KR101568457B1 - Diagnostic kit for Behcet's disease comprising GroEL - Google Patents

Abstract

The present invention relates to a kit for diagnosis of Behcet's disease comprising a GroEL or hnRNP-A2 / B1 antigen protein. According to the present invention, it is possible to produce a kit capable of specifically diagnosing Behcet's disease early using the antigen protein GroEL or hnRNAP A2 / B1 antigen protein of Behcet's disease, further providing a vaccine for treating Behcet's disease and a therapeutic composition Can be useful.

Description

[0001] The present invention relates to a kit for diagnosing Behcet's disease comprising GroEL,

The present invention relates to a kit for diagnosis of Behcet's disease comprising a GroEL or hnRNP-A2 / B1 antigen protein.

In general, Behcet's disease is one of the most threatening diseases in countries around Asia and the Mediterranean, including Japan, Korea and China, and is an inflammatory disease affecting the eyes and other organs. The exact cause of Behcet's disease has not yet been elucidated, but blood vessels, especially vascular endothelial cells, are known to be the first target of Behcet's disease. In addition, Streptococcus It has been shown that sanguis ( S. sanguis ) and herpes simplex virus play an important role in the development of Behcet's disease and α-enolase, glyceraldehyde-3-phosphate dihydrogenase Streptococcus protein, including glyceraldehyde-3-phosphate dehydrogenase, hypothetical protein and acid phosphatase, is known to react with serum IgM in patients with Behcet's disease. S. sanguis Is present in the mucous membranes of the mouth, colonic and vagina where symptoms of Behcet's disease are present and S. sanguis infection, which secretes IgA-protease in patients with Behcet's disease, is known to increase the IgA titer to these microorganisms or IgA-protease antigens have.

On the other hand, the treatment of patients with Behcet's disease was performed in various ways. These treatments include local, systemic, or medical treatments, but they did not produce satisfactory results. Through various experiments, it has been found that immunological changes play an important role in the pathogenesis of Behcet's disease. Immune changes in Behcet's disease include T cell activity and abnormal function of white blood cells. From an immunological point of view, mucosal lesions first penetrate CD4, CD8 cells, phagocytes, and dendritic cells, followed by neutrophils. Because the immunological process is involved in the progression of Behcet's disease, several medications that control the immune response have been used to treat Behcet's disease. These agents include corticosteroids, colchicine, cytotoxic drugs, and immunophilin ligands such as cyclosporin. However, these medicines have the potential to cause severe side effects if used over a long period of time.

The present inventors have found hnRNP A2 / B1 as an antigen protein of anti-endothelial cell IgA antibody in Behcet's disease and serum IgA reactivity to recombinant human hnRNP A2 / B1 is presumed to be a major etiology of Behcet's disease Was strongly associated with the reactivity of IgA to recombinant streptococcal Hsp-65 (Cho SB et al., J Invest Dermatol 2012; 132: 601-8).

Therefore, the present inventors have made efforts to find an antigen protein that causes Behçet's disease. As a result, it has been confirmed that the GroEL protein is an antigen protein of Behcet's disease. In particular, the protein of hCNAP A2 / B1 protein And confirmed the homozygous epitope, thereby completing the present invention.

It is an object of the present invention to provide a kit for diagnosis of Behcet's disease comprising GroEL or hnRNP-A2 / B1 antigen protein.

In order to achieve the above object, the present invention provides an antigenic epitope for detecting Behcet's disease, which is an amino acid sequence of SEQ ID NO: 1 to 57-70, an antigenic epitope for detecting Behcet's disease, an amino acid sequence of 347-358 in SEQ ID NO: 1, 2 to 33-46, and an antigenic epitope for detecting Behcet's disease, which is an amino acid sequence of 177-188 in SEQ ID NO: 2.

Also provided is an antigenic protein which induces Behcet's disease represented by SEQ ID NO: 1.

In another embodiment, the present invention provides a recombinant expression vector comprising a recombinant expression vector comprising a gene encoding the epitope and a gene encoding the antigen protein.

In another embodiment, the present invention provides a kit for the diagnosis of Behcet's disease comprising an antibody that specifically binds to a GroEL or hnRNP-A2 / B1 antigen protein or an antigenic protein thereof, wherein the GroEL's 57-70 or 347- 358 amino acid or a 33 -46 or 177-188 amino acid of hnRNP-A2 / Bl.

Previous studies have shown that therapeutic effects of autoimmune diseases can be obtained using protein analogs that specifically react with antibodies (Zacharie B et al., J Med Chem. 2010 Feb 11; 53 (3): Meyer O et al., Oncol. 2011; 34 (1-2): 10-3). Likewise, the Behçet's disease antigen protein GroEL or hnRNP-A2 / Bl can be used as a vaccine composition for Behcet's disease, and a composition for treating Behcet's disease can be provided using an antibody specifically reacting therewith.

In another embodiment, the present invention provides a vaccine for preventing Behcet's disease comprising GroEL or hnRNP-A2 / B1 antigen protein. At this time, it may be a vaccine for preventing Behcet's disease comprising amino acids 57-70 or 347-358 of GroEL or amino acids 33-46 or 177-188 of hnRNP-A2 / Bl.

The invention also provides, in another embodiment, a composition for treating Behçet's disease comprising an antibody that specifically reacts with GroEL or hnRNP-A2 / Bl, wherein the amino acid of GroEL at 57-70 or 347-358 Or an antibody that specifically reacts with amino acids 33-46 or 177-188 of hnRNP-A2 / Bl.

In the present invention, SEQ ID NO: 1 is a GroEL protein and SEQ ID NO: 2 is a hnRNP-A2 / B1 protein sequence.

As used herein, the term "vector" means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector And (c) a restriction enzyme cleavage site allowing the foreign DNA fragment to be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

"Transformation" of the present invention means that DNA is introduced into a host cell and DNA is replicable as a chromosomal factor or by chromosomal integration completion, which introduces an external DNA into a cell to cause an artificial genetic change . Generally, transformation methods include electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, lithium acetate-DMSO method, and the transformed recombinant microorganism is DNA And high expression efficiency of the introduced DNA are usually used. Bacteria, yeast, fungi, etc. can be used as all microorganisms including prokaryotic and eukaryotic cells.

The kit for diagnosing Behcet's disease of the present invention is basically applied to immunoassay to diagnose Behcet's disease. Such immunoassay can be performed according to various immunoassay or immunostaining protocols developed conventionally. The immunoassay or immunohistochemical staining formats can be used in a variety of ways including, but not limited to, radioimmunoassays, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hardwood analysis, sandwich analysis, flow cytometry, ≪ / RTI > and immunoaffinity purification. Methods of immunoassay or immunostaining are described in Enzyme Immunoassay, ET Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, JM ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference. In the ELISA method and the capture-ELISA method, measurement of the activity of the final enzyme or measurement of the signal can be performed according to various methods known in the art. If biotin is used as a label, it can be easily detected by streptavidin. When luciferase is used, luciferin can easily detect a signal. By analyzing the intensity of the final signal by the above-described immunoassay, it is possible to diagnose Behcet's disease.

According to the present invention, it is possible to produce a kit capable of specifically diagnosing Behcet's disease early using the antigen protein GroEL or hnRNAP A2 / B1 antigen protein of Behcet's disease, further providing a vaccine for treating Behcet's disease and a therapeutic composition Can be useful.

FIG. 1 shows the results of observation of four protein bands by performing immunoprecipitation using S. sanguis .
Figure 2 shows homologous epitope regions between GroEL and hnRNAP A2 / Bl through sequence comparison.
Figure 3 shows ELISA results using recombinant homologous epitope proteins.

Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Preparation of samples

The present invention is based on 100 patients with Behcet's disease who meet clinical diagnostic criteria for Behcet's disease. The demographic characteristics of the patients are shown in Table 1. All patients with Behcet's disease had benign diseases that met at least two major categories. Serum from 70 healthy donors (Innovative Research Inc., Novi, MI, USA) was used as a control and all serum samples were stored at minus 70 ° C. Patients 'medical records were reviewed to investigate the clinical features, urinalysis results, and other laboratory test results of Behcet' s disease. The laboratory tests included complete blood counts, glucose levels, renal and hepatic function tests, ESR (normal range, = 20 mm / hour), C reactive protein (CRP; Tests include anti-streptolysin O (normal range, = 200 IU / ml), rheumatoid factor, antinuclear antibody test, sexually transmitted disease and HLAB51 genotyping.

Number of BD patients Age ^*          40.6 ± 11.4 gender       male  30       female  70 canker 100 Genital ulcer  88 Skin lesion  96 Ocular lesion  35 Joint involvement  41 GI Invasion  14 Blood vessel invasion   6 Central nervous system involvement   6 Epididymitis   One Positive abnormal hypersensitivity test  13 Positive HLA-B51  32 ASO (IU / ml) ^**             67 (37.5-113.5) ESR (mm / hour) ^**            38 (19.0-60.5) CRP (mg / dL) ^**              4.18 (2.4-13.3)

S. sanguis Antigens and LC - MALDI - TOF / TOF  Analytical Immune sedimentation

S. sanguis (American Type Culture Collection (ATCC) 42927) was cultured in TSB medium (tryptic soy broth: Sigma, St. Louis, Mo., USA) and dissolved in RIPA buffer. Whole cell extracts (500 μg) were incubated with mixed serum for 16 hours. The G-Sepharose protein was preincubated with 5 μg of goat anti-human IgA and then G-Sepharose beads washed with PBS buffer were added and mixed overnight at 4 ° C. The precipitated protein (immunoprecipitate) was suspended in a sample buffer containing 100 mM dithiothreitol and 4 M urea and subjected to 10% SDS-PAGE. LC-MALDI-TOF / TOF analysis was then performed on the removed gel fragments. For search data screening, only proteins with a Mascot score of 30 or greater were chosen to have broad homology.

Structure and Expression of Expression Vectors

S. sanguis The protein coding region of GroEL was amplified by PCR using a 5 'oligonucleotide primer (CGAGCCTCGAGATGGCAAAAGATATTAAATT) with a Xho I restriction site and a 3' oligonucleotide primer (CGGAATTCCTACATCATACCGCCCATCATGC) with an Eco RI restriction enzyme site. The protein coding region of human hnRNP A2 / B1 was amplified by PCR using a 5 'oligonucleotide primer (CGAGCCTCGAGATGGAGAAAACTTTAGAAACTG) with a Xho I restriction site and a 3' oligonucleotide primer (CGGAATTCTCAGTATCGGCTCCTCCCACCATAACCCCCAC) with an Eco RI restriction site. The PCR amplification product was purified, digested with restriction enzymes, cloned into pRSET expression vector (Invitrogen), and all the constructs were confirmed by DNA sequencing. S. sanguis GroEL and human hnRNP A2 / B1 were overexpressed in E. coli BL21, and the produced recombinant protein was purified using Ni-NTA resin according to the manufacturer's instructions. Protein samples were stored at minus 30 ° C.

Recombination S. sanguis GroEL  And human hnRNP  Using A2 / B1 Western Blotting

Purified recombinant S. sanguis GroEL (1 [mu] g) and human hnRNP A2 / B1 (1 [mu] g) were suspended in sample buffer. The sample was loaded on a 12% polyacrylamide gel and electrophoresed at 100V. Membranes were occasionally pumped with serum samples from control or Behcet's disease patients (1: 500 with primary antibody dilution buffer (1% non-fat skim milk, 10 mM Tris pH 7.5, 100 mM NaCl, 0.1% Tween 20) Lt; RTI ID = 0.0 > 4 C < / RTI > overnight. Membranes were washed six times with PBST and diluted 1: 10,000 with blocking buffer (1% non-fat dry milk, 10 mM Tris pH 7.5, 100 mM NaCl, 0.1% Tween 20) and the peroxidase- And incubated with goat anti-human IgA antibody for 1 hour at room temperature. Then, chemiluminescence was observed.

ELISA

IgA ELISAs were performed using recombinant target epitope proteins. A 96-well microtiter plate (Immuno2, HB, Thermo Scientific, Waltham, MA, USA) was coated with 300 ng target epitope protein overnight. Thereafter, 100 μL of serum (diluted 1:20 in PBST containing 1% bovine serum albumin (Sigma, St Louis, MO, USA) from 10 BD patients and 10 normal controls was added to each well, Were incubated at 37 [deg.] C for 2 hours. Antibody binding was quantified colorimetrically by adding a substrate (tetramethylbenzidine, Sigma) to each well. The optical density of the plate was measured with a spectrophotometer at 450 nm in an ELISA reader (Dynatech, Alexandria, VA, USA).

Statistical analysis

Recombinant S. sanguis in patients with Behcet's disease and normal control A chi-square test (Fisher's exact test) was used to analyze differences in serum reactivity to GroEL and human hnRNP A2 / B1. McNemar's test was used to determine the association between the results of anti-recombinant S. sanguis GroEL IgA antibody experiments and anti-recombinant human hnRNP A2 / B1 IgA antibody experiments. Clinical characteristics and laboratory characteristics of patients with Behcet's disease with serum anti-recombinant S. sanguis GroEL IgA antibody and / or anti-recombinant human hnRNP A2 / B1 IgA antibody and recombinant S. sanguis GroEL and / or human hnRNP A2 / Using the Student's t test, Mann-Whitney U test, chi-square test (Fisher's exact test), logistic regression analysis, and linear regression analysis Respectively. All analyzes were performed using SAS software version 9.1.3 (SAS Institute Inc., Cary, NC, USA). P-value <0.05.

Immunoprecipitation and proteomic analysis

S. sanguis reacting with IgA antibodies in serum samples obtained from five patients with Behcet's disease The extract was immunoprecipitated (Figure 1). Four protein bands obtained by immunoprecipitation were excised from polyacrylamide gel, digested with trypsin, and the cleaved protein fragment was analyzed by LC-MALDI-TOF / TOF to obtain a peptide fingerprint. False positives involving immunoglobulins were found using the excluded NCBI data to identify DNA sequences corresponding to the four protein bands. In particular, the following proteins were found to have a Mascot score of greater than 30: foldase protein PrsA, von Willebrand factor type A, ATPase involved in DNA repair, C1q B-chain precursor, 50S ribosomal protein L1, flagellar FliF M-ring protein, flavoprotein NrdI, glyceraldehyde-3-phosphate dehydrogenase, and chaperonin GroEL (Table 2). Among these proteins, the streptococcal chaperonin GroEL (Molecular weight (M _r ) / p I , 57093 / 4.73; NCBI accession number, gi | 315316118; Swiss-Prot accession number, EFU64148; Mascot score, 60-kDa chaperonin or Hsp-65, and further analysis was performed in the present invention.

Spot number Identified protein Swiss-Prot accession number NCBI accession number M r (kDa) / p I Mascot score One Foldase protein PrsA ZP_06199103 gi│270292892 34349 / 5.08 143 2 von Willebrand factor, type A ZP_01748840 gi | 126733085 36066 / 3.72 31 3 ATPase involved in DNA repair ZP_01201100 gi│89889589 188466 / 5.14 31 4 C1q B-chain precursor CAA26880 gi | 573114 24154 / 8.85 57 5 50S ribosomal protein L1 NP_345142 gi│15900538 24480 / 9.22 83 6 Flagellar FliF M-ring protein YP_002514037 gi│220935138 60117 / 5.40 37 7 Flavoprotein Nrdi NP_357750 gi | 15902200 22950 / 6.90 54 8 Glyceraldehyde-3-phosphate dehydrogenase BAD37146 gi | 51534656 35929 / 5.39 67 9 Chaperonin GroEL EFU64148 gi | 315316118 57093 / 4.73 733

Recombination S. sanguis GroEL  And recombinant human hnRNP  A2 / B1 and the reactivity between serum of patients with Behcet's disease

S. sanguis GroEL was overexpressed in E. coli BL21 and the recombinant protein was purified using Ni-NTA resin. Western blotting assays of recombinant S. sanguis GroEL and recombinant human hnRNP A2 / B1 were performed to evaluate serum reactivity using serum from 100 Behcet's disease patients and 70 healthy controls. Serum IgA reactivity to recombinant S. sanguis GroEL was observed in 77 of 100 patients with Behcet's disease (77%) and reactivity to recombinant human hnRNP A2 / B1 was observed in 79 of 100 Behcet's disease patients (79 %). The McNemar's test results showed no difference between the results of anti-recombinant S. sanguis GroEL IgA antibody and anti-recombinant human hnRNP A2 / B1 IgA antibody ( P = 0.845). However, IgA reactivity to recombinant S. sanguis GroEL and recombinant human hnRNP A2 / B1 was observed in 21 (30%) and 8 (11.4%) in 70 healthy controls, respectively. The McNemar's test results showed a significant difference ( P = 0.004) between the anti-recombinant S. sanguis GroEL IgA antibody test and the anti-recombinant human hnRNP A2 / B1 IgA antibody results in a healthy control.

Serum IgA reactivity for both recombinant S. sanguis GroEL ( P <0.0001) and recombinant human hnRNP A2 / Bl ( P <0.0001) was significantly higher in patients with Behcet's disease than in the normal controls. Of 100 patients with Behcet 's disease, 65 had seroregent reactivity (65%) for two recombinant proteins and 91 patients showed serum reactivity (91%) for at least one of the two proteins. On the other hand, five of the normal controls responded to both recombinant proteins (7.1%) and 24 of the sera showed reactivity to at least one (34.3%).

Behcet's disease In patients  term- S. sanguis GroEL  And / or hnRNP  A2 / B1 IgA  Identification of clinical features by antibodies

Of the 100 patients with Behcet's disease, 77 (23 males, 54 females, mean age 40.5 ± 11.1 years) were positive for recombinant S. sanguis GroEL, whereas 23 patients (7 males, 16 females, Mean age was 40.9 ± 12.6 years). The following symptoms were observed in patients with Behcet's disease who were positive for recombinant S. sanguis GroEL: 77 (100%) oral ulcers, 75 (97.4%) skin lesions, ), Genital ulcers 65 (84.4%), articular involvement 29 (37.7%), ocular involvement 29 (37.7%), gastrointestinal lesions 12 15.6%), vascular involvement 5 (6.5%), and central nervous system involvement 5 (6.5%). For the anti- S. sanguis GroEL IgA antibody, the HLA-B51 test was positive in 23 (29.9%) of 77 patients with Behcet's disease and 11 (14.3%) in the pathergy test. .

Among 100 patients with Behcet's disease, 79 (23 males, 56 females, mean age 40.8 ± 11.5 years) were positive for recombinant human hnRNP A2 / B1, whereas 21 (7 males, 14 females, Mean age 40.0 ± 11.3 years) showed negative reactivity. The following symptoms were observed in patients with Behcet's disease who were positive for the recombinant human hnRNP A2 / Bl: repeated ulcers (100%), skin lesions (75) (94.9 ), Genital ulcers 68 (86.1%), articular involvement 32 (40.5%), ocular involvement 28 (35.4%), gastrointestinal lesions 12 (15.2%), vascular involvement in 4 (5.1%) and central nervous system involvement in 6 (7.6%). For the anti-human hnRNP A2 / B1 IgA antibody, the HLA-B51 test was positive in 24 (30.4%) of 79 patients with Behcet's disease and 12 (15.2%) in the pathergy test. ).

Behcet's disease In patients  serum IgA  Homologous to antibody Epitope  Identifying areas

The alignment algorithm of T-Coffee was used to identify homology sequences between streptococcal GroEL and human hnRNP A2 / B1 (Notredame C et al., J Mol Biol 2000; 302: 205-17). Eight distinct epitopes were identified that showed significant homology, and each candidate epitope was synthesized and purified (Peptron Inc., Korea). ELISA was performed using serum and recombinant candidate epitopes from 10 patients with Behcet's disease who showed serum iGa reactivity for both streptococcal GroEL and human hnRNP A2 / B1.

Serum IgA reactivity to epitope 2 (9-28 of hnRNP A2 / B1 peptide and 32-51 of GroEL peptide) was observed in 3 of 10 patients with Behcet's disease (30%), and epitope 3 (70%) of the hNRNP A2 / B1 peptides and 33-46 of the hnRNP A2 / B1 peptides and 57-70 of the GroEL peptides. In addition, serum IgA reactivity to epitope 6 (177-188 of hnRNP A2 / B1 peptide and 347-358 of GroEL peptide) was observed in 7 patients (70%) and epitope 7 (hnRNP A2 / B1 Serum IgA reactivity (40%) against epitope 8 (203-212 of hnRNP A2 / B1 peptide and 373-382 of hNRNP A2 / B1 peptide and 373-382 of GroEL peptide) in 4 patients IgA reactivity (40%) was observed. However, all 10 patients with Behcet's disease had epitope 1 (1-8 of hnRNP A2 / B1 peptide and 1-8 of GroEL peptide), epitope 4 (127-143 of hnRNP A2 / B1 peptide and 193-209 of GroEL peptide) , Epitope 5 (164-176 of hnRNP A2 / B1 peptide and 316-328 of GroEL peptide).

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> Diagnostic kit for Behcet's disease comprising GroEL and          hnRNP-A2 / B1 <130> IPDB46380 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 540 <212> PRT <213> Streptococcus sanguinis <400> 1 Met Ser Lys Glu Ile Lys Phe Ser Ser Asp Ala Arg Ser Ala Met Val   1 5 10 15 Arg Gly Val Asp Ile Leu Ala Asp Thr Val Lys Val Thr Leu Gly Pro              20 25 30 Lys Gly Arg Asn Val Val Leu Glu Lys Ser Phe Gly Ser Pro Leu Ile          35 40 45 Thr Asn Glu Val Thr Ile Ala Lys Glu Ile Glu Leu Glu Asp His      50 55 60 Phe Glu Asn Met Gly Ala Lys Leu Val Ser Glu Val Ala Ser Lys Thr  65 70 75 80 Asn Asp Ile Ala Gly Asp Gly Thr Thr Thr Ala Thr Val Leu Thr Gln                  85 90 95 Ala Ile Val Arg Glu Gly Ile Lys Asn Val Thr Ala Gly Ala Asn Pro             100 105 110 Ile Gly Ile Arg Gly Ile Glu Ala Ala Val Ala Ala Ala Val Glu         115 120 125 Ala Leu Lys Asn Ala Ile Ala Ila Pro Ala Asn Lys Glu Ala Ile Ala     130 135 140 Gln Val Ala Val Ser Ser Arg Ser Glu Lys Val Gly Glu Tyr Ile 145 150 155 160 Ser Glu Ala Met Glu Lys Val Gly Lys Asp Gly Val Ile Thr Ile Glu                 165 170 175 Glu Ser Arg Gly Met Glu Thr Glu Leu Glu Val Val Glu Gly Met Gln             180 185 190 Phe Asp Arg Gly Tyr Leu Ser Gln Tyr Met Val Thr Asp Ser Glu Lys         195 200 205 Met Val Ala Asp Leu Glu Asn Pro Tyr Ile Leu Ile Thr Asp Lys Lys     210 215 220 Ile Ser Asn Ile Gln Glu Ile Leu Pro Leu Leu Glu Ser Ile Leu Gln 225 230 235 240 Ser Asn Arg Pro Leu Leu Ile Ile Ala Asp Asp Val Asp Gly Glu Ala                 245 250 255 Leu Pro Thr Leu Val Leu Asn Lys Ile Arg Gly Thr Phe Asn Val Val             260 265 270 Ala Val Lys Ala Pro Gly Phe Gly Asp Arg Arg Lys Ala Met Leu Glu         275 280 285 Asp Ile Ale Ile Leu Thr Gly Gly Thr Val Ile Thr Glu Asp Leu Gly     290 295 300 Leu Glu Leu Lys Asp Ala Thr Ile Glu Ala Leu Gly Gln Ala Ala Arg 305 310 315 320 Val Thr Val Asp Lys Asp Ser Thr Val Ile Val Glu Gly Ala Gly Asn                 325 330 335 Pro Glu Ala Ile Phe His Arg Val Ala Val Ile Lys Ser Gln Ile Glu             340 345 350 Thr Thr Ser Glu Phe Asp Arg Glu Lys Leu Gln Glu Arg Leu Ala         355 360 365 Lys Leu Ser Gly Gly Val Ala Val Ile Lys Val Gly Ala Ala Thr Glu     370 375 380 Thr Glu Leu Lys Glu Met Lys Leu Arg Ile Glu Asp Ala Leu Asn Ala 385 390 395 400 Thr Arg Ala Ala Val Glu Glu Gly Ile Val Ala Gly Gly Gly Thr Ala                 405 410 415 Leu Ala Asn Val Ile Pro Ala Val Ala Asp Leu Glu Leu Thr Gly Asp             420 425 430 Glu Ala Thr Gly Arg Asn Ile Val Leu Arg Ala Leu Glu Glu Pro Val         435 440 445 Arg Gln Ile Ala His Asn Ala Gly Phe Glu Gly Ser Ile Val Ile Asp     450 455 460 Arg Leu Lys Asn Ala Gla Val Gly Thr Gly Phe Asn Ala Ala Thr Gly 465 470 475 480 Glu Trp Val Asn Met Ile Glu Glu Gly Ile Ile Asp Pro Val Lys Val                 485 490 495 Ser Arg Ser Ala Leu Gln Asn Ala Ala Ser Val Ala Ser Leu Ile Leu             500 505 510 Thr Thr Glu Ala Val Val Ala Asn Lys Pro Glu Pro Val Ala Pro Ala         515 520 525 Pro Ala Met Asp Pro Ser Met Met Gly Gly Met Met     530 535 540 <210> 2 <211> 353 <212> PRT <213> homo sapiens <400> 2 Met Glu Lys Thr Leu Glu Thr Val Pro Leu Glu Arg Lys Lys Arg Glu   1 5 10 15 Lys Glu Gln Phe Arg Lys Leu Phe Ile Gly Gly Leu Ser Phe Glu Thr              20 25 30 Thr Glu Glu Ser Leu Arg Asn Tyr Tyr Glu Gln Trp Gly Lys Leu Thr          35 40 45 Asp Cys Val Val Met Arg Asp Pro Ala Ser Lys Arg Ser Ser Gly Phe      50 55 60 Gly Phe Val Thr Phe Ser Ser Met Ala Glu Val Asp Ala Ala Met Ala  65 70 75 80 Ala Arg Pro His Ser Ile Asp Gly Arg Val Val Glu Pro Lys Arg Ala                  85 90 95 Val Ala Arg Glu Glu Ser Gly Lys Pro Gly Ala His Val Thr Val Lys             100 105 110 Lys Leu Phe Val Gly Gly Ile Lys Glu Asp Thr Glu Glu His His Leu         115 120 125 Arg Asp Tyr Phe Glu Glu Tyr Gly Lys Ile Asp Thr Ile Glu Ile Ile     130 135 140 Thr Asp Arg Gln Ser Gly Lys Lys Arg Gly Phe Gly Phe Val Thr Phe 145 150 155 160 Asp Asp His Asp Pro Val Asp Lys Ile Val Leu Gln Lys Tyr His Thr                 165 170 175 Ile Asn Gly His Asn Ala Glu Val Arg Lys Ala Leu Ser Arg Gln Glu             180 185 190 Met Gln Glu Val Gln Ser Ser Arg Ser Gly Arg Gly Gly Asn Phe Gly         195 200 205 Phe Gly Asp Ser Arg Gly Gly Gly Gly Asn Phe Gly Pro Gly Pro Gly     210 215 220 Ser Asn Phe Arg Gly Gly Ser Asp Gly Tyr Gly Ser Gly Arg Gly Phe 225 230 235 240 Gly Asp Gly Tyr Asn Gly Tyr Gly Gly Gly Gly Pro Gly Gly Gly Gly Asn Phe                 245 250 255 Gly Gly Ser Pro Gly Tyr Gly Gly Gly Arg Gly Gly Tyr Gly Gly Gly             260 265 270 Gly Pro Gly Tyr Gly Asn Gly Gly Gly Gly Gly Tyr Gly Gly Gly Tyr Asp         275 280 285 Asn Tyr Gly Gly Gly Asn Tyr Gly Ser Gly Asn Tyr Asn Asp Phe Gly     290 295 300 Asn Tyr Asn Gln Gln Pro Ser Asn Tyr Gly Pro Met Lys Ser Gly Asn 305 310 315 320 Phe Gly Gly Ser Arg Asn Met Gly Gly Pro Tyr Gly Gly Gly Asn Tyr                 325 330 335 Gly Pro Gly Gly Ser Gly Gly Ser Gly Gly Tyr Gly Gly Arg Ser Ser             340 345 350 Tyr    

Claims (18)

An antigenic epitope for detecting Behcet's disease having an amino acid sequence of 57-70 or 347-358 in SEQ ID NO: 1.
delete delete delete delete A recombinant expression vector comprising a gene encoding the epitope of claim 1.
delete A transformant, excluding human, comprising the recombinant expression vector of claim 6.
delete A GroEL antigenic epitope of amino acid sequence 57-70 or 347-358 of GroEL, or an antibody that specifically binds to said antigenic epitope. delete delete delete delete delete delete delete delete

Images