KR101514631B1 - A kit for diagnosing behcet's disease comprising antibodies against herpes simplex virus type 1 ul48 protein - Google Patents

A kit for diagnosing behcet's disease comprising antibodies against herpes simplex virus type 1 ul48 protein Download PDF

Info

Publication number
KR101514631B1
KR101514631B1 KR1020130158140A KR20130158140A KR101514631B1 KR 101514631 B1 KR101514631 B1 KR 101514631B1 KR 1020130158140 A KR1020130158140 A KR 1020130158140A KR 20130158140 A KR20130158140 A KR 20130158140A KR 101514631 B1 KR101514631 B1 KR 101514631B1
Authority
KR
South Korea
Prior art keywords
disease
protein
behcet
serum
antibody
Prior art date
Application number
KR1020130158140A
Other languages
Korean (ko)
Inventor
조성빈
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Priority to KR1020130158140A priority Critical patent/KR101514631B1/en
Application granted granted Critical
Publication of KR101514631B1 publication Critical patent/KR101514631B1/en

Links

Images

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983Viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/42Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum viral
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/01DNA viruses
    • G01N2333/03Herpetoviridae, e.g. pseudorabies virus

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention relates to a Bechet′s disease diagnosing kit including antibodies against herpes virus protein U48. Bechet′s disease can be specifically and quickly diagnosed by the Bechet′s disease diagnosing kit of the present invention. Furthermore, Bechet′s disease can be treated by the antibodies.

Description

헤르페스바이러스 단백질 U48에 대한 항체를 포함하는 베체트병 진단 키트 {A kit for diagnosing Behcet’s disease comprising antibodies against herpes simplex virus type 1 UL48 protein}[0001] The present invention relates to a kit for diagnosing Behcet's disease comprising antibodies against the herpes virus protein U48, a herpes simplex virus type 1 UL48 protein,

본 발명은 헤르페스바이러스 단백질 U48에 대한 항체를 포함하는 베체트병 진단 키트에 관한 것이다. The present invention relates to a Behcet's disease diagnostic kit comprising an antibody against the herpes virus protein U48.

베체트병의 정확한 발병 원인은 아직 밝혀지지 않았지만, 혈관, 특히 혈관내피세포가 베체트병의 첫번째 타겟인 것으로 알려져 있다. 또한, 스트렙토코커스 상귀스(Streptococcus sanguis (S. sanguis)와 단순헤르페스바이러스(herpes simplex virus)가 베체트병의 발생에 중요한 역할을 하는 것이 밝혀져 있고, α-에놀라제(α-enolase), 글리세르알데히드-3-인산디히드로게나아제 (glyceraldehyde-3-phosphate dehydrogenase), 가설단백질(hypothetical protein) 및 산성인산가수분해효소(acid phosphatase)를 포함하는 스트렙토코커스 단백질은 베체트병 환자에서 혈청 IgM과 반응하는 것으로 알려져 있다. 하지만, 바체트병에 대한 항원은 정확히 알려진 바가 없다.The exact cause of Behcet's disease has not yet been elucidated, but blood vessels, especially vascular endothelial cells, are known to be the first target of Behcet's disease. It has also been shown that Streptococcus sanguis (S. sanguis) and herpes simplex virus play an important role in the development of Behcet's disease, and α-enolase, Streptococcus proteins, including glyceraldehyde-3-phosphate dehydrogenase, hypothetical protein and acid phosphatase, have been shown to react with serum IgM in patients with Behcet's disease However, the antigen for Bachert's disease is not known exactly.

이에 본 발명자들은 베체트병 환자의 혈청과 헤르페스 단순 바이러스 단백질인 UL48(VP16)이 반응함을 확인하여 본 발명을 완성하였다.
Thus, the present inventors have confirmed that the serum of the patients with Behcet's disease reacts with the herpes simplex virus protein UL48 (VP16), thereby completing the present invention.

본 발명은 베체트병을 진단하기 위하여 헤르페스바이러스 단백질 U48 또는 이의 항체를 포함하는 베체트병 진단 키트를 제공하는 것을 목적으로 한다. 또한, 헤르페스바이러스 단백질 U48 또는 이의 항체를 이용하여 베체트병 항원 또는 항체를 검출하여 진단하는 방법을 제공하는 것을 목적으로 한다.
It is an object of the present invention to provide a Behcet's disease diagnostic kit comprising the herpes virus protein U48 or an antibody thereof for diagnosis of Behcet's disease. It is another object of the present invention to provide a method for detecting and diagnosing a Behcet's disease antigen or antibody using the herpes virus protein U48 or an antibody thereof.

이하, 본 발명의 구성요소와 기술적 특징을 다음의 실시예들을 통하여 보다 상세하게 설명하고자 한다. 그러나 하기 실시예들은 본 발명의 내용을 예시하는 것일 뿐 발명의 범위가 실시예에 의해 한정되는 것은 아니다.Hereinafter, the components and technical features of the present invention will be described in more detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention and are not intended to limit the scope of the invention.

본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물, 및 공정 등이 기재되어 있다. 그러나, 특정의 구체예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예"에 대한 본 명세서 전체를 통한 참조는 구체예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현 "한 가지 구체예에서" 또는 "구체예"의 상황은 반드시 본 발명의 동일한 구체예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다.Various embodiments described herein are described with reference to the drawings. In the following description, for purposes of complete understanding of the present invention, various specific details are set forth, such as specific forms, compositions, and processes, and the like. However, certain embodiments may be practiced without one or more of these specific details, or with other known methods and forms. In other instances, well-known processes and techniques of manufacture are not described in any detail, in order not to unnecessarily obscure the present invention. Reference throughout this specification to "one embodiment" or "embodiment" means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in at least one embodiment of the invention. Accordingly, the appearances of the phrase " in one embodiment "or" the embodiment "in various places throughout this specification are not necessarily indicative of the same embodiment of the present invention. In addition, a particular feature, form, composition, or characteristic may be combined in any suitable manner in one or more embodiments.

본 발명의 일 구체예에서, 헤르페스 바이러스 UL48 단백질에 대한 항체를 포함하는 베체트병 진단용 키트를 제공한다. 상기 구체예에서, 항체는 IgA 또는 IgG인 것을 특징으로 하는 베체트병 진단용 키트를 제공하고, UL48 단백질은 서열번호 1로 표시되는 것을 특징으로 하는 베체트병 진단용 키트를 제공한다.In one embodiment of the present invention, a kit for the diagnosis of Behcet's disease comprising an antibody against the herpes virus UL48 protein is provided. In the above embodiment, the antibody is IgA or IgG, and the kit for diagnosing Behcet's disease is provided, wherein the UL48 protein is represented by SEQ ID NO: 1.

본 발명의 일 구체예에서, 헤르페스 바이러스 UL48 단백질을 포함하는 베체트병 진단용 키트를 제공한다. 상기 구체예에서, UL48 단백질은 베체트병을 가지는 환자의 혈청내 항체와 특이적으로 결합하는 것을 특징으로 하는 베체트병 진단용 키트를 제공하고, UL48 단백질은 서열번호 1로 표시되는 것을 특징으로 하는 베체트병 진단용 키트를 제공한다.In one embodiment of the present invention, a kit for the diagnosis of Behcet's disease comprising herpes virus UL48 protein is provided. In this embodiment, the UL48 protein specifically binds to an antibody in the serum of a patient having Behçet's disease, and the UL48 protein is a Bethel disease Provide a diagnostic kit.

본 발명의 일 구체예에서, 피검체의 혈청과 헤르페스 바이러스 UL48 단백질에 대한 항체 반응시키는 단계; 및 헤르페스 바이러스 UL48 단백질에 대한 항체와 특이적 면역반응성 여부를 확인하는 단계를 포함하는 피검체 혈청 내 베체트병 항원을 검출하는 방법을 제공한다. 상기 구체예에서, 항체는 IgA 또는 IgG 인 것을 특징으로 하는 피검체 혈청 내 베체트병 항원을 검출하는 방법을 제공하고, UL48 단백질은 서열번호 1로 표시되는 것을 특징으로 하는 피검체 혈청 내 베체트병 항원을 검출하는 방법을 제공한다.In one embodiment of the present invention, there is provided a method for detecting a herpes virus UL48 protein, comprising: reacting a sera of a subject with an herpes virus UL48 protein; And confirming whether or not a specific immunoreactivity with the antibody against the herpes virus UL48 protein is present in the serum of the subject. Wherein the antibody is IgA or IgG, wherein the UL48 protein is selected from the group consisting of a Behcet's disease antigen Is detected.

본 발명의 일 구체예에서, 피검체의 혈청과 헤르페스 바이러스 UL48 단백질을 반응시키는 단계; 및 피검체의 혈청과 헤르페스 바이러스 UL48 단백질의 특이적 면역반응성 여부를 확인하는 단계를 포함하는 피검체 혈청 내 베체트병 항체를 검출하는 방법을 제공한다. 상기 구체에에서, 피검체의 혈청내 항체는 IgA 또는 IgG 인 것을 특징으로 하는 피검체 혈청 내 베체트병 항체를 검출하는 방법을 제공하고, UL48 단백질은 서열번호 1로 표시되는 것을 특징으로 하는 피검체 혈청 내 베체트병 항체를 검출하는 방법을 제공한다.In one embodiment of the present invention, there is provided a method comprising: reacting a sera of a subject with a herpes virus UL48 protein; And a step of confirming whether the serum of the subject and the herpes virus UL48 protein are specifically immunoreactive. The present invention also provides a method for detecting a Behçet's disease antibody in a serum of a subject. The present invention provides a method for detecting a Behcet's disease antibody in a serum of a subject, wherein the antibody in the serum of the subject is IgA or IgG, and the UL48 protein is a protein having the amino acid sequence of SEQ ID NO: A method for detecting a Behcet's disease antibody in serum is provided.

본 발명의 일 구체예에서, 헤르페스 바이러스 UL48 단백질에 대한 항체를 유효성분으로 포함하는 베체트병 치료용 약학조성물을 제공한다.In one embodiment of the present invention, there is provided a pharmaceutical composition for treating Behcet's disease comprising an antibody against the herpes virus UL48 protein as an active ingredient.

본 발명의 일 구체예에서, 베체트병은 여러 기관에서 발병하는 질환으로 인식되고 있으며, 구강, 음부궤양, 안병변 및 피부병변을 주증상으로 하고, 주로 심혈관계, 호흡기계, 소화기계, 중추신경계, 비뇨기계 등에서 발병하여 다양한 증상을 나타내고 있다. 베체트병은 전세계적으로 보고되어 있으나, 서유럽, 미국 등에서는 비교적 드물게 보고되고 있다. 터어키, 그리이스, 이탈리아, 레바논, 아라비아 지역 등 지중해 연안국가와 한국, 일본, 중국에서 호발하여, 역사적으로 일명 비단길(silk road)과 어떤 연관성이 있을 것으로 보고 있다. 남녀분포를 살펴보면, 남:여의 비율이 중동지역의 이스라엘(3.8:1), 터어키(3.3:1), 이라크(3.8:1) 등과 지중해 연안의 그리이스(4.3:1), 이탈리아(4.8:1) 등에서는 남자의 발생 비율이 높았던 반면, 일본(0.95:1), 중국(0.75:1)에서는 여자의 발생빈도가 높았고, 국내 보고에서도 여자의 빈도가 높아서 유전학적 유사성이 관여할 것으로 보인다. 그러나, 본 질환에서 HLA-B5의 빈도가 일본, 영국, 터어키, 프랑스, 이스라엘 및 한국과 같이 인종적으로 서로 다른 국가에서 공통적으로 높게 나와서, 환경 및 문화적 유사성도 관여하리라 여겨지고 있다. 국내의 보고에 의하면, 발병당시 환자의 연령분포는 20대가 가장 많고, 직업분포에서 남자는 사무직이, 여자는 가정주부가 많고, 전체 환자의 약 15%에서 가족력이 있었다. 이 질환의 원인으로는, 바이러스설, 연쇄상 구균항원에 대한 알레르기설, 중금속 중독설, 유전학적 관련설, 면역기전설 등이 있으나 확실한 것은 없으며, 진단은 뚜렷한 검사방법 이 없어서 주로 임상적 양상에 의존하고 있다.In one embodiment of the present invention, Behcet's disease is recognized as a disease that occurs in various organs, and is characterized by oral, vaginal ulceration, ocular lesions, and skin lesions as main symptoms, and mainly includes cardiovascular, respiratory, digestive, , Urinary tract, and the like. Although Behcet's disease has been reported worldwide, it has been reported relatively rarely in Western Europe and the United States. It is expected to have something to do with silk roads in history, especially in Mediterranean countries like Turkey, Greece, Italy, Lebanon, Arabia and Korea, Japan and China. The ratio of male to female in the Middle East is 3.8: 1, Turkey is 3.3: 1, Iraq is 3.8: 1, Greece is Mediterranean: 4.3: 1, Italy is 4.8: 1 ), Whereas in Japan (0.95: 1) and China (0.75: 1), the incidence of female was high and in female, frequency of female was high. However, the incidence of HLA-B5 in this disease is common in racially different countries, such as Japan, the United Kingdom, Turkey, France, Israel and Korea, and is believed to be related to environmental and cultural similarities. According to the domestic reports, the age distribution of the patients was the largest in the 20s, and the occupation distribution of the patients was office workers, female housewives, and family history of about 15% of the patients. The cause of the disease is viral, allergic to streptococcal antigen, heavy metal poisoning, genetic association, immune system legend, but there is no definite diagnosis. .

본 발명에서 "벡터 (vector)"는 적합한 숙주 내에서 DNA를 발현시킬 수 있는 적합한 조절 서열에 작동가능하게 연결된 DNA 서열을 함유하는 DNA 제조물을 의미한다. 벡터는 플라스미드, 파지 입자 또는 간단하게 잠재적 게놈 삽입물 일수 있다. 적당한 숙주로 형질전환되면, 벡터는 숙주게놈과 무관하게 복제하고 기능할 수 있거나, 또는 일부 경우에 게놈 그 자체에 통합될 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이므로, 본 발명의 명세서에서 "플라스미드(plasmid)" 및 "벡터(vector)"는 때로 상호교환적으로 사용된다. 본 발명의 목적상, 플라스미드 벡터를 이용하는 것이 바람직하다. 이러한 목적에 사용될 수 있는 전형적인 플라스미드 벡터는 (a) 숙주세포당 수백개의 플라스미드벡터를 포함하도록 복제가 효율적으로 이루어지도록하는 복제 개시점, (b) 플라스미드 벡터로 형질전환된 숙주세포가 선발될 수 있도록 하는 항생제 내성 유전자 및 (c) 외래 DNA 절편이 삽입될 수 있도록 하는 제한효소 절단부위를 포함하는 구조를 지니고 있다. 적절한 제한효소 절단부위가 존재하지 않을지라도, 통상의 방법에 따른 합성 올리고뉴클레오타이드어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용하면 벡터와 외래 DNA를 용이하게 라이게이션(ligation) 할 수 있다.As used herein, the term "vector" means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, a phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector And (c) a restriction enzyme cleavage site allowing the foreign DNA fragment to be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

본 발명의 베체트병 진단용 키트는, 기본적으로 면역분석(immunoassay)에 적용되어 베체트병을 진단한다. 이러한 면역분석은 종래에 개발된 다양한 면역분석(immunoassay) 또는 면역염색(immunostaining) 프로토콜에 따라 실시될 수 있다. 상기 면역분석 또는 면역염색 포맷은 방사능면역분석, 방사능면역침강, 면역침강, ELISA(enzyme-linked immunosorbent assay), 캡처-ELISA, 억제 또는 경재 분석, 샌드위치 분석, 유세포 분석(flow cytometry), 면역형광염색 및 면역친화성 정제를 포함하지만, 이에 한정되는 것은 아니다. 상기 면역분석 또는 면역염색의 방법은 Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay(ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; 및 Ed Harlow and David Lane, Using Antibodies:A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999에 기재되어 있으며, 상기 문헌은 본 명세서에 참조로서 삽입된다. 상기 ELISA 방법 및 캡처-ELISA 방법에서 최종적인 효소의 활성 측정 또는 시그널의 측정은 당업계에 공지된 다양한 방법에 따라 실시될 수 있다. 만일, 레이블로서 바이오틴이 이용된 경우에는 스트렙타비딘으로, 루시퍼라아제가 이용된 경우에는 루시페린으로 시그널을 용이하게 검출할 수 있다. 상술한 면역분석 과정에 의한 최종적인 시그널의 세기를 분석함으로써, 베체트병을 진단할 수 있다.The kit for diagnosing Behcet's disease according to the present invention is basically applied to immunoassay to diagnose Behcet's disease. Such immunoassay can be performed according to various immunoassay or immunostaining protocols developed conventionally. The immunoassay or immuno-staining formats may be used in a variety of ways including, but not limited to, radioimmunoassays, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hardwood analysis, sandwich analysis, flow cytometry, ≪ / RTI > and immunoaffinity purification. Methods of immunoassay or immunostaining are described in Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference. In the ELISA method and the capture-ELISA method, measurement of the activity of the final enzyme or measurement of the signal can be performed according to various methods known in the art. If biotin is used as a label, it can be easily detected by streptavidin. When luciferase is used, luciferin can easily detect a signal. By analyzing the intensity of the final signal by the above-described immunoassay, it is possible to diagnose Behcet's disease.

투여를 위해서 상기 기재한 유효성분 이외에 추가로 약학적으로 허용가능한 담체를 1종 이상 포함하여 제조할 수 있다. 약학적으로 허용가능한 담체는 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로오스 용액, 말토덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다. 더 나아가 당 분야의 적정한 방법으로 또는 Remington's Pharmaceutical Science(최근판), Mack Publishing Company, Easton PA에 개시되어있는 방법을 이용하여 각 질환에 따라 또는 성분에 따라 바람직하게 제제화할 수 있다.In addition to the above-described effective ingredients for administration, one or more further pharmaceutically acceptable carriers may be prepared. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components. If necessary, an antioxidant, , And other conventional additives such as a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or by the method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA.

본 발명의 조성물은 목적하는 방법에 따라 비경구, 동맥내, 피내, 경피, 근육내, 복강내, 정맥내, 피하, 경구 및 비내 투여 경로를 포함하여 다양한 경로에 의해 인간이나 동물에 투여될 수 있으며, 투여량은 환자의 체중, 연령, 성별, 건강 상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하다. 상기 조성물의 일일 투여량은 약 10ng/㎏~10㎎/㎏, 바람직하게는 약 80~400ng/㎏이며, 하루 일회 내지 수회에 나누어 투여하는 것이 더욱 바람직하다.
The composition of the present invention may be administered to humans or animals by various routes including parenteral, intraarterial, intradermal, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous, The dosage varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and disease severity. The daily dose of the composition is about 10 ng / kg to 10 mg / kg, preferably about 80 to 400 ng / kg, and it is more preferable to administer the composition once a day or several times a day.

본 발명의 헤르페스 바이러스 UL48 단백질 또는 이의 항체를 포함하는 베체트병 진단용 키트를 통하여 베체트병을 특이적이고 신속하게 진단할 수 있다. 나아가 상기 항체를 통하여 베체트병을 치료할 수 있다.
The kit for diagnosing Behcet's disease comprising the herpes virus UL48 protein of the present invention or an antibody thereof can specifically and rapidly diagnose Behcet's disease. Further, the above-mentioned antibody can be used to treat Behcet's disease.

도 1은 5명의 베체트병 환자로부터 수득한 혈청 샘플 내의 IgA 및 IgG 항체와 HSV 용균물에 대한 면역침강의 결과이다.
도 2는 ELISA로부터 수득한 재조합 HSV UL48에 대한 혈청 IgA 반응성의 평균 흡광도의 결과이다.
도 3은 재조합 HSV 1형 UL48 단백질에 대한 혈청 IgA 반응성에 대하여, ELISA 분석 및 웨스턴 블롯을 비교한 결과이다.
도 4는 재조합 HSV UL48에 대한 혈청 IgG 및 IgA 반응성의 평균 흡광도 결과이다.
도 5는 인간 진피 미세혈관 내피 세포에 대한 HSV UL48 항체의 면역반응성의 결과이다.
도 6은 HSV UL48 단백질 및 인간 HSC71간에 상동서열을 평가하였을 때, 상동성을 가지는 14개의 구별되는 에피토프이다.
도 7은 비감염 ICR 마우스, HSV 접종하였으나 증상이 없는 마우스, 및 바체트 유사 마우스에 대한 면역조직학적 염색의 결과이다.
Figure 1 shows the results of immunoprecipitation for IgA and IgG antibodies and HSV in serum samples obtained from five patients with Behcet's disease.
Figure 2 is the result of the average absorbance of serum IgA reactivity for recombinant HSV UL48 obtained from ELISA.
Figure 3 is a comparison of ELISA analysis and Western blot for serum IgA reactivity to recombinant HSV type 1 UL48 protein.
Figure 4 shows the average absorbance results of serum IgG and IgA responsiveness to recombinant HSV UL48.
Figure 5 is the result of immunoreactivity of HSV UL48 antibody to human dermal microvascular endothelial cells.
Figure 6 is the 14 distinct epitopes that have homology when assessing homology sequences between HSV UL48 protein and human HSC71.
Figure 7 shows the results of immunohistochemical staining for uninfected ICR mice, HSV-inoculated but symptom-free mice, and Vacher-like mice.

이하, 본 발명의 구성요소와 기술적 특징을 다음의 실시예들을 통하여 보다 상세하게 설명하고자 한다. 그러나 하기 실시예들은 본 발명의 내용을 예시하는 것일 뿐 발명의 범위가 실시예에 의해 한정되는 것은 아니다.
Hereinafter, the components and technical features of the present invention will be described in more detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention and are not intended to limit the scope of the invention.

샘플의 준비Preparation of samples

30명의 베체트병 환자를 모집하여, 최소 2가지의 주요 기준에 따라 임상적으로 질환의 활성 상태에 있는 환자로부터 혈청 샘플을 수득하였고, 수득한 혈청 샘플은 -70℃에 보관하였다. 30개의 건강한 공여주로부터 구입한 혈청을 대조군으로 포함하였다.
Thirty patients with Behcet's disease were recruited and serum samples were obtained from patients who were clinically active in the disease according to at least two major criteria, and the resulting serum samples were stored at -70 < 0 > C. Serum from 30 healthy donors was included as a control.

베체트병 유사 마우스 모델Behcet's disease-like mouse model

베로 세포에서 성장한 HSV 1형 바이러스를4내지 5주령된 수컷 ICR 마우스에 접종하여 베체트병 유사 마우스 모델을 제조하였다. HSV type 1 virus grown in Vero cells was inoculated into male ICR mice 4 to 5 weeks old to construct a Behcet's disease-like mouse model.

이때, 바늘을 이용하여 실험용 마우스의 귓불을 긁어서 10일 간격으로 2번씩 바이러스를 마우스에 접종하였다. 최종 접종 후에 감염된 마우스를 16주간 관찰하였다. 최소한 2 가지의 베체트병 유사한 징후를 보이는 HSV 접종 마우스를 베체트병 유사 마우스 모델로 사용하였다(N=5). HSV를 감염시키지 않은 ICR 마우스(N=2) 및 HSV를 접종하였으나 베체트병 증상이 없는 ICR 마우스(N=2)를 대조군으로 포함하였다.
At this time, the ear lobe of the experimental mouse was scratched with a needle, and the virus was inoculated into the mouse twice at intervals of 10 days. Infected mice were observed for 16 weeks after the last inoculation. At least two HSV vaccinated mice with similar signs of Behcet's disease were used as Behcet's disease-like mouse models (N = 5). ICR mice (N = 2), which did not infect HSV, and ICR mice (N = 2), who received HSV but did not develop Behçet's disease, were included as controls.

면역침강법Immune sedimentation  And LCLC -- MALDIMALDI -- TOFTOF /TOF(/ TOF ( LiquidLiquid ChromatographyChromatography -- MatrixMatrix AssistedAssisted Laser  Laser DesorptionDesorption // IonizationIonization -- tandemtandem TimeTime -- OfOf -- FlightFlight ) 분석법) Method

베로 세포에서 성장시킨 1형 HSV의 용균물을 16시간 동안 5명의 베체트병 환자의 혼합된 혈청과 배양하였다. 염소 항-인간 IgA 및 IgG 항체 각각 5ug으로 전 처리한 단백질 G-세파로즈 비드(Sigma, St. Louis, MO, U.S.A.)를 추가하고, 4℃에서 하룻밤 동안 배양하였다. 면역침강물은 샘플 완충액에서 부유시켰고, 10% SDS-폴리아크릴아마이드 젤 전기영동법(PAGE)을 이용하여 분리하였다. 젤 조각을 잘라내어 LC-MALDI-TOF/TOF 분석을 진행하였다. Type 1 HSV strains grown in Vero cells were cultured with mixed serum from five Behcet 's disease patients for 16 hours. Protein G-Sepharose beads (Sigma, St. Louis, MO, U.S.A.) pretreated with 5 ug each of goat anti-human IgA and IgG antibodies were added and incubated overnight at 4 캜. Immunoprecipitates were suspended in sample buffer and separated using 10% SDS-polyacrylamide gel electrophoresis (PAGE). The gel pieces were cut out and analyzed by LC-MALDI-TOF / TOF.

용균된 1형 HSV, HSV와 배양한 인간 진피 미세혈관 내피세포(HDMECs) 및 샘플 완충액으로 용균시킨 HDMEC를 사용하여 웨스턴 블롯 분석을 실시하였다. 멤브레인은 항-VP16 표지 다클론성 항체(ab4808;abcam, Cambridge, UK)와 배양하였고 ECL(Enhanced ChemiLuminescence)를 사용하여 시각화하였다. 추가적으로, 용균된 HDMEC는 항-VP16 표지 다클론성 항체(abcam)과 16시간 동안 배양하였다. 염소 항-토끼 IgG 항체 5ug으로 전처리한 단백질 G-세파로즈 비드(Sigma)를 추가하였다. 이후에, 면역침강 및 프로테오믹스 분석을 수행하였다.
Western blot analysis was performed using HDMECs lysed with lysed type 1 HSV, HSV and cultured human dermal microvascular endothelial cells (HDMECs) and sample buffer. Membranes were incubated with anti-VP16-labeled polyclonal antibody (ab4808; abcam, Cambridge, UK) and visualized using ECL (Enhanced Chemiluminescence). In addition, the lysed HDMECs were incubated with anti-VP16 labeled polyclonal antibody (abcam) for 16 hours. Protein G-Sepharose beads (Sigma) pretreated with 5 ug of goat anti-rabbit IgG antibody were added. Subsequently, immunoprecipitation and proteomic analysis were performed.

발현 벡터의 제조 및 박테리아 내 발현Preparation of expression vector and expression in bacteria

HSV UL48의 단백질 암호화 구역은 밑줄친 Xho I 절단 위치를 포함하는 5'올리고뉴클레오티드 프라이머 GGGATCCGAGCTCGAGATGGACCTCTTGGTCGACGAGCTG 및 밑줄친 XhoI 절단 위치를 포함하는 3'올리고뉴클레오티드 프라이머 AGCTGCAGATCTCGAGCTACCCACCGTACTCGTCAATTCC를 이용하여 PCR(polymerase chain raction)에 의해 증폭되었다. PCR 증폭 생성물은 젤 상에서 분리하여 pRSET 박테리아 발현 벡터(Invitrogen, Grand Island, NY, U.S.A.)로 클로닝하였다. 완성된 생성물은 DNA 서열분석을 통해 검증하였다. HSV UL48을 대장균 BL21 내에서 과발현시켰고, 과발현된 HSV UL48 재조합 단백질을 Ni-NTA 레진(Sigma)를 사용하여 균질성을 갖도록 정제하였다. 재조합 HSV UL 48 단백질을 사용할 때까지 -30℃에서 보관하였다.
The protein coding region of HSV UL48 was amplified by polymerase chain reaction (PCR) using the 3 'oligonucleotide primer AGCTGCAGAT CTCGAG CTACCCACCGTACTCGTCAATTCC containing the 5' oligonucleotide primer GGGATCCGAG CTCGAG ATGGACCTCTTGGTCGACGAGCTG containing the underlined Xho I cleavage site and the underlined XhoI cleavage site, Lt; / RTI > The PCR amplified products were separated on gel and cloned into pRSET bacterial expression vector (Invitrogen, Grand Island, NY, USA). The finished product was verified by DNA sequencing. HSV UL48 was overexpressed in E. coli BL21 and the overexpressed HSV UL48 recombinant protein was purified to homogeneity using Ni-NTA resin (Sigma). Recombinant HSV UL 48 protein was stored at -30 ° C until use.

재조합 1형 헤르페스 단순 바이러스(Recombinant type 1 herpes simplex virus ( HSVHSV ) ) UL48UL48 을 이용한 Using 웨스턴Western 블롯Blot

정제된 재조합 1형 HSV UL48 단백질 1ug을 샘플 완충액에 부유시켰다. 샘플은 12% 폴리아크릴아마이드 젤 상에 로딩하였고 100V에서 전기영동을 실시하였다. 멤브레인은 1차 항체 희석 완충액(1% 탈지분유, 10mM Tris pH 7.5, 100mM NaCl, 0.1% Tween 20)을 사용하여 1:500 비율로 희석시킨 정상 대조군 또는 베체트병 환자로부터의 혈청 샘플과 같이 4℃에서 하룻밤 동안 배양하였다. 멤브레인은 PBST를 사용하여 6회 세척하였고, 블로킹 완충액(1% 탈지분유, 10mM Tris pH 7.5, 100mM NaCl, 0.1% Tween 20) 내 1:10000으로 각각 희석시킨 페록시다아제 결합형 염소 항-인간 IgA 및 IgG 항체와 상온에서 1시간 동안 배양하였다. 배양 후에 멤브레인은 ECL을 사용하여 시각화하였다.
One ug of purified recombinant type 1 HSV UL48 protein was suspended in sample buffer. Samples were loaded onto 12% polyacrylamide gels and electrophoresed at 100V. Membranes were incubated at 4 [deg.] C with serum samples from normal control or Behcet's disease patients diluted 1: 500 with primary antibody dilution buffer (1% skim milk, 10 mM Tris pH 7.5, 100 mM NaCl, 0.1% Tween 20) Lt; / RTI > overnight. Membranes were washed 6 times with PBST and incubated with peroxidase-conjugated goat anti-human (Gibco) diluted 1: 10000 in blocking buffer (1% skim milk, 10 mM Tris pH 7.5, 100 mM NaCl, 0.1% Tween 20) IgA and IgG antibodies at room temperature for 1 hour. After incubation the membranes were visualized using ECL.

ELISAELISA ( ( EnzymeEnzyme LinkedLinked ImmunosorentImmunosorient assayassay ))

ELISA는 재조합 1형 HSV UL48 단백질을 베체트병 환자의 혈청 및 구입한 대조군 혈청 내 IgG 및 IgA와 반응시켜서 실시하였다. 96 웰 마이크로타이터 플레이트(Immuno2, HB, Thermo Scientific, Waltham, MA, USA)는 300ng의UL48 단백질을 사용하여 하룻밤 동안 코팅하였다. 코팅 후에, 30개 베체트병 환자의 혈청 및 30개 건강한 대조군의 혈청 100ul를 1% 소혈청 알부민(BSA, Sigma, St Louis, MO, USA)를 포함하는 PBST 내에서 1:20 비율로 희석한 후, 각각의 96웰 플레이트 내 각각의 웰에 첨가하였다. 플레이트는 37℃에서 2시간 동안 배양하였다. 항체의 결합은 각각의 웰에 기질(테트라메틸벤지딘, tetramethylbenzidine)을 첨가하여 비색분석으로 정량하였다. 플레이트의 흡광도는 ELISA 리더기(Alexandria, VA, USA) 상의 450nm에서 분광광전으로 측정하였다. 정치성(positivity)는 건강한 대조군의 평균 값 이상의 표준편차보다 큰 흡광도 수치로서 정의하였다.
ELISA was performed by reacting recombinant type 1 HSV UL48 protein with serum from patients with Behcet's disease and IgG and IgA in the purchased control serum. 96 well microtiter plates (Immuno2, HB, Thermo Scientific, Waltham, MA, USA) were coated overnight with 300 ng UL48 protein. After coating, serum from 30 patients with Behcet's disease and 100 ul of serum from 30 healthy controls were diluted 1:20 in PBST containing 1% bovine serum albumin (BSA, Sigma, St Louis, MO, USA) , To each well in each 96-well plate. Plates were incubated at 37 [deg.] C for 2 hours. Antibody binding was quantified by colorimetric analysis by adding a substrate (tetramethylbenzidine) to each well. The absorbance of the plate was measured spectrophotometrically at 450 nm on an ELISA reader (Alexandria, VA, USA). The positivity was defined as the absorbance value above the standard deviation above the mean value of the healthy controls.

면역조직학적 분석Immunohistological analysis

실험용 마우스를 희생시키고, 무릎 관절의 조직 샘플을 수득하여 고정하였다. 베체트병-유사 마우스 모델, 비감염 ICR 마우스 및 HSV 접종하였지만 증상이 없는 마우스로부터의 조직 단면(4um 두께)은 희석된 1차 항-혈청과 함께 상온에서 1시간 동안 배양하였다. 토끼 항-VP16 표지 다클론성 항체(abcam)은 1:200 으로 희석하였다. PBS를 사용하여 세척한 후에, 조직 단면은 1:100으로 희석시킨 HRP-결합된 2차 항-혈청과 30분 동안 배양하였다. 그 후, 조직 단면은 헤마톡실린(hematoxylin)으로 옅게 대조염색하였다. 음성 대조군은 1차 항체를 누락시킴으로써 수득하였다. 염색 강도는 Metamorph 소프트웨어 버전 7.7.1.0(Molecular Devices Inc., Sunnyvale, CA, USA)를 사용하여 분석하였다.
Experimental mice were sacrificed and tissue samples of the knee joint were obtained and fixed. Tissue sections (4 μm thickness) from Behcet's disease-like mouse models, uninfected ICR mice and HSV-inoculated but symptom-free mice were incubated with diluted primary anti-serum for 1 hour at room temperature. Rabbit anti-VP16 labeled polyclonal antibody (abcam) was diluted 1: 200. After washing with PBS, the tissue sections were incubated with HRP-conjugated secondary anti-serum diluted 1: 100 for 30 minutes. The tissue section was then lightly counterstained with hematoxylin. Negative controls were obtained by omitting the primary antibody. Staining intensity was analyzed using Metamorph software version 7.7.1.0 (Molecular Devices Inc., Sunnyvale, Calif., USA).

통계 분석Statistical analysis

정성적 변수에 대한 수치는 중간값 범위 및 4분위수 범위로써 기재하였다. 재조합 1형 HSV UL48 단백질에 대한 혈청의 반응성은 베체트병 마우스 모델과 대조군 마우스 및 베체트병 환자와 건강한 피험체 사이에서, 비모수의 Mann-Whitney U test, X2 tests 및 chi-square test(Fisher's exact test)를 이용하여 비교하였다. DeLong? 방법을 사용하여 수용자 작용 특징 곡선 하의 영역을 베체트병 환자에서 비교함으로, 재조합 1형 HSV UL48 단백질을 이용한 웨스턴 블롯 및 ELISA 의 진단상 정확성을 분석하였다. 모든 분석은 SAS 소프트웨어 버전 9.2(SAS Institute Inc., Cary, NC, USA)를 사용하여 실시하였다. P-value<0.05 인 경우에 유의적으로 의미있는 것으로 하였다.
Numerical values for qualitative variables are described as intermediate range and quartile range. The reactivity of the sera to recombinant type 1 HSV UL48 protein was assessed by the Mann-Whitney U test, the X 2 tests and the chi-square test (Fisher's exact test) using a non-parametric test between the Behcet's disease mouse model and control mice and Behcet's disease patients and healthy subjects ). DeLong? The diagnostic accuracy of western blot and ELISA using recombinant type 1 HSV UL48 protein was analyzed by comparing the area under the receptor function curve using the method of Behcet 's disease. All analyzes were performed using SAS software version 9.2 (SAS Institute Inc., Cary, NC, USA). P <0.05 was considered significant.

실시예Example 1.  One. 면역침강법Immune sedimentation 및 프로테오믹스 분석 And proteomics analysis

5명의 베체트병 환자로부터 수득한 혈청 샘플 내의 IgA 및 IgG 항체와 HSV 용균물에 대한 면역침강을 실시하였다(도 1). IgA(N=2) 및 IgG(N=2) 면역침강에 의해 수득된 4 개의 단백질 밴드는 LC-MALDI-TOF/TOF를 이용하여 분석하였고, NCBI 데이터베이스에서 상기 4가지 단백질 밴드에 상응하는 DNA 서열을 검색하였다. 허위 양성 결과 및 면역글로불린을 포함하는 자료를 배제한 후, 하기의 바이러스 단백질이 30보다 큰 Mascot 수치를 나타냄을 특이적으로 확인하였다; IgA-반응성 단백질 밴드 내UL48, 알파 트랜스alpha trans inducing factor, 게놈 폴리단백질; IgG-반응성 단백질 밴드 내 당단백질 D, UL48, alpha trans inducing factor, 외피 당단백질 D, 당단백질 C-1 및 게놈 폴리단백질(표 1). Immunoprecipitation was performed on IgA and IgG antibodies and HSV-like fungi in serum samples obtained from five patients with Behcet's disease (Fig. 1). The four protein bands obtained by IgA (N = 2) and IgG (N = 2) immunoprecipitation were analyzed using LC-MALDI-TOF / TOF and DNA sequences corresponding to the four protein bands in the NCBI database Respectively. After excluding false positive results and data containing immunoglobulin, the following viral proteins specifically identified Mascot values greater than 30; UL48 in the IgA-reactive protein band, alpha trans inducing factor, genomic polyprotein; The glycoprotein D, UL48, alpha trans inducing factor, envelope glycoprotein D, glycoprotein C-1 and genomic polyprotein in the IgG-reactive protein band (Table 1).

IgA 및 IgG에 대하여 반응하는 HSV 단백질HSV proteins that respond to IgA and IgG 유형type 확인된 단백질Identified protein 스위스-프롯 기탁번호Switzerland - Plot Accession Number NCBI 기탁 번호NCBI deposit number Mr (kDa)/pI M r (kDa) / p I 마스코트 점수(Mascot score)Mascot score IgAIgA UL48UL48 ABI63509ABI63509 gi│14318835gi│14318835 54698/4.9254698 / 4.92 158158 Alpha trans inducing factorAlpha trans inducing factor AAA45766AAA45766 gi│30055gi | 30055 53396/4.9553396 / 4.95 133133 Genome polyproteinGenome polyprotein P07564P07564 gi│30428gi | 30428 382498/8.75382498 / 8.75 6969 IgGIgG Glycoprotein DGlycoprotein D ABM52980ABM52980 gi│21277019gi│21277019 43744/8.1043744 / 8.10 182182 UL48UL48 ABI63509ABI63509 gi│14318835gi│14318835 54698/4.9254698 / 4.92 173173 Alpha trans inducing factorAlpha trans inducing factor AAA45766AAA45766 gi│30055gi | 30055 53396/4.9553396 / 4.95 158158 Envelope glycoprotein DEnvelope glycoprotein D P06476
P06476
gi│38233gi | 38233 43767/8.8943767 / 8.89 107107
Glycoprotein C-1Glycoprotein C-1 CAD13356CAD13356 gi│7426768gi│7426768 55560/7.1655560 / 7.16 5454 Genome polyproteinGenome polyprotein P14335P14335 gi│30494gi | 30494 384959/8.70384959 / 8.70 5454

확인된 단백질 중에서, HSV UL48(예측 분자량 (M r )/pI , 54698/4.92; NCBI 기탁번호, gi│14318835; 스위스-프롯 기탁번호, ABI63509)는 IgA 및 IgG 반응성 단백질 밴드에서 각각 mascot 수치가 158 및 173이고, 서열커버리지가 14% 및 16%이었다. 따라서, HSV UL48이 베체트병 환자의 혈청과 가장 특이적으로 결합한다는 점에서 바체트병의 항원으로 간주하고, HSV UL 48 단백질에 대한 추가적인 분석을 수행하였다.
Of the identified proteins, HSV UL48 (predicted molecular weight (M r ) / p I , 54698 / 4.92; NCBI Deposition Number, gi | 14318835; Switzerland-Plot Deposit Number, ABI 63509) had mascot values of 158 and 173 in the IgA and IgG reactive protein bands, respectively, and sequence coverage of 14% and 16%, respectively. Therefore, HSV UL48 was considered to be the antigen of Bacchott disease in that it most specifically binds to the serum of patients with Behcet's disease, and additional analysis of HSV UL 48 protein was performed.

실시예Example 2. 베체트병 환자 내 재조합  2. Recombination in patients with Behcet's disease HSVHSV UL48UL48 에 대한 혈청 반응성 Serum Reactivity to

재조합 HSV UL48을 이용한 ELISA 및 웨스턴 블롯 분석은 30명의 베체트병 환자 및 30명의 건강한 대조군으로부터 수득한 혈청을 이용한 혈청의 반응성을 측정하기 위해 실시하였다. ELISA로부터 수득한 재조합 HSV UL48에 대한 혈청 IgA 반응성의 평균 흡광도(사분위수 범위)는 베체트병 환자에서 0.35(0.02~1.01), 건강한 대조군(P<0.001)에서 0.1(0.02~0.40)으로 측정되었다(도 2a). 확실성(positivity)을 건강한 대조군의 평균 흡광도+표준편차 보다 큰 흡광도 수치로써 정의한다면, UL48에 대한 양성 혈청 IgA 반응성은 24명의 베체트병 환자(80%) 및 5명의 건강한 대조군(16.7%)에서 나타났다. 웨스턴 블롯 분석은 재조합 HSV UL48에 대한 혈청 IgA의 반응성은 10명의 베체트병 환자(33.3%) 및 2 명의 건강한 대조군(6.7%)(P=0.010)으로 나타남을 검증하였다(도 2c).        ELISA and Western blot analysis using recombinant HSV UL48 were performed to determine the reactivity of sera using sera obtained from 30 patients with Behcet's disease and 30 healthy controls. The mean absorbance (quartile range) of serum IgA reactivity for recombinant HSV UL48 obtained from ELISA was 0.35 (0.02-1.01) in Behcet's disease patients and 0.1 (0.02-0.40) in healthy controls (P <0.001) 2a). Positive serum IgA reactivity for UL48 was seen in 24 Behcet's disease patients (80%) and 5 healthy controls (16.7%), if positivity was defined as the absorbance reading above the mean absorbance + standard deviation of healthy controls. Western blot analysis verified that the reactivity of serum IgA to recombinant HSV UL48 was 10 patients with Behcet's disease (33.3%) and 2 healthy controls (6.7%) (P = 0.010) (FIG.

추가적으로, 재조합 HSV UL48에 대한 혈청 IgG 반응성의 중간값 흡광도(사분위수 범위)는 베체트병 환자에서 0.58(0.32~1.22)이고 건강한 대조군에서 0.53(0.18~0.74, P=0.045)이었다(도 2b). UL48에 대한 양성의 혈청 IgG 반응성은 12명의 베체트병 환자(40%) 및 6명의 건강한 대조군(20%)에서 관찰되었다. 웨스턴 블롯 분석결과는 재조합 HSV UL48에 대한 혈청 IgG의 반응성이 18명의 베체트병 환자(60%) 및 4명의 건강한 대조군(13.3%, P<0.001)에서 나타남을 확인하였다(도 2c).
In addition, the median absorbance (quartile range) of serum IgG responsiveness to recombinant HSV UL48 was 0.58 (0.32-1.22) in patients with Behcet's disease and 0.53 (0.18-0.74, P = 0.045 ) in healthy controls (Figure 2b). Positive serum IgG responsiveness to UL48 was observed in 12 patients with Behcet's disease (40%) and 6 healthy controls (20%). Western blot analysis confirmed that the reactivity of serum IgG to recombinant HSV UL48 occurred in 18 patients with Behcet's disease (60%) and 4 healthy controls (13.3%, P <0.001 ) (Fig. 2c).

재조합 HSV 1형 UL48 단백질에 대한 혈청 IgA 반응성에 대하여, ELISA 분석은 웨스턴 블롯에 비해 베체트 병 진단에 있어서 좀 더 정확하였다(AUROC ELISA vs. 웨스턴 블로팅, 0.852 vs 0.633, P=0.003)(도 3a). 하지만, 재조합 HSV 1형 UL48 단백질에 대한 혈청 IgG 반응성에 대해서는, ELISA 및 웨스턴 블로팅이 유사하게 베체트 병을 진단하였다(AUROC ELISA vs. 웨스턴 블로팅 0.651 vs. 0.733, P>0.05)(도 3b).
For serum IgA reactivity to recombinant HSV type 1 UL48 protein, ELISA assays were more accurate in the diagnosis of Behcet's disease than in Western blots (AUROC ELISA vs. Western blotting, 0.852 vs 0.633, P = 0.003) ). However, for serum IgG responsiveness to recombinant HSV type 1 UL48 protein, ELISA and Western blotting similarly diagnosed Behcet's disease (AUROC ELISA vs. western blotting 0.651 vs. 0.733, P> 0.05 ) (Figure 3b) .

실시예Example 3. 베체트병 유사 마우스 모델의 재조합  3. Recombination of Behcet's disease-like mouse model HSVHSV UL48UL48 에 대한 혈청 반응성Serum Reactivity to

재조합 HSV UL48을 이용한 ELISA 및 웨스턴 블롯 분석을 수행하여 베체트병 유사 마우스 모델 5마리, 비감염 ICR 마우스 2마리 및 HSV 접종하였으나 증상이 없는 마우스 2마리로부터 추출한 혈청을 이용하여 혈청 반응성을 측정하였다. ELISA and Western blot analysis using recombinant HSV UL48 were performed to determine serum reactivity using serum from five Behçet's disease-mimicked mouse models, two non-infected ICR mice and two HSV-infected mice but no symptoms.

ELISA로부터 수득한 재조합 HSV UL48에 대한 혈청 IgA 반응성의 평균 흡광도(사분위수 범위)는 베체트병 유사 마우스 모델에서 0.31(0.14~0.75), 비감염 ICR 마우스 및 HSV 접종하였으나 증상이 없는 마우스에서 0.10(0.07~0.14, P=0.037)로 측정되었다(도 4a). 하지만, 웨스턴 블롯 분석 결과는 재조합 HSV UL48에 대한 혈청 IgA의 반응성이 5마리의 베체트병 유사 마우스에서만 나타났고, 비감염 ICR 마우스 및 HSV 접종하였으나 증상이 없는 마우스에서는 나타나지 않음을 확인하였다(P=0.008, 도 4b).The mean absorbance (quartile range) of serum IgA responsiveness to recombinant HSV UL48 obtained from ELISA was 0.31 (0.14-0.75) in the Behçet's disease-like mouse model, 0.10 (0.07-0.75) in the uninfected ICR mouse and HSV inoculated mice, 0.14, P = 0.037 ) (Fig. 4A). However, Western blot analysis showed that serum IgA reactivity to recombinant HSV UL48 was present only in five Behcet-like mice, and not in uninfected ICR mice and HSV inoculated mice ( P = 0.008 , 4b).

추가적으로, 재조합 HSV UL48에 대한 혈청 IgG 반응성의 평균 흡광도는 베체트병 유사 마우스 모델에서 0.07(0.04~0.11)이고, 비감염 ICR 마우스 및 HSV 접종하였으나 증상이 없는 마우스에서는 0.04(0.02~0.08)(P>0.05)로 측정되었다(도 4a). 웨스턴 블롯 분석은 재조합 HSV UL48에 대한 혈청 IgG의 반응성이 오직 5마리의 베체트병 유사 마우스 중 2두(40%)에서만 관찰되었고, 비감염 ICR 마우스 및 HSV 접종하였으나 증상이 없는 마우스(P>0.05)에서는 관찰되지 않았음을 확인하였다(도 4b).
In addition, the average absorbance of serum IgG reactivity to recombinant HSV UL48 was 0.07 (0.04-0.11) in the Behcet disease-like mouse model and 0.04 (0.02-0.08) (P> 0.05) in the uninfected ICR mouse and HSV inoculated mice ) (Fig. 4A). Western blot analysis showed that serum IgG reactivity to recombinant HSV UL48 was observed in only 2 out of 5 (50%) of Behcet's disease-like mice, and in uninfected ICR mice and HSV inoculated but symptom-free ( P> 0.05 ) (Fig. 4B).

실시예Example 4. 인간 진피 미세혈관 내피 세포에 대한  4. Human dermal microvascular endothelial cells HSVHSV UL48UL48 항체의 면역반응성 Immunoreactivity of antibodies

HSV 1형, HSV로 배양한 HDMEC, 및 HDMEC를 이용한 웨스턴 블롯 분석결과는 항-HSV UL48 다클론성 항체가 HSV 1형과 비교하여 HDMEC 내 멀리 떨어져 있는 단백질 밴드와 반응하는 것을 확인하였다(도 5a). 면역침강을 실시하여 두 개의 단백질 밴드를 상기에서 기술한 프로테오믹스에 의해 분석하였다(도 5b). 일반적으로 UL48단백에 대한 항체는 herpes simplex virus의 단백에 대해서만 반응하여야 함에도 불구하고 HSV로 배양한 HDMEC, 및 HDMEC에서도 반응하는 부분을 알 수 있으며, 이 중에서는 HSV 단백과 관련이 없는 부분에 대해서도 반응성을 보인다는 것을 알 수 있었다.Western blot analysis using HSV 1 type, HDMEC cultured with HSV, and HDMEC confirmed that the anti-HSV UL48 polyclonal antibody reacted with a protein band far away in the HDMEC as compared with HSV type 1 ). Immunoprecipitation was performed and two protein bands were analyzed by the proteomics described above (Figure 5b). In general, antibodies against UL48 protein should be reacted only to the proteins of herpes simplex virus, but they may also be found in HDMEC and HDMEC cultured with HSV, Of the total.

잘못된 양성군 및 면역글로불린을 포함하는 자료를 배제시킨 후, 하기의 인간 단백질은 특이적으로 30보다 큰 Mascot 수치를 나타냄을 확인하였다: keratin 1, epidermal cytokeratin 2, VIM, keratin 6B isoform CRA a, heat shock cognate 71 kDa 단백질 유사형1, 알파-튜불린, factor VII 활성 위치 변이체 면역접합체 및 MTHSP75(표 2). After excluding data containing false positives and immunoglobulins, the following human proteins specifically identified Mascot values greater than 30: keratin 1, epidermal cytokeratin 2, VIM, keratin 6B isoform CRA a, heat shock cognate 71 kDa protein-like 1, alpha-tubulin, factor VII active site-mutant immunoconjugates and MTHSP75 (Table 2).

확인된 단백질 중에서, 열 충격 동족체(heat shock cognate) 71 kDa 단백질 유사형 1(측정된 분자량(Mr)/pI, 71082/5.37); NCBI 기탁번호, gi│729877; 스위스-프롯 기탁번호, NP_006588)에 대하여 추가적으로 연구를 진행하였다. Of the identified proteins, heat shock cognate 71 kDa protein mimetic 1 (measured molecular weight (Mr) / p I , 71082 / 5.37); NCBI Deposition Number, gi | 729877; Switzerland-Plot Deposit No., NP_006588).

항-HSV UL48 단백질 항체와 반응하는 HDMEC의 확인된 단백질Identified protein of HDMEC reacting with anti-HSV UL48 protein antibody 확인된 단백질Identified protein 스위스-프롯 기탁번호Switzerland - Plot Accession Number NCBI 기탁번호NCBI deposit number Mr (kDa)/pI M r (kDa) / p I 마스코트 점수(Mascot score)Mascot score Heat shock cognate 71 kDa protein isoform 1Heat shock cognate 71 kDa protein isoform 1 NP_006588NP_006588 gi│729877gi | 729877 71082/5.3771082 / 5.37 7979 Alpha-tubulinAlpha-tubulin CAA25855CAA25855 gi│7492gi | 7492 50810/5.0250810 / 5.02 7373 Factor VII active site mutant immunoconjugateFactor VII active site mutant immunoconjugate AAK58686AAK58686 gi│8269794gi | 8269794 77386/6.6077386 / 6.60 6565 MTHSP75MTHSP75 AAA67526AAA67526 gi│92059gi│92059 74019/5.9774019 / 5.97 6262

T-Coffee(http://www.tcoffee.org)의 정열 알고리즘을 사용하여 HSV UL48 단백질 및 인간 HSC71간에 상동서열을 평가하였다. 그 결과 하기와 같은 중요한 상동성을 가지는 14개의 구별되는 에피토프를 검출하였다(도 6)
The homology sequences between HSV UL48 protein and human HSC71 were evaluated using the alignment algorithm of T-Coffee (http://www.tcoffee.org). As a result, 14 distinct epitopes with important homology were detected (Figure 6)

실시예Example 5. 면역 조직적 염색법에 의한 확인  5. Confirmation by immunohistochemical staining

비감염 ICR 마우스 및 HSV 접종하였으나 증상이 없는 마우스로부터 수득된 무릎관절의 조직 시료에서는 전혀 또는 적은 염증성 세포 침습 조차 발견되지 않았다(도 7a-d). 반면에, 바체트 유사 마우스로부터 수득된 관절에서는 염증성 세포 침습이 발견되었다(도 7e, f). 모든 그룹의 실험 마우스는 윤할막의 상피에서 항 HSV UL48 항체에 대한 면역반응성을 보여주었다. 또한, 염증성 세포 및 진피세포 모두는 바체트병 유사 마우스로부터 수득된 조직 시료에서 있는 항 HSV UL48 항체에 대한 눈에 띄는 면역반응성을 보여주었다(도 7e, f).
No or less inflammatory cell invasion was found in the tissue samples of the knee joint obtained from uninfected ICR mice and HSV inoculated but symptom-free mice (Fig. 7a-d). On the other hand, inflammatory cell invasion was found in the joints obtained from Bacet-like mice (Fig. 7e, f). All groups of experimental mice showed immunoreactivity to the anti-HSV UL48 antibody in the epithelium of the lachrymal membrane. In addition, both inflammatory cells and dermal cells showed noticeable immunoreactivity to anti-HSV UL48 antibodies in tissue samples obtained from Barrett's disease-like mice (Fig. 7e, f).

본원 발명의 내용은 하기 참고문헌에서 참조할 수 있다.The contents of the present invention can be referred to the following references.

1. Sakane T, Takeno M, Suzuki N, Inaba G. Behcet’s disease. N Engl J Med 1999; 341:1284-91.1. Sakane T, Takeno M, Suzuki N, Inaba G. Behcet's disease. N Engl J Med 1999; 341 : 1284-91.

2 . Suzuki Kurokawa M, Suzuki N. Behcet’s disease. Clin Exp Med 2004; 4:10-20.2 . Suzuki Kurokawa M, Suzuki N. Behcet's disease. Clin Exp Med 2004; 4 : 10-20.

3. Kalayciyan A, Zouboulis C. An update on Behcet’s disease. J Eur Acad Dermatol Venereol 2007; 21:1-10.3. Kalayciyana, Zouboulis C. An update on Behcet's disease. J Eur Acad Dermatol Venereol 2007; 21 : 1-10.

4. Cho SB, Cho S, Bang D. New insights in the clinical understanding of Behcet’s disease. Yonsei Med J 2012; 53:35-42.4. Cho SB, Cho S, Bang D. New insights in the clinical understanding of Behcet's disease. Yonsei Med J 2012; 53 : 35-42.

5. Behcet H. Uer rezidivierende, aphthose, durch ein Virus verursachte Geschwure im Mund, am Auge und an den Genitalien. Dermatol Wochenschr 1937; 105:1152-7.5. Behcet H. Uer rezidivierende, aphthose, durch ein Virus verurschte Geschwure im Mund, am Auge und an den Genitalien. Dermatol Wochenschr 1937; 105 : 1152-7.

6. Kaneko F, Oyama N, Yanagihori H, Isogai E, Yokota K, Oguma K. The role of streptococcal hypersensitivity in the pathogenesis of Behcet’s disease. Eur J Dermatol 2008; 18:489-98.6. Kaneko F, Oyama N, Yanagihori H, Isogai E, Yokota K, Oguma K. The role of streptococcal hypersensitivity in the pathogenesis of Behcet's disease. Eur J Dermatol 2008; 18 : 489-98.

7. Eglin RP, Lehner T, Subak-Sharpe JH. Detection of RNA complementary to herpes-simplex virus in mononuclear cells from patients with Behcet's syndrome and recurrent oral ulcers. Lancet 1982; 2:1356-61.7. Eglin RP, Lehner T, Subak-Sharpe JH. Detection of RNA complementary to herpes simplex virus in mononuclear cells from patients with Behcet's syndrome and recurrent oral ulcers. Lancet 1982; 2 : 1356-61.

8. Lee S, Bang D, Cho YH, Lee ES, Sohn S. Polymerase chain reaction reveals herpes simplex virus DNA in saliva of patients with Behcet's disease. Arch Dermatol Res 1996; 288:179-83.8. Lee S, Bang D, Cho YH, Lee ES, Sohn S. Polymerase chain reaction reveals herpes simplex virus DNA in saliva of patients with Behcet's disease. Arch Dermatol Res 1996; 288 : 179-83.

9. Cho SB, Zheng Z, Ahn KJ et al. Serum IgA reactivity against GroEL of Streptococcus sanguinis and human heterogeneous nuclear ribonucleoprotein A2/B1 in patients with Behcet’s disease. Br J Dermatol 2013; 168:977-83.9. Cho SB, Zheng Z, Ahn KJ et al . Serum IgA reactivity against GroEL of Streptococcus sanguinis and human heterogeneous nuclear ribonucleoprotein A2 / B1 in patients with Behcet's disease. Br J Dermatol 2013; 168 : 977-83.

10. Quinn A, Shinnick TM, Cunningham MW. Anti-Hsp65 antibodies recognize M proteins of group A streptococci. Infect Immun 1996; 64:818-24.10. Quinna, Shinnick TM, Cunningham MW. Anti-Hsp65 antibodies recognize M proteins of group A streptococci. Infect Immun 1996; 64 : 818-24.

11. Kapustian LL, Vigontina OA, Rozhko OT et al. Hsp90 and its co-chaperone, Sgt1, as autoantigens in dilated cardiomyopathy. Heart Vessels 2013; 28:114-9.11. Kapustian LL, Vigontina OA, Rozhko OT et al . Hsp90 and its co-chaperone, Sgt1, as autoantigens in dilated cardiomyopathy. Heart Vessels 2013; 28 : 114-9.

12. Marino Gammazza A, Bucchieri F, Grimaldi LM et al. The molecular anatomy of human Hsp60 and its similarity with that of bacterial orthologs and acetylcholine receptor reveal a potential pathogenetic role of anti-chaperonin immunity in myasthenia gravis. Cell Mol Neurobiol 2012; 32:943-7. 12. Marino Gammazzaa, Bucchieri F, Grimaldi LM et al . The molecular anatomy of human Hsp60 and its similarity with bacterial orthologs and acetylcholine receptor revealed a potential pathogenetic role of anti-chaperonin immunity in myasthenia gravis. Cell Mol Neurobiol 2012; 32 : 943-7.

13. Cho SB, Ahn KJ, Kim DH et al. Identification of HnRNP-A2/B1 as a target antigen of anti-endothelial cell IgA antibody in Behcet’s disease. J Invest Dermatol 2012; 132:601-8.13. Cho SB, Ahn KJ, Kim DH et al . Identification of HnRNP-A2 / B1 as a target antigen of anti-endothelial cell IgA antibody in Behcet's disease. J Invest Dermatol 2012; 132 : 601-8.

14. Sohn S, Lee ES, Bang D, Lee S. Behcet’s disease-like symptoms induced by the herpes simplex virus in ICR mice. Eur J Dermatol 1998; 8:21-3.14. Sohn S, Lee ES, Bang D, Lee S. Behcet's disease-like symptoms induced by the herpes simplex virus in ICR mice. Eur J Dermatol 1998; 8 : 21-3.

15. Sohn S, Lee ES, Bang D. Learning from HSV-infected mice as a model of Behcet’s disease. Clin Exp Rheumatol 2012; 30:S96-103.15. Sohn S, Lee ES, Bang D. Learning from HSV-infected mice as a model of Behcet's disease. Clin Exp Rheumatol 2012; 30 : S96-103.

16. International Study Group for Behcet’s Disease. Criteria for diagnosis of Behcet’s disease. Lancet 1990; 335:1078-80.
16. International Study Group for Behcet's Disease. Criteria for diagnosis of Behcet's disease. Lancet 1990; 335 : 1078-80.

지금까지 예시적인 실시 태양을 참조하여 본 발명을 기술하여 왔지만, 본 발명의 속하는 기술 분야의 당업자는 본 발명의 범주를 벗어나지 않고서도 다양한 변화를 실시할 수 있으며 그의 요소들을 등가물로 대체할 수 있음을 알 수 있을 것이다. 또한, 본 발명의 본질적인 범주를 벗어나지 않고서도 많은 변형을 실시하여 특정 상황 및 재료를 본 발명의 교시내용에 채용할 수 있다. 따라서, 본 발명이 본 발명을 실시하는데 계획된 최상의 양식으로서 개시된 특정 실시 태양으로 국한되는 것이 아니며, 본 발명이 첨부된 특허청구의 범위에 속하는 모든 실시 태양을 포함하는 것으로 해석되어야 한다.
While the present invention has been described with reference to exemplary embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. You will know. In addition, many modifications may be made to adapt a particular situation and material to the teachings of the invention without departing from the essential scope thereof. Accordingly, it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention, but that the invention be construed as including all embodiments falling within the scope of the appended claims.

<110> yonsei university industry academic cooperation foundation <120> A kit for diagnosing Behcet's disease comprising antibodies against herpes simplex virus type 1 UL48 protein <130> 1223 <160> 1 <170> KopatentIn 2.0 <210> 1 <211> 490 <212> PRT <213> herpes simplex virus type 1 UL48 protein <400> 1 Met Asp Leu Leu Val Asp Glu Leu Phe Ala Asp Met Asn Ser Asp Gly 1 5 10 15 Ala Ser Pro Pro Pro Pro Arg Pro Ala Gly Gly Pro Lys Asn Thr Pro 20 25 30 Ala Ala Pro Pro Leu Tyr Ala Thr Gly Arg Leu Ser Gln Ala Gln Leu 35 40 45 Met Pro Ser Pro Pro Met Pro Val Pro Pro Ala Ala Leu Phe Asn Arg 50 55 60 Leu Leu Asp Asp Leu Gly Phe Ser Ala Gly Pro Ala Leu Cys Thr Met 65 70 75 80 Leu Asp Thr Trp Asn Glu Asp Leu Phe Ser Ala Leu Pro Thr Asn Ala 85 90 95 Asp Leu Tyr Arg Glu Cys Lys Phe Leu Ser Thr Leu Pro Ser Asp Val 100 105 110 Val Glu Trp Gly Asp Ala Tyr Val Pro Glu Arg Ala Gln Ile Asp Ile 115 120 125 Arg Ala His Gly Asp Val Ala Phe Pro Thr Leu Pro Ala Thr Arg Asp 130 135 140 Gly Leu Gly Leu Tyr Tyr Glu Ala Leu Ser Arg Phe Phe His Ala Glu 145 150 155 160 Leu Arg Ala Arg Glu Glu Ser Tyr Arg Thr Val Leu Ala Asn Phe Cys 165 170 175 Ser Ala Leu Tyr Arg Tyr Leu Arg Ala Ser Val Arg Gln Leu His Arg 180 185 190 Gln Ala His Met Arg Gly Arg Asp Arg Asp Leu Gly Glu Met Leu Arg 195 200 205 Ala Thr Ile Ala Asp Arg Tyr Tyr Arg Glu Thr Ala Arg Leu Ala Arg 210 215 220 Val Leu Phe Leu His Leu Tyr Leu Phe Leu Thr Arg Glu Ile Leu Trp 225 230 235 240 Ala Ala Tyr Ala Glu Gln Met Met Arg Pro Asp Leu Phe Asp Cys Leu 245 250 255 Cys Cys Asp Leu Glu Ser Trp Arg Gln Leu Ala Gly Leu Phe Gln Pro 260 265 270 Phe Met Phe Val Asn Gly Ala Leu Thr Val Arg Gly Val Pro Ile Glu 275 280 285 Ala Arg Arg Leu Arg Glu Leu Asn His Ile Arg Glu His Leu Asn Leu 290 295 300 Pro Leu Val Arg Ser Ala Ala Thr Glu Glu Pro Gly Ala Pro Leu Thr 305 310 315 320 Thr Pro Pro Thr Leu His Gly Asn Gln Ala Arg Ala Ser Gly Tyr Phe 325 330 335 Met Val Leu Ile Arg Ala Lys Leu Asp Ser Tyr Ser Ser Phe Thr Thr 340 345 350 Ser Pro Ser Glu Ala Val Met Arg Glu His Ala Tyr Ser Arg Ala Arg 355 360 365 Thr Lys Asn Asn Tyr Gly Ser Thr Ile Glu Gly Leu Leu Asp Leu Pro 370 375 380 Asp Asp Asp Ala Pro Lys Glu Ala Gly Leu Ala Ala Pro Arg Leu Ser 385 390 395 400 Phe Leu Pro Ala Gly His Thr Arg Arg Leu Ser Thr Pro Pro Pro Thr 405 410 415 Asp Val Ser Leu Gly Asp Glu Leu His Leu Asp Gly Glu Asp Val Ala 420 425 430 Met Ala His Ala Asp Ala Leu Asp Asp Phe Asp Leu Asp Met Leu Gly 435 440 445 Asp Gly Asp Ser Pro Gly Pro Gly Phe Thr Pro His Asp Ser Ala Pro 450 455 460 Tyr Gly Ala Leu Asp Met Ala Asp Phe Glu Phe Glu Gln Met Phe Thr 465 470 475 480 Asp Ala Leu Gly Ile Asp Glu Tyr Gly Gly 485 490 <110> yonsei university industry academic cooperation foundation <120> A kit for diagnosing Behcet's disease containing antibodies          against herpes simplex virus type 1 UL48 protein <130> 1223 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 490 <212> PRT <213> herpes simplex virus type 1 UL48 protein <400> 1 Met Asp Leu Leu Val Asp Glu Leu Phe Ala Asp Met Asn Ser Asp Gly   1 5 10 15 Ala Ser Pro Pro Pro Pro Arg Pro Ala Gly Gly Pro Lys Asn Thr Pro              20 25 30 Ala Ala Pro Pro Leu Tyr Ala Thr Gly Arg Leu Ser Gln Ala Gln Leu          35 40 45 Met Pro Ser Pro Pro Met Pro Pro Pro Ala Ala Leu Phe Asn Arg      50 55 60 Leu Leu Asp Asp Leu Gly Phe Ser Ala Gly Pro Ala Leu Cys Thr Met  65 70 75 80 Leu Asp Thr Trp Asn Glu Asp Leu Phe Ser Ala Leu Pro Thr Asn Ala                  85 90 95 Asp Leu Tyr Arg Glu Cys Lys Phe Leu Ser Thr Leu Pro Ser Asp Val             100 105 110 Val Glu Trp Gly Asp Ala Tyr Val Pro Glu Arg Ala Gln Ile Asp Ile         115 120 125 Arg Ala His Gly Asp Val Ala Phe Pro Thr Leu Pro Ala Thr Arg Asp     130 135 140 Gly Leu Gly Leu Tyr Tyr Glu Ala Leu Ser Arg Phe Phe His Ala Glu 145 150 155 160 Leu Arg Ala Arg Glu Glu Ser Tyr Arg Thr Val Leu Ala Asn Phe Cys                 165 170 175 Ser Ala Leu Tyr Arg Tyr Leu Arg Ala Ser Val Arg Gln Leu His Arg             180 185 190 Gln Ala His Met Arg Gly Arg Asp Arg Asp Leu Gly Glu Met Leu Arg         195 200 205 Ala Thr Ile Ala Asp Arg Tyr Tyr Arg Glu Thr Ala Arg Leu Ala Arg     210 215 220 Val Leu Phe Leu His Leu Tyr Leu Phe Leu Thr Arg Glu Ile Leu Trp 225 230 235 240 Ala Ala Tyr Ala Glu Gln Met Met Arg Pro Asp Leu Phe Asp Cys Leu                 245 250 255 Cys Cys Asp Leu Glu Ser Trp Arg Gln Leu Ala Gly Leu Phe Gln Pro             260 265 270 Phe Met Phe Val Asn Gly Ala Leu Thr Val Gly Val Ile Glu         275 280 285 Ala Arg Arg Leu Arg Glu Leu Asn His Ile Arg Glu His Leu Asn Leu     290 295 300 Pro Leu Val Arg Ser Ala Ala Thr Glu Glu Pro Gly Ala Pro Leu Thr 305 310 315 320 Thr Pro Pro Thr Leu His Gly Asn Gln Ala Arg Ala Ser Gly Tyr Phe                 325 330 335 Met Val Leu Ile Arg Ala Lys Leu Asp Ser Tyr Ser Ser Phe Thr Thr             340 345 350 Ser Pro Ser Glu Ala Val Met Arg Glu His Ala Tyr Ser Arg Ala Arg         355 360 365 Thr Lys Asn Asn Tyr Gly Ser Thr Ile Glu Gly Leu Leu Asp Leu Pro     370 375 380 Asp Asp Ala Pro Lys Glu Ala Gly Leu Ala Ala Pro Arg Leu Ser 385 390 395 400 Phe Leu Pro Ala Gly His Thr Arg Arg Leu Ser Thr Pro Pro Thr                 405 410 415 Asp Val Ser Leu Gly Asp Glu Leu His Leu Asp Gly Glu Asp Val Ala             420 425 430 Met Ala His Ala Asp Ala Leu Asp Asp Phe Asp Leu Asp Met Leu Gly         435 440 445 Asp Gly Asp Ser Pro Gly Pro Gly Phe Thr Pro His Asp Ser Ala Pro     450 455 460 Tyr Gly Ala Leu Asp Met Ala Asp Phe Glu Phe Glu Gln Met Phe Thr 465 470 475 480 Asp Ala Leu Gly Ile Asp Glu Tyr Gly Gly                 485 490

Claims (14)

헤르페스 바이러스 UL48 단백질에 대한 항체를 포함하는 베체트병 진단용 키트.A kit for the diagnosis of Behcet's disease comprising an antibody against the herpes virus UL48 protein. 제 1항에 있어서,
항체는 IgA 또는 IgG인 것을 특징으로 하는 베체트병 진단용 키트.
The method according to claim 1,
Wherein the antibody is IgA or IgG.
제 1항에 있어서,
UL48 단백질은 서열번호 1로 표시되는 것을 특징으로 하는 베체트병 진단용 키트.
The method according to claim 1,
Wherein the UL48 protein is represented by SEQ ID NO: 1.
헤르페스 바이러스 UL48 단백질을 포함하는 베체트병 진단용 키트.Kit for the diagnosis of Behcet's disease comprising the herpes virus UL48 protein. 제 4항에 있어서,
UL48 단백질은 베체트병을 가지는 환자의 혈청내 항체와 특이적으로 결합하는 것을 특징으로 하는 베체트병 진단용 키트.
5. The method of claim 4,
Wherein the UL48 protein specifically binds to an antibody in serum of a patient having Behçet's disease.
제 4항에 있어서,
UL48 단백질은 서열번호 1로 표시되는 것을 특징으로 하는 베체트병 진단용 키트.
5. The method of claim 4,
Wherein the UL48 protein is represented by SEQ ID NO: 1.
피검체의 혈청과 헤르페스 바이러스 UL48 단백질에 대한 항체 반응시키는 단계; 및
헤르페스 바이러스 UL48 단백질에 대한 항체와 특이적 면역반응성 여부를 확인하는 단계를 포함하는 피검체 혈청 내 베체트병 항원을 검출하는 방법.
Reacting the serum of the subject with an antibody to the herpes virus UL48 protein; And
A method for detecting a Behçet's disease antigen in a serum of a subject, comprising the step of confirming whether the herpes virus UL48 protein is specifically immunoreactive with the antibody.
제 7항에 있어서,
항체는 IgA 또는 IgG 인 것을 특징으로 하는 피검체 혈청 내 베체트병 항원을 검출하는 방법.
8. The method of claim 7,
Wherein the antibody is IgA or IgG.
제 7항에 있어서,
UL48 단백질은 서열번호 1로 표시되는 것을 특징으로 하는 피검체 혈청 내 베체트병 항원을 검출하는 방법.
8. The method of claim 7,
Wherein the UL48 protein is represented by SEQ ID NO: 1. 2. A method for detecting a Behçet's disease antigen in serum of a subject.
피검체의 혈청과 헤르페스 바이러스 UL48 단백질을 반응시키는 단계; 및
피검체의 혈청과 헤르페스 바이러스 UL48 단백질의 특이적 면역반응성 여부를 확인하는 단계를 포함하는 피검체 혈청 내 베체트병 항체를 검출하는 방법.
Reacting the sera of the subject with the herpes virus UL48 protein; And
A method for detecting a Behcet's disease antibody in a serum of a subject comprising the step of confirming whether the serum of the subject and the herpes virus UL48 protein are specifically immunoreactive.
제 10항에 있어서,
피검체의 혈청내 항체는 IgA 또는 IgG 인 것을 특징으로 하는 피검체 혈청 내 베체트병 항체를 검출하는 방법.
11. The method of claim 10,
A method for detecting a Behcet's disease antibody in a serum of a subject, wherein the antibody in the serum of the subject is IgA or IgG.
제 10항에 있어서,
UL48 단백질은 서열번호 1로 표시되는 것을 특징으로 하는 피검체 혈청 내 베체트병 항체를 검출하는 방법.
11. The method of claim 10,
Wherein the UL48 protein is represented by SEQ ID NO: 1. 2. A method for detecting a Behcet's disease antibody in a serum of a subject.
헤르페스 바이러스 UL48 단백질에 대한 항체를 유효성분으로 포함하는 베체트병 치료용 약학조성물.A pharmaceutical composition for treating Behcet's disease comprising an antibody against the herpes virus UL48 protein as an active ingredient. 삭제delete
KR1020130158140A 2013-12-18 2013-12-18 A kit for diagnosing behcet's disease comprising antibodies against herpes simplex virus type 1 ul48 protein KR101514631B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130158140A KR101514631B1 (en) 2013-12-18 2013-12-18 A kit for diagnosing behcet's disease comprising antibodies against herpes simplex virus type 1 ul48 protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130158140A KR101514631B1 (en) 2013-12-18 2013-12-18 A kit for diagnosing behcet's disease comprising antibodies against herpes simplex virus type 1 ul48 protein

Related Child Applications (1)

Application Number Title Priority Date Filing Date
KR1020150029207A Division KR101568632B1 (en) 2015-03-02 2015-03-02 A kit for diagnosing Behcet’s disease comprising antibodies against HSC71 protein

Publications (1)

Publication Number Publication Date
KR101514631B1 true KR101514631B1 (en) 2015-04-23

Family

ID=53053953

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130158140A KR101514631B1 (en) 2013-12-18 2013-12-18 A kit for diagnosing behcet's disease comprising antibodies against herpes simplex virus type 1 ul48 protein

Country Status (1)

Country Link
KR (1) KR101514631B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020040450A1 (en) * 2018-08-20 2020-02-27 아주대학교산학협력단 Composition for prevention or treatment of behcet's disease or herpes simplex virus infection comprising eubacterium rectale

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050060537A (en) * 2003-12-16 2005-06-22 바이오코아 주식회사 α-enolase for diagnosing autoimmune disease

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050060537A (en) * 2003-12-16 2005-06-22 바이오코아 주식회사 α-enolase for diagnosing autoimmune disease

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CD4 and CD8 cell responses to herpes simplex virus in Behcet's disease (Clin. exp. Immunol., (1988), Vol. 73, pp 6-10.) *
Natural killer cell activity, interferon-gammma and antibodies to herpes viruses in patients with Behcet's disease (Clin. exp. Immunol., (1990), Vol. 79, pp 28-34.) *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020040450A1 (en) * 2018-08-20 2020-02-27 아주대학교산학협력단 Composition for prevention or treatment of behcet's disease or herpes simplex virus infection comprising eubacterium rectale

Similar Documents

Publication Publication Date Title
US20180057541A1 (en) Senecavirus a antigens and methods of use
CA2834376A1 (en) Neutralizing antibodies to nipah and hendra virus
Allison et al. Antibody responses to the immunodominant Cryptosporidium gp15 antigen and gp15 polymorphisms in a case–control study of cryptosporidiosis in children in Bangladesh
KR101528169B1 (en) Method and kit for detection of anti-avibacterium paragallinarum antibody
JP2005531286A (en) Human monoclonal antibody Fab fragment directed against HCVE2 glycoprotein and having in vitro neutralizing activity
CN112961222A (en) 2019 novel coronavirus N protein linear epitope peptide, monoclonal antibody and application
KR20170106407A (en) Immunological detection and kit of mycoplasma pneumoniae
US20230348591A1 (en) Methods for detecting early damage of blood-brain barrier during cerebral ischemic stroke and application thereof
US10100092B2 (en) Compositions and methods to detect various infectious organisms
KR101667122B1 (en) Improved vaccine diagnostics
AU744477B2 (en) Peptides useful for reducing symptoms of toxic shock syndrome
KR101568632B1 (en) A kit for diagnosing Behcet’s disease comprising antibodies against HSC71 protein
KR101514631B1 (en) A kit for diagnosing behcet&#39;s disease comprising antibodies against herpes simplex virus type 1 ul48 protein
US10273278B2 (en) Epitope recognized by anti-interferon gamma autoantibodies in patients with disseminated mycobacterial infections and the application therefor
Li et al. Characterization of novel Omp31 antigenic epitopes of Brucella melitensis by monoclonal antibodies
WO2022102744A1 (en) Antibody against spike protein of sars-cov-2
Yang et al. A novel double-antigen sandwich enzyme-linked immunosorbent assay for measurement of antibodies against rabies virus
Wu et al. Molecular cloning, expression, and characterization of cyclophilin A from Clonorchis sinensis
CN110437326B (en) Epitope polypeptide of bullous pemphigoid BP230 IgE antibody and application thereof
US20060057161A1 (en) Detection of coronavirus infection
KR101568457B1 (en) Diagnostic kit for Behcet&#39;s disease comprising GroEL
CN113493495B (en) Epitope of EB virus BALF4 protein
KR101565443B1 (en) Diagnostic kit for Behcet&#39;s disease comprising hnRNP-A2/B1
CN113493494B (en) Epitope of EB virus BALF3 protein
EP3925971A1 (en) Method for identifying compounds influencing virus receptor binding

Legal Events

Date Code Title Description
A107 Divisional application of patent
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20190318

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20200109

Year of fee payment: 6