KR101514631B1 - A kit for diagnosing behcet's disease comprising antibodies against herpes simplex virus type 1 ul48 protein - Google Patents

Abstract

The present invention relates to a Bechet′s disease diagnosing kit including antibodies against herpes virus protein U48. Bechet′s disease can be specifically and quickly diagnosed by the Bechet′s disease diagnosing kit of the present invention. Furthermore, Bechet′s disease can be treated by the antibodies.

Description

[0001] The present invention relates to a kit for diagnosing Behcet's disease comprising antibodies against the herpes virus protein U48, a herpes simplex virus type 1 UL48 protein,

The present invention relates to a Behcet's disease diagnostic kit comprising an antibody against the herpes virus protein U48.

The exact cause of Behcet's disease has not yet been elucidated, but blood vessels, especially vascular endothelial cells, are known to be the first target of Behcet's disease. It has also been shown that Streptococcus sanguis (S. sanguis) and herpes simplex virus play an important role in the development of Behcet's disease, and α-enolase, Streptococcus proteins, including glyceraldehyde-3-phosphate dehydrogenase, hypothetical protein and acid phosphatase, have been shown to react with serum IgM in patients with Behcet's disease However, the antigen for Bachert's disease is not known exactly.

Thus, the present inventors have confirmed that the serum of the patients with Behcet's disease reacts with the herpes simplex virus protein UL48 (VP16), thereby completing the present invention.

It is an object of the present invention to provide a Behcet's disease diagnostic kit comprising the herpes virus protein U48 or an antibody thereof for diagnosis of Behcet's disease. It is another object of the present invention to provide a method for detecting and diagnosing a Behcet's disease antigen or antibody using the herpes virus protein U48 or an antibody thereof.

Hereinafter, the components and technical features of the present invention will be described in more detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention and are not intended to limit the scope of the invention.

Various embodiments described herein are described with reference to the drawings. In the following description, for purposes of complete understanding of the present invention, various specific details are set forth, such as specific forms, compositions, and processes, and the like. However, certain embodiments may be practiced without one or more of these specific details, or with other known methods and forms. In other instances, well-known processes and techniques of manufacture are not described in any detail, in order not to unnecessarily obscure the present invention. Reference throughout this specification to "one embodiment" or "embodiment" means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in at least one embodiment of the invention. Accordingly, the appearances of the phrase " in one embodiment "or" the embodiment "in various places throughout this specification are not necessarily indicative of the same embodiment of the present invention. In addition, a particular feature, form, composition, or characteristic may be combined in any suitable manner in one or more embodiments.

In one embodiment of the present invention, a kit for the diagnosis of Behcet's disease comprising an antibody against the herpes virus UL48 protein is provided. In the above embodiment, the antibody is IgA or IgG, and the kit for diagnosing Behcet's disease is provided, wherein the UL48 protein is represented by SEQ ID NO: 1.

In one embodiment of the present invention, a kit for the diagnosis of Behcet's disease comprising herpes virus UL48 protein is provided. In this embodiment, the UL48 protein specifically binds to an antibody in the serum of a patient having Behçet's disease, and the UL48 protein is a Bethel disease Provide a diagnostic kit.

In one embodiment of the present invention, there is provided a method for detecting a herpes virus UL48 protein, comprising: reacting a sera of a subject with an herpes virus UL48 protein; And confirming whether or not a specific immunoreactivity with the antibody against the herpes virus UL48 protein is present in the serum of the subject. Wherein the antibody is IgA or IgG, wherein the UL48 protein is selected from the group consisting of a Behcet's disease antigen Is detected.

In one embodiment of the present invention, there is provided a method comprising: reacting a sera of a subject with a herpes virus UL48 protein; And a step of confirming whether the serum of the subject and the herpes virus UL48 protein are specifically immunoreactive. The present invention also provides a method for detecting a Behçet's disease antibody in a serum of a subject. The present invention provides a method for detecting a Behcet's disease antibody in a serum of a subject, wherein the antibody in the serum of the subject is IgA or IgG, and the UL48 protein is a protein having the amino acid sequence of SEQ ID NO: A method for detecting a Behcet's disease antibody in serum is provided.

In one embodiment of the present invention, there is provided a pharmaceutical composition for treating Behcet's disease comprising an antibody against the herpes virus UL48 protein as an active ingredient.

In one embodiment of the present invention, Behcet's disease is recognized as a disease that occurs in various organs, and is characterized by oral, vaginal ulceration, ocular lesions, and skin lesions as main symptoms, and mainly includes cardiovascular, respiratory, digestive, , Urinary tract, and the like. Although Behcet's disease has been reported worldwide, it has been reported relatively rarely in Western Europe and the United States. It is expected to have something to do with silk roads in history, especially in Mediterranean countries like Turkey, Greece, Italy, Lebanon, Arabia and Korea, Japan and China. The ratio of male to female in the Middle East is 3.8: 1, Turkey is 3.3: 1, Iraq is 3.8: 1, Greece is Mediterranean: 4.3: 1, Italy is 4.8: 1 ), Whereas in Japan (0.95: 1) and China (0.75: 1), the incidence of female was high and in female, frequency of female was high. However, the incidence of HLA-B5 in this disease is common in racially different countries, such as Japan, the United Kingdom, Turkey, France, Israel and Korea, and is believed to be related to environmental and cultural similarities. According to the domestic reports, the age distribution of the patients was the largest in the 20s, and the occupation distribution of the patients was office workers, female housewives, and family history of about 15% of the patients. The cause of the disease is viral, allergic to streptococcal antigen, heavy metal poisoning, genetic association, immune system legend, but there is no definite diagnosis. .

As used herein, the term "vector" means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, a phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector And (c) a restriction enzyme cleavage site allowing the foreign DNA fragment to be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

The kit for diagnosing Behcet's disease according to the present invention is basically applied to immunoassay to diagnose Behcet's disease. Such immunoassay can be performed according to various immunoassay or immunostaining protocols developed conventionally. The immunoassay or immuno-staining formats may be used in a variety of ways including, but not limited to, radioimmunoassays, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hardwood analysis, sandwich analysis, flow cytometry, ≪ / RTI > and immunoaffinity purification. Methods of immunoassay or immunostaining are described in Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference. In the ELISA method and the capture-ELISA method, measurement of the activity of the final enzyme or measurement of the signal can be performed according to various methods known in the art. If biotin is used as a label, it can be easily detected by streptavidin. When luciferase is used, luciferin can easily detect a signal. By analyzing the intensity of the final signal by the above-described immunoassay, it is possible to diagnose Behcet's disease.

In addition to the above-described effective ingredients for administration, one or more further pharmaceutically acceptable carriers may be prepared. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components. If necessary, an antioxidant, , And other conventional additives such as a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or by the method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA.

The composition of the present invention may be administered to humans or animals by various routes including parenteral, intraarterial, intradermal, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous, The dosage varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and disease severity. The daily dose of the composition is about 10 ng / kg to 10 mg / kg, preferably about 80 to 400 ng / kg, and it is more preferable to administer the composition once a day or several times a day.

The kit for diagnosing Behcet's disease comprising the herpes virus UL48 protein of the present invention or an antibody thereof can specifically and rapidly diagnose Behcet's disease. Further, the above-mentioned antibody can be used to treat Behcet's disease.

Figure 1 shows the results of immunoprecipitation for IgA and IgG antibodies and HSV in serum samples obtained from five patients with Behcet's disease.
Figure 2 is the result of the average absorbance of serum IgA reactivity for recombinant HSV UL48 obtained from ELISA.
Figure 3 is a comparison of ELISA analysis and Western blot for serum IgA reactivity to recombinant HSV type 1 UL48 protein.
Figure 4 shows the average absorbance results of serum IgG and IgA responsiveness to recombinant HSV UL48.
Figure 5 is the result of immunoreactivity of HSV UL48 antibody to human dermal microvascular endothelial cells.
Figure 6 is the 14 distinct epitopes that have homology when assessing homology sequences between HSV UL48 protein and human HSC71.
Figure 7 shows the results of immunohistochemical staining for uninfected ICR mice, HSV-inoculated but symptom-free mice, and Vacher-like mice.

Hereinafter, the components and technical features of the present invention will be described in more detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention and are not intended to limit the scope of the invention.

Preparation of samples

Thirty patients with Behcet's disease were recruited and serum samples were obtained from patients who were clinically active in the disease according to at least two major criteria, and the resulting serum samples were stored at -70 < 0 > C. Serum from 30 healthy donors was included as a control.

Behcet's disease-like mouse model

HSV type 1 virus grown in Vero cells was inoculated into male ICR mice 4 to 5 weeks old to construct a Behcet's disease-like mouse model.

At this time, the ear lobe of the experimental mouse was scratched with a needle, and the virus was inoculated into the mouse twice at intervals of 10 days. Infected mice were observed for 16 weeks after the last inoculation. At least two HSV vaccinated mice with similar signs of Behcet's disease were used as Behcet's disease-like mouse models (N = 5). ICR mice (N = 2), which did not infect HSV, and ICR mice (N = 2), who received HSV but did not develop Behçet's disease, were included as controls.

Immune sedimentation  And LC - MALDI - TOF / TOF ( Liquid Chromatography - Matrix Assisted  Laser Desorption / Ionization - tandem Time - Of - Flight ) Method

Type 1 HSV strains grown in Vero cells were cultured with mixed serum from five Behcet 's disease patients for 16 hours. Protein G-Sepharose beads (Sigma, St. Louis, MO, U.S.A.) pretreated with 5 ug each of goat anti-human IgA and IgG antibodies were added and incubated overnight at 4 캜. Immunoprecipitates were suspended in sample buffer and separated using 10% SDS-polyacrylamide gel electrophoresis (PAGE). The gel pieces were cut out and analyzed by LC-MALDI-TOF / TOF.

Western blot analysis was performed using HDMECs lysed with lysed type 1 HSV, HSV and cultured human dermal microvascular endothelial cells (HDMECs) and sample buffer. Membranes were incubated with anti-VP16-labeled polyclonal antibody (ab4808; abcam, Cambridge, UK) and visualized using ECL (Enhanced Chemiluminescence). In addition, the lysed HDMECs were incubated with anti-VP16 labeled polyclonal antibody (abcam) for 16 hours. Protein G-Sepharose beads (Sigma) pretreated with 5 ug of goat anti-rabbit IgG antibody were added. Subsequently, immunoprecipitation and proteomic analysis were performed.

Preparation of expression vector and expression in bacteria

The protein coding region of HSV UL48 was amplified by polymerase chain reaction (PCR) using the 3 'oligonucleotide primer AGCTGCAGAT CTCGAG CTACCCACCGTACTCGTCAATTCC containing the 5' oligonucleotide primer GGGATCCGAG CTCGAG ATGGACCTCTTGGTCGACGAGCTG containing the underlined Xho I cleavage site and the underlined XhoI cleavage site, Lt; / RTI > The PCR amplified products were separated on gel and cloned into pRSET bacterial expression vector (Invitrogen, Grand Island, NY, USA). The finished product was verified by DNA sequencing. HSV UL48 was overexpressed in E. coli BL21 and the overexpressed HSV UL48 recombinant protein was purified to homogeneity using Ni-NTA resin (Sigma). Recombinant HSV UL 48 protein was stored at -30 ° C until use.

Recombinant type 1 herpes simplex virus ( HSV ) UL48 Using Western Blot

One ug of purified recombinant type 1 HSV UL48 protein was suspended in sample buffer. Samples were loaded onto 12% polyacrylamide gels and electrophoresed at 100V. Membranes were incubated at 4 [deg.] C with serum samples from normal control or Behcet's disease patients diluted 1: 500 with primary antibody dilution buffer (1% skim milk, 10 mM Tris pH 7.5, 100 mM NaCl, 0.1% Tween 20) Lt; / RTI > overnight. Membranes were washed 6 times with PBST and incubated with peroxidase-conjugated goat anti-human (Gibco) diluted 1: 10000 in blocking buffer (1% skim milk, 10 mM Tris pH 7.5, 100 mM NaCl, 0.1% Tween 20) IgA and IgG antibodies at room temperature for 1 hour. After incubation the membranes were visualized using ECL.

ELISA  ( Enzyme Linked Immunosorient assay )

ELISA was performed by reacting recombinant type 1 HSV UL48 protein with serum from patients with Behcet's disease and IgG and IgA in the purchased control serum. 96 well microtiter plates (Immuno2, HB, Thermo Scientific, Waltham, MA, USA) were coated overnight with 300 ng UL48 protein. After coating, serum from 30 patients with Behcet's disease and 100 ul of serum from 30 healthy controls were diluted 1:20 in PBST containing 1% bovine serum albumin (BSA, Sigma, St Louis, MO, USA) , To each well in each 96-well plate. Plates were incubated at 37 [deg.] C for 2 hours. Antibody binding was quantified by colorimetric analysis by adding a substrate (tetramethylbenzidine) to each well. The absorbance of the plate was measured spectrophotometrically at 450 nm on an ELISA reader (Alexandria, VA, USA). The positivity was defined as the absorbance value above the standard deviation above the mean value of the healthy controls.

Immunohistological analysis

Experimental mice were sacrificed and tissue samples of the knee joint were obtained and fixed. Tissue sections (4 μm thickness) from Behcet's disease-like mouse models, uninfected ICR mice and HSV-inoculated but symptom-free mice were incubated with diluted primary anti-serum for 1 hour at room temperature. Rabbit anti-VP16 labeled polyclonal antibody (abcam) was diluted 1: 200. After washing with PBS, the tissue sections were incubated with HRP-conjugated secondary anti-serum diluted 1: 100 for 30 minutes. The tissue section was then lightly counterstained with hematoxylin. Negative controls were obtained by omitting the primary antibody. Staining intensity was analyzed using Metamorph software version 7.7.1.0 (Molecular Devices Inc., Sunnyvale, Calif., USA).

Statistical analysis

Numerical values for qualitative variables are described as intermediate range and quartile range. The reactivity of the sera to recombinant type 1 HSV UL48 protein was assessed by the Mann-Whitney U test, the X ² tests and the chi-square test (Fisher's exact test) using a non-parametric test between the Behcet's disease mouse model and control mice and Behcet's disease patients and healthy subjects ). DeLong? The diagnostic accuracy of western blot and ELISA using recombinant type 1 HSV UL48 protein was analyzed by comparing the area under the receptor function curve using the method of Behcet 's disease. All analyzes were performed using SAS software version 9.2 (SAS Institute Inc., Cary, NC, USA). P <0.05 was considered significant.

Example  One. Immune sedimentation  And proteomics analysis

Immunoprecipitation was performed on IgA and IgG antibodies and HSV-like fungi in serum samples obtained from five patients with Behcet's disease (Fig. 1). The four protein bands obtained by IgA (N = 2) and IgG (N = 2) immunoprecipitation were analyzed using LC-MALDI-TOF / TOF and DNA sequences corresponding to the four protein bands in the NCBI database Respectively. After excluding false positive results and data containing immunoglobulin, the following viral proteins specifically identified Mascot values greater than 30; UL48 in the IgA-reactive protein band, alpha trans inducing factor, genomic polyprotein; The glycoprotein D, UL48, alpha trans inducing factor, envelope glycoprotein D, glycoprotein C-1 and genomic polyprotein in the IgG-reactive protein band (Table 1).

HSV proteins that respond to IgA and IgG type Identified protein Switzerland - Plot Accession Number NCBI deposit number M r (kDa) / p I Mascot score IgA UL48 ABI63509 gi│14318835 54698 / 4.92 158 Alpha trans inducing factor AAA45766 gi | 30055 53396 / 4.95 133 Genome polyprotein P07564 gi | 30428 382498 / 8.75 69 IgG Glycoprotein D ABM52980 gi│21277019 43744 / 8.10 182 UL48 ABI63509 gi│14318835 54698 / 4.92 173 Alpha trans inducing factor AAA45766 gi | 30055 53396 / 4.95 158 Envelope glycoprotein D P06476
gi | 38233 43767 / 8.89 107 Glycoprotein C-1 CAD13356 gi│7426768 55560 / 7.16 54 Genome polyprotein P14335 gi | 30494 384959 / 8.70 54

Of the identified proteins, HSV UL48 (predicted molecular weight (M _r ) / p I , 54698 / 4.92; NCBI Deposition Number, gi | 14318835; Switzerland-Plot Deposit Number, ABI 63509) had mascot values of 158 and 173 in the IgA and IgG reactive protein bands, respectively, and sequence coverage of 14% and 16%, respectively. Therefore, HSV UL48 was considered to be the antigen of Bacchott disease in that it most specifically binds to the serum of patients with Behcet's disease, and additional analysis of HSV UL 48 protein was performed.

Example  2. Recombination in patients with Behcet's disease HSV UL48  Serum Reactivity to

       ELISA and Western blot analysis using recombinant HSV UL48 were performed to determine the reactivity of sera using sera obtained from 30 patients with Behcet's disease and 30 healthy controls. The mean absorbance (quartile range) of serum IgA reactivity for recombinant HSV UL48 obtained from ELISA was 0.35 (0.02-1.01) in Behcet's disease patients and 0.1 (0.02-0.40) in healthy controls (P <0.001) 2a). Positive serum IgA reactivity for UL48 was seen in 24 Behcet's disease patients (80%) and 5 healthy controls (16.7%), if positivity was defined as the absorbance reading above the mean absorbance + standard deviation of healthy controls. Western blot analysis verified that the reactivity of serum IgA to recombinant HSV UL48 was 10 patients with Behcet's disease (33.3%) and 2 healthy controls (6.7%) (P = 0.010) (FIG.

In addition, the median absorbance (quartile range) of serum IgG responsiveness to recombinant HSV UL48 was 0.58 (0.32-1.22) in patients with Behcet's disease and 0.53 (0.18-0.74, P = 0.045 ) in healthy controls (Figure 2b). Positive serum IgG responsiveness to UL48 was observed in 12 patients with Behcet's disease (40%) and 6 healthy controls (20%). Western blot analysis confirmed that the reactivity of serum IgG to recombinant HSV UL48 occurred in 18 patients with Behcet's disease (60%) and 4 healthy controls (13.3%, P <0.001 ) (Fig. 2c).

For serum IgA reactivity to recombinant HSV type 1 UL48 protein, ELISA assays were more accurate in the diagnosis of Behcet's disease than in Western blots (AUROC ELISA vs. Western blotting, 0.852 vs 0.633, P = 0.003) ). However, for serum IgG responsiveness to recombinant HSV type 1 UL48 protein, ELISA and Western blotting similarly diagnosed Behcet's disease (AUROC ELISA vs. western blotting 0.651 vs. 0.733, P> 0.05 ) (Figure 3b) .

Example  3. Recombination of Behcet's disease-like mouse model HSV UL48 Serum Reactivity to

ELISA and Western blot analysis using recombinant HSV UL48 were performed to determine serum reactivity using serum from five Behçet's disease-mimicked mouse models, two non-infected ICR mice and two HSV-infected mice but no symptoms.

The mean absorbance (quartile range) of serum IgA responsiveness to recombinant HSV UL48 obtained from ELISA was 0.31 (0.14-0.75) in the Behçet's disease-like mouse model, 0.10 (0.07-0.75) in the uninfected ICR mouse and HSV inoculated mice, 0.14, P = 0.037 ) (Fig. 4A). However, Western blot analysis showed that serum IgA reactivity to recombinant HSV UL48 was present only in five Behcet-like mice, and not in uninfected ICR mice and HSV inoculated mice ( P = 0.008 , 4b).

In addition, the average absorbance of serum IgG reactivity to recombinant HSV UL48 was 0.07 (0.04-0.11) in the Behcet disease-like mouse model and 0.04 (0.02-0.08) (P> 0.05) in the uninfected ICR mouse and HSV inoculated mice ) (Fig. 4A). Western blot analysis showed that serum IgG reactivity to recombinant HSV UL48 was observed in only 2 out of 5 (50%) of Behcet's disease-like mice, and in uninfected ICR mice and HSV inoculated but symptom-free ( P> 0.05 ) (Fig. 4B).

Example  4. Human dermal microvascular endothelial cells HSV UL48  Immunoreactivity of antibodies

Western blot analysis using HSV 1 type, HDMEC cultured with HSV, and HDMEC confirmed that the anti-HSV UL48 polyclonal antibody reacted with a protein band far away in the HDMEC as compared with HSV type 1 ). Immunoprecipitation was performed and two protein bands were analyzed by the proteomics described above (Figure 5b). In general, antibodies against UL48 protein should be reacted only to the proteins of herpes simplex virus, but they may also be found in HDMEC and HDMEC cultured with HSV, Of the total.

After excluding data containing false positives and immunoglobulins, the following human proteins specifically identified Mascot values greater than 30: keratin 1, epidermal cytokeratin 2, VIM, keratin 6B isoform CRA a, heat shock cognate 71 kDa protein-like 1, alpha-tubulin, factor VII active site-mutant immunoconjugates and MTHSP75 (Table 2).

Of the identified proteins, heat shock cognate 71 kDa protein mimetic 1 (measured molecular weight (Mr) / p I , 71082 / 5.37); NCBI Deposition Number, gi | 729877; Switzerland-Plot Deposit No., NP_006588).

Identified protein of HDMEC reacting with anti-HSV UL48 protein antibody Identified protein Switzerland - Plot Accession Number NCBI deposit number M r (kDa) / p I Mascot score Heat shock cognate 71 kDa protein isoform 1 NP_006588 gi | 729877 71082 / 5.37 79 Alpha-tubulin CAA25855 gi | 7492 50810 / 5.02 73 Factor VII active site mutant immunoconjugate AAK58686 gi | 8269794 77386 / 6.60 65 MTHSP75 AAA67526 gi│92059 74019 / 5.97 62

The homology sequences between HSV UL48 protein and human HSC71 were evaluated using the alignment algorithm of T-Coffee (http://www.tcoffee.org). As a result, 14 distinct epitopes with important homology were detected (Figure 6)

Example  5. Confirmation by immunohistochemical staining

No or less inflammatory cell invasion was found in the tissue samples of the knee joint obtained from uninfected ICR mice and HSV inoculated but symptom-free mice (Fig. 7a-d). On the other hand, inflammatory cell invasion was found in the joints obtained from Bacet-like mice (Fig. 7e, f). All groups of experimental mice showed immunoreactivity to the anti-HSV UL48 antibody in the epithelium of the lachrymal membrane. In addition, both inflammatory cells and dermal cells showed noticeable immunoreactivity to anti-HSV UL48 antibodies in tissue samples obtained from Barrett's disease-like mice (Fig. 7e, f).

The contents of the present invention can be referred to the following references.

1. Sakane T, Takeno M, Suzuki N, Inaba G. Behcet's disease. N Engl J Med 1999; 341 : 1284-91.

2 . Suzuki Kurokawa M, Suzuki N. Behcet's disease. Clin Exp Med 2004; 4 : 10-20.

3. Kalayciyana, Zouboulis C. An update on Behcet's disease. J Eur Acad Dermatol Venereol 2007; 21 : 1-10.

4. Cho SB, Cho S, Bang D. New insights in the clinical understanding of Behcet's disease. Yonsei Med J 2012; 53 : 35-42.

5. Behcet H. Uer rezidivierende, aphthose, durch ein Virus verurschte Geschwure im Mund, am Auge und an den Genitalien. Dermatol Wochenschr 1937; 105 : 1152-7.

6. Kaneko F, Oyama N, Yanagihori H, Isogai E, Yokota K, Oguma K. The role of streptococcal hypersensitivity in the pathogenesis of Behcet's disease. Eur J Dermatol 2008; 18 : 489-98.

7. Eglin RP, Lehner T, Subak-Sharpe JH. Detection of RNA complementary to herpes simplex virus in mononuclear cells from patients with Behcet's syndrome and recurrent oral ulcers. Lancet 1982; 2 : 1356-61.

8. Lee S, Bang D, Cho YH, Lee ES, Sohn S. Polymerase chain reaction reveals herpes simplex virus DNA in saliva of patients with Behcet's disease. Arch Dermatol Res 1996; 288 : 179-83.

9. Cho SB, Zheng Z, Ahn KJ et al . Serum IgA reactivity against GroEL of Streptococcus sanguinis and human heterogeneous nuclear ribonucleoprotein A2 / B1 in patients with Behcet's disease. Br J Dermatol 2013; 168 : 977-83.

10. Quinna, Shinnick TM, Cunningham MW. Anti-Hsp65 antibodies recognize M proteins of group A streptococci. Infect Immun 1996; 64 : 818-24.

11. Kapustian LL, Vigontina OA, Rozhko OT et al . Hsp90 and its co-chaperone, Sgt1, as autoantigens in dilated cardiomyopathy. Heart Vessels 2013; 28 : 114-9.

12. Marino Gammazzaa, Bucchieri F, Grimaldi LM et al . The molecular anatomy of human Hsp60 and its similarity with bacterial orthologs and acetylcholine receptor revealed a potential pathogenetic role of anti-chaperonin immunity in myasthenia gravis. Cell Mol Neurobiol 2012; 32 : 943-7.

13. Cho SB, Ahn KJ, Kim DH et al . Identification of HnRNP-A2 / B1 as a target antigen of anti-endothelial cell IgA antibody in Behcet's disease. J Invest Dermatol 2012; 132 : 601-8.

14. Sohn S, Lee ES, Bang D, Lee S. Behcet's disease-like symptoms induced by the herpes simplex virus in ICR mice. Eur J Dermatol 1998; 8 : 21-3.

15. Sohn S, Lee ES, Bang D. Learning from HSV-infected mice as a model of Behcet's disease. Clin Exp Rheumatol 2012; 30 : S96-103.

16. International Study Group for Behcet's Disease. Criteria for diagnosis of Behcet's disease. Lancet 1990; 335 : 1078-80.

While the present invention has been described with reference to exemplary embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. You will know. In addition, many modifications may be made to adapt a particular situation and material to the teachings of the invention without departing from the essential scope thereof. Accordingly, it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention, but that the invention be construed as including all embodiments falling within the scope of the appended claims.

<110> yonsei university industry academic cooperation foundation <120> A kit for diagnosing Behcet's disease containing antibodies          against herpes simplex virus type 1 UL48 protein <130> 1223 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 490 <212> PRT <213> herpes simplex virus type 1 UL48 protein <400> 1 Met Asp Leu Leu Val Asp Glu Leu Phe Ala Asp Met Asn Ser Asp Gly   1 5 10 15 Ala Ser Pro Pro Pro Pro Arg Pro Ala Gly Gly Pro Lys Asn Thr Pro              20 25 30 Ala Ala Pro Pro Leu Tyr Ala Thr Gly Arg Leu Ser Gln Ala Gln Leu          35 40 45 Met Pro Ser Pro Pro Met Pro Pro Pro Ala Ala Leu Phe Asn Arg      50 55 60 Leu Leu Asp Asp Leu Gly Phe Ser Ala Gly Pro Ala Leu Cys Thr Met  65 70 75 80 Leu Asp Thr Trp Asn Glu Asp Leu Phe Ser Ala Leu Pro Thr Asn Ala                  85 90 95 Asp Leu Tyr Arg Glu Cys Lys Phe Leu Ser Thr Leu Pro Ser Asp Val             100 105 110 Val Glu Trp Gly Asp Ala Tyr Val Pro Glu Arg Ala Gln Ile Asp Ile         115 120 125 Arg Ala His Gly Asp Val Ala Phe Pro Thr Leu Pro Ala Thr Arg Asp     130 135 140 Gly Leu Gly Leu Tyr Tyr Glu Ala Leu Ser Arg Phe Phe His Ala Glu 145 150 155 160 Leu Arg Ala Arg Glu Glu Ser Tyr Arg Thr Val Leu Ala Asn Phe Cys                 165 170 175 Ser Ala Leu Tyr Arg Tyr Leu Arg Ala Ser Val Arg Gln Leu His Arg             180 185 190 Gln Ala His Met Arg Gly Arg Asp Arg Asp Leu Gly Glu Met Leu Arg         195 200 205 Ala Thr Ile Ala Asp Arg Tyr Tyr Arg Glu Thr Ala Arg Leu Ala Arg     210 215 220 Val Leu Phe Leu His Leu Tyr Leu Phe Leu Thr Arg Glu Ile Leu Trp 225 230 235 240 Ala Ala Tyr Ala Glu Gln Met Met Arg Pro Asp Leu Phe Asp Cys Leu                 245 250 255 Cys Cys Asp Leu Glu Ser Trp Arg Gln Leu Ala Gly Leu Phe Gln Pro             260 265 270 Phe Met Phe Val Asn Gly Ala Leu Thr Val Gly Val Ile Glu         275 280 285 Ala Arg Arg Leu Arg Glu Leu Asn His Ile Arg Glu His Leu Asn Leu     290 295 300 Pro Leu Val Arg Ser Ala Ala Thr Glu Glu Pro Gly Ala Pro Leu Thr 305 310 315 320 Thr Pro Pro Thr Leu His Gly Asn Gln Ala Arg Ala Ser Gly Tyr Phe                 325 330 335 Met Val Leu Ile Arg Ala Lys Leu Asp Ser Tyr Ser Ser Phe Thr Thr             340 345 350 Ser Pro Ser Glu Ala Val Met Arg Glu His Ala Tyr Ser Arg Ala Arg         355 360 365 Thr Lys Asn Asn Tyr Gly Ser Thr Ile Glu Gly Leu Leu Asp Leu Pro     370 375 380 Asp Asp Ala Pro Lys Glu Ala Gly Leu Ala Ala Pro Arg Leu Ser 385 390 395 400 Phe Leu Pro Ala Gly His Thr Arg Arg Leu Ser Thr Pro Pro Thr                 405 410 415 Asp Val Ser Leu Gly Asp Glu Leu His Leu Asp Gly Glu Asp Val Ala             420 425 430 Met Ala His Ala Asp Ala Leu Asp Asp Phe Asp Leu Asp Met Leu Gly         435 440 445 Asp Gly Asp Ser Pro Gly Pro Gly Phe Thr Pro His Asp Ser Ala Pro     450 455 460 Tyr Gly Ala Leu Asp Met Ala Asp Phe Glu Phe Glu Gln Met Phe Thr 465 470 475 480 Asp Ala Leu Gly Ile Asp Glu Tyr Gly Gly                 485 490

Claims (14)

A kit for the diagnosis of Behcet's disease comprising an antibody against the herpes virus UL48 protein. The method according to claim 1,
Wherein the antibody is IgA or IgG. The method according to claim 1,
Wherein the UL48 protein is represented by SEQ ID NO: 1. Kit for the diagnosis of Behcet's disease comprising the herpes virus UL48 protein. 5. The method of claim 4,
Wherein the UL48 protein specifically binds to an antibody in serum of a patient having Behçet's disease. 5. The method of claim 4,
Wherein the UL48 protein is represented by SEQ ID NO: 1.
Reacting the serum of the subject with an antibody to the herpes virus UL48 protein; And
A method for detecting a Behçet's disease antigen in a serum of a subject, comprising the step of confirming whether the herpes virus UL48 protein is specifically immunoreactive with the antibody. 8. The method of claim 7,
Wherein the antibody is IgA or IgG. 8. The method of claim 7,
Wherein the UL48 protein is represented by SEQ ID NO: 1. 2. A method for detecting a Behçet's disease antigen in serum of a subject. Reacting the sera of the subject with the herpes virus UL48 protein; And
A method for detecting a Behcet's disease antibody in a serum of a subject comprising the step of confirming whether the serum of the subject and the herpes virus UL48 protein are specifically immunoreactive. 11. The method of claim 10,
A method for detecting a Behcet's disease antibody in a serum of a subject, wherein the antibody in the serum of the subject is IgA or IgG. 11. The method of claim 10,
Wherein the UL48 protein is represented by SEQ ID NO: 1. 2. A method for detecting a Behcet's disease antibody in a serum of a subject. A pharmaceutical composition for treating Behcet's disease comprising an antibody against the herpes virus UL48 protein as an active ingredient. delete

Images