KR101565299B1 - Composition comprising hydrolysate of whey protein using alcalase for preventing or treating atopic dermatitis or allergic diseases - Google Patents

Composition comprising hydrolysate of whey protein using alcalase for preventing or treating atopic dermatitis or allergic diseases Download PDF

Info

Publication number
KR101565299B1
KR101565299B1 KR1020130137694A KR20130137694A KR101565299B1 KR 101565299 B1 KR101565299 B1 KR 101565299B1 KR 1020130137694 A KR1020130137694 A KR 1020130137694A KR 20130137694 A KR20130137694 A KR 20130137694A KR 101565299 B1 KR101565299 B1 KR 101565299B1
Authority
KR
South Korea
Prior art keywords
hydrolyzate
allergic
lactoglobulin
atopic dermatitis
bsa
Prior art date
Application number
KR1020130137694A
Other languages
Korean (ko)
Other versions
KR20150055666A (en
Inventor
남명수
유재민
Original Assignee
충남대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충남대학교산학협력단 filed Critical 충남대학교산학협력단
Priority to KR1020130137694A priority Critical patent/KR101565299B1/en
Publication of KR20150055666A publication Critical patent/KR20150055666A/en
Application granted granted Critical
Publication of KR101565299B1 publication Critical patent/KR101565299B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/39Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/38Albumins

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 알칼라아제를 이용한 유청 단백질의 가수분해물을 함유하는 아토피 피부염 또는 알레르기 질환의 예방 또는 치료용 조성물에 관한 것으로서, 상기 유청 단백질의 가수분해물 중 분자량 3kDa 이하인 것을 선택적으로 추출한 가수분해물이 특히 IL-6, TNF-α 및 IL-13의 발현 억제 효과가 우수하여, 아토피 피부염 또는 알레르기 질환의 치료용 조성물로 유용하게 이용될 수 있다.The present invention relates to a composition for preventing or treating atopic dermatitis or an allergic disease, which comprises a hydrolyzate of a whey protein using an alkaline protease, wherein a hydrolyzate obtained by selectively extracting a whey protein having a molecular weight of 3 kDa or less, -6, TNF-a and IL-13, and thus can be effectively used as a composition for the treatment of atopic dermatitis or allergic diseases.

Description

알칼라아제를 이용한 유청 단백질의 가수분해물을 함유하는 아토피 피부염 또는 알레르기 질환의 예방 또는 치료용 조성물 {Composition comprising hydrolysate of whey protein using alcalase for preventing or treating atopic dermatitis or allergic diseases}BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a composition for preventing or treating atopic dermatitis or an allergic disease containing hydrolysates of whey proteins using alcalase,

본 발명은 알칼라아제(alcalase)를 이용한 유청 단백질의 가수분해물을 함유하는 아토피 피부염 또는 알레르기 질환의 예방 또는 치료용 조성물에 관한 것이다. The present invention relates to a composition for preventing or treating atopic dermatitis or allergic diseases, which contains a hydrolyzate of whey protein using an alcalase.

우유는 건강에 유익한 효과를 나타내는 기능성 식품이며(Gill et al., 2000), 기능성 식품과 건강음료의 첨가제로서의 가치가 있는 것으로 알려져 있다(Huth et al., 2004). 또한 우유에 함유된 유청 단백질은 대사활동에서 폭 넓게 생리활성 기능을 가지고 있는 것으로 알려져 있다. 유청은 치즈제조공정에서 얻어지는 부산물로 버려지는 산물로 여겨졌지만, 근래에 영양학적으로 응용가치를 높일 수 있는 기능성 식품으로서 재발견되면서 이에 대한 연구가 급증하고 있다(Walzem et al., 2002). Milk is a functional food that has a beneficial effect on health (Gill et al. , 2000) and is known to be of value as an additive in functional foods and health drinks (Huth et al. , 2004). In addition, whey proteins in milk are known to have a wide range of physiological activities in metabolic activities. Whey has been considered a by-product of the cheese manufacturing process, but has recently been rediscovered as a functional food that can increase nutritional value (Walzem et al. , 2002).

유청(whey)은 우유를 치즈로 가공할 때 형성되는 부산물이다. 우유에는 수분, 단백질, 지방, 탄수화물, 무기질, 비타민, 효소 등이 포함되어 있다. 지방은 가장 중요한 성분이며 이것을 제외한 것을 탈지유라고 한다. 탈지유에 산 또는 응유효소를 첨가하면 응고물이 생기는데 이것을 응유(curd)라 하며 우유의 주단백질인 카세인이 주성분이다. 응유를 제외한 수용액을 유청이라 하고 전 단백질의 20%를 포함한다. 유청에는 유당, 무기질, 각종 유청 단백질 등이 포함되어 있다. 유청에 포함된 유청 단백질은 β-락토글로불린(β-lactoglobulin), α-락타알부민(α-lactalbumin), BSA(bovine serum albumin), 락토페린(lactoferrin), 면역글로불린(immunoglobulin), 효소(enzyme), GMP(glycomacropeptide) 등이 있으며, 면역글로불린은 특히 초유에 다량 함유되어 있다. 유청은 다양한 필수아미노산을 함유하고 있으며, 면역 증진 효과가 있다고도 보고된 바 있다(Marshall, 2004). Whey is a by-product formed when milk is processed into cheese. Milk contains water, protein, fat, carbohydrates, minerals, vitamins, and enzymes. Fat is the most important ingredient and the exception is skim milk. The addition of acid or cough enzyme to skim milk results in clotting, which is called curd and is the major component of milk, casein. The aqueous solution except for curdling is called whey and contains 20% of total protein. Whey contains lactose, minerals, and whey proteins. Whey proteins contained in whey are β-lactoglobulin, α-lactalbumin, bovine serum albumin (BSA), lactoferrin, immunoglobulin, enzyme, GMP (glycomacropeptide), etc., and immunoglobulin is especially contained in colostrum. Whey contains a variety of essential amino acids and has been reported to have immunomodulatory effects (Marshall, 2004).

우유 단백질의 가수분해물에 대한 생리활성 기능연구는 많이 진행되어 왔는데 지금까지 가장 잘 알려진 것은 면역조절 펩티드로서 β-카세인(β-casein, f1-28) 유래 CPP(casein phosphopeptide)이다. CPP는 마우스 비장과 토끼 Peyer's patch 세포에서 세포분열물질 촉진제(mitogen)로서의 활성을 나타내고 IgA 생산을 활성화한다고 보고된 바 있다(Hata et al., 1998). 또한 β-카세인 유래의 β-카소케모타이드-1(β-casochemotide-1)이라는 펩티드가 단핵구(monocyte)와 대식세포(macrophage)에서의 주화성을 높인다고 보고되기도 하였다(Kitazawa et al., 2007). Studies on the physiological activity of hydrolysates of milk protein have been carried out. The most well-known is the casein phosphopeptide (CPP) derived from β-casein (f1-28) as an immunomodulating peptide. CPP has been reported to act as a mitogen and activate IgA production in mouse spleen and rabbit Peyer's patch cells (Hata et al. , 1998). It has also been reported that a peptide called β-casochemotide-1 derived from β-casein increases the chemotaxis in monocytes and macrophages (Kitazawa et al. , 2007) .

알레르기(allergy)는 어떤 외래성 물질과 접한 생체가 그 물질에 대하여 정상과는 다른 반응을 나타내는 현상으로서, 생물체(生物體)가 어떤 외래성 물질과 접하게 되면 항원항체반응(抗原抗體反應)에 의하여 생체 내에 급격한 반응 능력의 변화가 생기는데, 이를 알레르기라고 한다. 생체는 이종물질에 대해서는 그 항원(抗原)에 특이적으로 반응하는 항체(抗體)와 림프구를 생산하고 재차 항원과 접하면 여러 가지 면역반응을 일으킨다. 이 면역응답 또는 면역반응은 생체의 자기 보존을 위한 중요한 방어메커니즘의 하나인데, 보통 생체에 대해 보호적으로 작용하지만 때로는 이 메커니즘이 생체에 불리하게 작용하여 장애를 일으키는 경우가 있다. 알레르기는 "과민 반응"이라는 뜻이으로서, 그리스어 낱말 allos가 어원이며, 이는 "변형된 것"을 뜻한다. 알레르기라는 용어는 1906년 프랑스 학자 폰 피르케가 처음으로 사용하였다. 알러지 또는 앨러지는 영어 발음, 알레르기는 독일어식 발음으로 한국어에선 둘 다 혼용되어 통용된다. 알레르기 반응을 유발하는 항원은 알레르겐(allergen)이라고 하며, 전형적인 알레르겐은 꽃가루, 약물, 식물성 섬유, 세균, 음식물, 염색약, 화학물질 등이 있다. 면역계에는 항원에 대항하여 신체를 지키기 위한 몇 가지 방어 메커니즘이 있다. 이들 중 가장 많은 종류는 림프구로, 특정 항원에 반응하기 위해 특이화되어 있으며, B세포와 T세포가 이에 해당한다. B세포는 항원에 결합하여 항원을 파괴시키고 중화시키는 단백질인 항체를 생성한다. T세포는 항체를 생산하는 대신에 항원에 직접 결합하여 공격을 자극한다. 알레르기 반응은 즉시형 알레르기 또는 지연형 알레르기로 나타나는데, 항원이 B세포나 T세포 중 어느 세포와 반응하는지에 따라 결정된다. 알레르기로 인해 일어나는 질환에는 자가면역질환, 교원병 등을 포함하여 여러 가지 질환이 있으나, 일반적으로 알레르기성 질환이라고 하는 경우에는 고전적 알레르기성 질환인, 아나필락시스 쇼크, 식품 알레르기, 알레르기성 비염, 화분증, 기관지천식, 약제 알레르기, 식물 알레르기, 두드러기, 습진, 알레르기성 접촉성 피부염 등이 이에 해당된다. 이들은 알레르기가 병의 원인인 질환이지만 그 발증(發症)에는 그 밖의 생체측 조건이 필요한 경우도 있다. 또한 비(非)알레르기적 메커니즘에 의해서도 동일한 증상이 나타날 수 있다. Allergy is a phenomenon in which a living organism in contact with an exogenous substance exhibits a different reaction to the substance than in the normal state. When an organism comes into contact with a certain exogenous substance, an antigenic antibody reaction There is a change in the response ability, which is called allergy. The living organism produces antibodies and lymphocytes that react specifically with the antigen (antigen) and reacts with the antigen again to cause various immune responses. This immune response or immune response is one of the important defense mechanisms for the self-preservation of living organisms. It usually acts on the living body in a protective manner, but sometimes this mechanism causes disability to the living body. Allergy means "hypersensitive", meaning that the Greek word allos is the etymology, which means "modified." The term allergy was first used by the French scholar von Pirke in 1906. Allergies or allergies are pronounced in English, and allergies are pronounced in German. Antigens that cause allergic reactions are called allergens. Typical allergens include pollen, drugs, vegetable fibers, bacteria, food, dyes, and chemicals. There are several defense mechanisms in the immune system to protect the body against antigens. The most abundant of these are lymphocytes, which are specific for reacting to specific antigens, including B cells and T cells. B cells bind to an antigen to produce an antibody that is a protein that destroys and neutralizes the antigen. Instead of producing antibodies, T cells directly bind to the antigen and stimulate the attack. An allergic reaction occurs as an immediate allergic or delayed allergy, depending on which of the B or T cells the antigen reacts to. The diseases caused by allergies include various diseases including autoimmune diseases and collagen diseases. Generally, allergic diseases are classified into classical allergic diseases such as anaphylactic shock, food allergy, allergic rhinitis, hay fever, bronchial asthma , Drug allergies, plant allergies, urticaria, eczema, and allergic contact dermatitis. They are allergic diseases that cause disease, but there are cases where other biochemical conditions are necessary for their development. The same symptoms may also be caused by non-allergic mechanisms.

아토피 피부염은 주로 유아기 혹은 소아기에 시작되는 만성적이고 재발성이 강한 염증성 피부질환으로 소양증(가려움증)과 피부건조증, 특징적인 습진을 동반한다. 유아기에는 얼굴과 팔다리의 펼쳐진 쪽 부분에 습진으로 시작되지만, 성장하면서 특징적으로 팔이 굽혀지는 부분과 무릎 뒤의 굽혀지는 부위에 습진의 형태로 나타나게 되며, 많은 경우에 성장하면서 자연히 호전되는 경향을 보인다. 어른의 경우 접히는 부위 피부가 두꺼워지는 태선화(lichenification)가 나타나고, 유소아기에 비해 얼굴에 습진이 생기는 경우가 많다. 아토피 피부염은 세계적으로 증가하는 추세이며 유병률이 인구의 20%라는 보고도 있다.Atopic dermatitis is a chronic, recurrent, inflammatory skin disease that starts in infancy or childhood and is accompanied by pruritus (itching), dry skin, and characteristic eczema. In infancy, it begins with eczema on the unfolded side of the face and limbs, but it appears as a form of eczema on the part where the arm is bent and on the bending part behind the knee in growth, and in many cases it tends to improve naturally . In adults, lichenification appears in which the skin folds up, and eczema is more common on the face than in childhood. Atopic dermatitis is a worldwide increasing trend and its prevalence is reported to be 20% of the population.

한편, 본 발명자들은 치즈 제조시 생성되는 부산물인 유청 단백질 중에서, β-락토글로불린(β-lactoglobulin, β-LG) 또는 소혈청알부민(Bovine Serum Albumin, BSA)을 알칼라아제로 분해한 가수분해물이 아토피 피부염 또는 알레르기 질환 관련 사이토카인을 억제하는 효과가 있음을 확인하고, 상기 가수분해물이 아토피 피부염 또는 알레르기 질환의 치료제로 이용될 수 있음을 밝힘으로서, 본 발명을 완성할 수 있었다. On the other hand, the inventors of the present invention found that hydrolyzate obtained by digesting? -Lactoglobulin (? -LG) or bovine serum albumin (BSA) with alkalase among whey proteins produced as a by- The present inventors have confirmed that there is an effect of suppressing atopic dermatitis or allergic disease-related cytokine and that the hydrolyzate can be used as a therapeutic agent for atopic dermatitis or allergic diseases.

유청 단백질을 효소분해한 가수분해물에 대해 분석된 선행문헌으로서, 효소가수분해에 의한 초유 유청으로부터 철-결합 펩티드(iron-binding peptide)의 생성에 관한 연구에서는 알칼라아제(alcalase)를 이용한 가수분해가 유청 단백질의 주요 성분들을 가수분해시킬 수 있음이 기재되어 있다. 여기에서 열처리된 초유 유청을 120분 동안 가수분해한 가수분해도는 알칼라아제(alcalase) 25.31%, 펩신(pepsin) 12.42%, 파파인(papain) 10.66%, 트립신(trypsin) 10.83%로 확인되고, 다른 단백질 분해효소에 비해 알칼라아제에 의한 유청 단백질의 가수분해가 우수하다고 보고된 바 있다(Smyth 및 Fitz-Gerald, 1998; Kim et al., 2007). 이러한 선행기술에서는 기능성 식품들과 의약품 소재로서 유청 단백질 가수분해물이 산업적으로 응용 가능함을 제시하고 있다. 그러나, 상기 선행문헌들에서는 알칼라아제를 이용하여 유청 단백질을 가수분해하여 얻은 가수분해물이 항아토피 또는 항알레르기 효과가 있다는 것은 개시되어 있지 않다. In a previous study analyzing the hydrolysates of whey proteins by enzymatic hydrolysis, a study on the production of iron-binding peptides from colostrum whey by enzymatic hydrolysis showed that hydrolysis with alcalase Is capable of hydrolyzing the major components of the whey protein. The degree of hydrolysis of the heat-treated colostrum whey for 120 minutes was found to be 25.31% for alcalase, 12.42% for pepsin, 10.66% for papain and 10.83% for trypsin, It has been reported that hydrolysis of whey proteins by alkalase is superior to proteinase (Smyth and Fitz-Gerald, 1998; Kim et al., 2007). This prior art suggests industrially applicable whey protein hydrolyzate as a functional food and pharmaceutical material. However, in the above-mentioned prior arts, it is not disclosed that the hydrolyzate obtained by hydrolyzing whey protein using alkalase has an anti-atopic or anti-allergic effect.

Gill HS, Rutherford KJ, Cross ML. 2000. Bovine milk : a unique source of immunomodulatory ingredients for functional foods. In Buttriss J, Saltmarsh M, eds. Functional Food II-Claims and Evidence. Cambridge, England: Royal Society of Chemistry Press pp. 82-90. Royal Society of Chemistry Press, Cambridge, England.Gill HS, Rutherford KJ, Cross ML. 2000. Bovine milk: a unique source of immunomodulatory ingredients for functional foods. In Buttriss J, Saltmarsh M, eds. Functional Food II-Claims and Evidence. Cambridge, England: Royal Society of Chemistry Press pp. 82-90. Royal Society of Chemistry Press, Cambridge, England. Hata I, Higashiyama S, Otani H. 1998. identification of a phosphopeptide in bovine alpha s1-casein digest as a factor influencing proliferation and immunoglobulin production in lymphocyte cultures. J. Dairy Res. 65:569-578.Hata I, Higashiyama S, Otani H. 1998. Identification of a phosphopeptide in bovine alpha s1-casein digesting as a factor influencing proliferation and immunoglobulin production in lymphocyte cultures. J. Dairy Res. 65: 569-578. Huth PJ, Layman DK, Brown PH. 2004. The emerging role of dairy proteins and bioactive peptides in nutrition and health. J. Nutr. 134: 961S.Huth PJ, Layman DK, Brown PH. 2004. The emerging role of dairy proteins and bioactive peptides in nutrition and health. J. Nutr. 134: 961S. Kim SB, Ku MJ, Cho WM, Ki KS, Kim HS, Nam MS. 2010. Production of Iron-Binding Peptides from Colostral Whey by Enzymatic Hydrolysis. Kor. J. Animal Food Sci. Resour. 20: 566-577.Kim, SB, Ku, MJ, Cho, WM, KS, Kim, HS, MS. 2010. Production of Iron-Binding Peptides from Colostral Whey by Enzymatic Hydrolysis. Kor. J. Animal Food Sci. Resour. 20: 566-577. Kim SB, Seo IS, Khan MA, Ki KS, Nam MS, Kim HS. 2007. Separation of iron-binding protein whey through enzymatic hydrolysis. Internat.Dairy J. 17: 625-631.Kim SB, Seo IS, Khan MA, Ki KS, Nam MS, Kim HS. 2007. Separation of iron-binding protein from whey through enzymatic hydrolysis. Internat.Dairy J. 17: 625-631. Kitazawa H, Yonezawa K, Tohno M, Shimosato T, Kawai Y, saito T, Wang JM. 2007. Enzymatic digestion of the milk protein β-casein releases potent chemotactic peptide(s) for monocytes and macrophages. Inter. Immunopharmac. 7: 1150-1159.Kitazawa H, Yonezawa K, Tohno M, Shimosato T, Kawai Y, Saito T, Wang JM. 2007. Enzymatic digestion of the milk protein β-casein releases potent chemotactic peptide (s) for monocytes and macrophages. Inter. Immunopharmac. 7: 1150-1159. Kunitz M. 1947. Crystalline soybean trypsin inhibitor. II. General properties. J. Gen. Physiol. 30: 291-297.Kunitz M. 1947. Crystalline soybean trypsin inhibitor. II. General properties. J. Gen. Physiol. 30: 291-297. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head bacteriophage T4. Nature 227: 680-685.Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head bacteriophage T4. Nature 227: 680-685. Marshall K. 2004. Therapeutic applications of whey protein. Alternative Medicine Review. 9: 136-156.Marshall K. 2004. Therapeutic applications of whey protein. Alternative Medicine Review. 9: 136-156. Smyth M, Fitz-Gerald RJ. 1998. Relationship between some characteristics of WPC hydrolysates and the enzyme complement in commercially available proteinase preparations. Internat. Dairy J. 8: 819-827. Smyth M, Fitz-Gerald RJ. 1998. Relationship between some characteristics of WPC hydrolysates and the enzyme complement. Internat. Dairy J. 8: 819-827. Walzem RL, Dillard CJ, German JB. 2002. Whey components: millennia of evolution create functionalities for mammalian nutrition: what we know and what we may be overlooking. Crit. Rev. Food Sci. Nutr. 42: 353-375.Walzem RL, Dillard CJ, German JB. 2002. Whey components: millennia of evolution create functionalities for mammalian nutrition: what we know and what we may be overlooking. Crit. Rev. Food Sci. Nutr. 42: 353-375.

본 발명의 목적은 알칼라아제를 이용한 유청 단백질의 가수분해물을 함유하는 아토피 피부염 또는 알레르기 질환의 예방 또는 치료용 조성물을 제공하는 데에 있다. It is an object of the present invention to provide a composition for the prevention or treatment of atopic dermatitis or allergic diseases which contains a hydrolyzate of whey protein using an alkalase.

본 발명은 β-락토글로불린(β-lactoglobulin, β-LG) 및 소혈청알부민(Bovine Serum Albumin, BSA) 중 1종 이상의 유청 단백질에 알칼라아제(alcalase)를 처리하여 얻은 가수분해물을 함유하는 아토피 피부염 또는 알레르기 질환의 예방 또는 치료용 조성물에 관한 것이다. The present invention relates to a method for producing atopic diseases comprising hydrolysates obtained by treating an alcalase with at least one whey protein of? -Lactoglobulin (? -LG) and bovine serum albumin (BSA) Dermatitis or allergic diseases.

상기 가수분해물은 분자량 3kDa 이하인 것만 선택적으로 추출한 가수분해물일 수 있다. The hydrolyzate may be a hydrolyzate selectively extracted with a molecular weight of 3 kDa or less.

상기 알레르기 질환은 아나필락시스 쇼크, 식품 알레르기, 알레르기성 비염, 화분증, 기관지천식, 약제 알레르기, 식물 알레르기, 두드러기, 습진 및 알레르기성 접촉성 피부염에서 선택되는 질환일 수 있다. The allergic disease may be a disease selected from anaphylactic shock, food allergy, allergic rhinitis, hay fever, bronchial asthma, drug allergy, plant allergies, urticaria, eczema and allergic contact dermatitis.

또한, 본 발명은 알칼라아제(alcalase)를 이용한 β-락토글로불린(β-lactoglobulin, β-LG) 및 소혈청알부민(Bovine Serum Albumin, BSA)에서 선택되는 1종 이상의 유청 단백질의 가수분해물을 함유하는 아토피 피부염 또는 알레르기 질환의 예방 또는 개선용 건강기능식품을 제공한다.In addition, the present invention relates to a method for the production of a hydrolyzate of at least one whey protein selected from β-lactoglobulin (β-LG) and bovine serum albumin (BSA) using an alcalase Which is effective for preventing or ameliorating atopic dermatitis or allergic diseases.

이하, 본 발명을 상세하게 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 알칼라아제를 이용한 유청 단백질의 가수분해물을 함유하는 아토피 피부염 또는 알레르기 질환의 예방 또는 치료용 약학 조성물을 제공한다. 상기 알칼라아제를 이용한 유청 단백질의 가수분해물을 포함하는 약학 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 상기 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 알칼라아제를 이용한 유청 단백질의 가수분해물을 함유하는 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다. The present invention provides a pharmaceutical composition for the prevention or treatment of atopic dermatitis or allergic diseases containing hydrolysates of whey protein using an alkalase. The pharmaceutical composition containing the hydrolyzate of whey proteins using the above-mentioned alkaline protease can be used in the form of oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, external preparations, May be formulated in the form of sterile injectable solutions. Examples of carriers, excipients and diluents that can be contained in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, and such solid preparations can be prepared by incorporating at least one excipient into the composition containing the hydrolyzate of the whey protein using the alkalase of the present invention, For example, it is prepared by mixing starch, calcium carbonate, sucrose or lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Examples of the liquid preparation for oral administration include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, simple diluents commonly used, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of suppository bases include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like.

본 발명의 약학 조성물의 투여량은 치료받을 대상의 연령, 성별, 체중과, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있으며, 일반적으로 투여량은 0.01㎎/㎏/일 내지 대략 2000㎎/㎏/일의 범위이다. 더 바람직한 투여량은 1㎎/㎏/일 내지 500㎎/㎏/일이다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. The dosage of the pharmaceutical composition of the present invention will depend on the age, sex, body weight of the subject to be treated, the particular disease or condition to be treated, the severity of the disease or condition, the route of administration and the judgment of the prescriber. Dosage determinations based on these factors are within the level of ordinary skill in the art and generally the dosage ranges from 0.01 mg / kg / day to approximately 2000 mg / kg / day. A more preferable dosage is 1 mg / kg / day to 500 mg / kg / day. The administration may be carried out once a day or divided into several times. The dose is not intended to limit the scope of the invention in any way.

본 발명의 약학 조성물은 쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내 주사에 의해 투여될 수 있다. 본 발명의 화합물은 독성 및 부작용이 거의 없으므로 예방 목적으로 장기간 복용시에도 안심하고 사용할 수 있는 약제이다. The pharmaceutical composition of the present invention can be administered to mammals such as rats, livestock, humans, and the like in various routes. All modes of administration may be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine dural or intracerebral injection. Since the compound of the present invention has little toxicity and side effects, it can be safely used even for long-term administration for preventive purposes.

또한, 본 발명은 알칼라아제를 이용한 유청 단백질의 가수분해물 및 식품학적으로 허용 가능한 식품보조 첨가제를 포함하는 아토피 피부염 또는 알레르기 질환의 예방 또는 개선용 건강기능식품을 제공한다. 상기 알칼라아제를 이용한 유청 단백질의 가수분해물은 본 발명의 건강기능식품에 0.001~100 중량%로 하여 첨가될 수 있다. 본 발명의 건강기능식품은 정제, 캡슐제, 환제 또는 액제 등의 형태를 포함하며, 본 발명의 추출물을 첨가할 수 있는 식품으로는, 예를 들어, 각종 식품류, 음료, 껌, 차, 비타민 복합제, 건강기능성식품류 등이 있다. The present invention also provides a health functional food for preventing or ameliorating atopic dermatitis or allergic diseases, which comprises a hydrolyzate of whey protein and a pharmaceutically acceptable food-aid additive using an alkalase. The hydrolyzate of the whey protein using the above-described alkalase may be added in an amount of 0.001 to 100% by weight to the health functional food of the present invention. The health functional food of the present invention includes forms such as tablets, capsules, pills, and liquids. Examples of the foods to which the extract of the present invention can be added include various foods, beverages, gums, tea, vitamins , And health functional foods.

본 발명은 알칼라아제를 이용한 유청 단백질의 가수분해물을 함유하는 아토피 피부염 또는 알레르기 질환의 예방 또는 치료용 조성물에 관한 것으로서, 상기 유청 단백질의 가수분해물 중 분자량 3kDa 이하인 것을 선택적으로 추출한 가수분해물이 특히 IL-6, TNF-α 및 IL-13의 발현 억제 효과가 우수하여, 아토피 피부염 또는 알레르기 질환의 치료용 조성물로 유용하게 이용될 수 있다.The present invention relates to a composition for preventing or treating atopic dermatitis or an allergic disease, which comprises a hydrolyzate of a whey protein using an alkaline protease, wherein a hydrolyzate obtained by selectively extracting a whey protein having a molecular weight of 3 kDa or less, -6, TNF-a and IL-13, and thus can be effectively used as a composition for the treatment of atopic dermatitis or allergic diseases.

도 1은 β-락토글로불린, BSA 및 이들을 실시예 1에서 알칼라아제로 가수분해한 것(총 가수분해물)의 HPLC 분석 결과이다.
도 2A 및 도 2B의 그림들은 β-락토글로불린, 이를 실시예 1에서 알칼라아제로 가수분해한 것(총 가수분해물), 상기 총가수분해물을 3kDa 초과 또는 이하인 것으로 분리정제한 것들의 아토피 피부염 또는 알레르기 질환 관련 사이토카인의 발현을 분석한 RT-PCR 결과이며, 도 2A 하단의 그래프는 이를 수치화한 결과이다.
도 3의 왼쪽 그림은 BSA, 이를 실시예 1에서 알칼라아제로 가수분해한 것(총 가수분해물), 상기 총 가수분해물을 3kDa 초과 또는 이하인 것으로 분리정제한 것들의 아토피 피부염 또는 알레르기 질환 관련 사이토카인의 발현을 분석한 RT-PCR 결과이며, 오른쪽의 그래프는 이를 수치화한 결과이다.
1 shows the results of HPLC analysis of? -Lactoglobulin, BSA, and those obtained by hydrolyzing (total hydrolyzate) with alcalase in Example 1.
2A and 2B show β-lactoglobulin, which is hydrolyzed by alkalase in Example 1 (total hydrolyzate), atopic dermatitis of those in which the total hydrolyzate was separated and purified to have a total hydrolyzate exceeding 3 kDa or less, or RT-PCR analysis of the expression of allergic disease-related cytokines, and the graph at the bottom of FIG.
3 shows BSA, its hydrolyzate (total hydrolyzate) in Example 1, and the total hydrolyzate of which the total hydrolyzate was separated or purified to have a total hydrolyzate of 3 kDa or less, or an allergic disease related cytokine , And the graph on the right is the result of quantification.

이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지고, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다. Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein but may be embodied in other forms. Rather, the intention is to provide an exhaustive, complete, and complete disclosure of the principles of the invention to those skilled in the art.

<실시예 1. 알칼라아제를 이용한 β-락토글로불린 또는 BSA의 가수분해물 제조> &Lt; Example 1: Preparation of hydrolysates of? -Lactoglobulin or BSA using alkalase>

0.5M NaOH을 사용하여 β-락토글로불린(시그마, L3908) 또는 BSA(시그마, A7906)을 증류수에 20㎎/㎖ 농도로 β-락토글로불린 용액 또는 BSA 용액을 제조하여 각각의 pH를 8.0으로 조정하였다. 알칼라아제(시그마, A30079)를 증류수에 1%(w/v)로 녹여 알칼라아제 용액 상태로 만들고, 상기 알칼라아제 용액과 상기 β-락토글로불린 용액 또는 BSA 용액(기질) 각각을 1:100의 부피비로 혼합하였다. 각 단백질 용액의 효소반응(가수분해)은 40℃에서 시간별로(5, 60, 120, 240분) 수행하였고, 효소반응을 마친 후에는 90℃에서 10분간 가열하여 효소활성을 실활시켰으며, 상등액을 β-락토글로불린 또는 BSA의 총 가수분해물로 취하였고 침전물은 버렸다. 한편, 상기 가수분해물의 일부를 분자량 3kDa 용 비바스핀 농축기 20(Vivaspin concentrator 20, GE Healthcare, Sweden)을 이용하여 3kDa 초과하는 것과 3kDa 이하인 것으로 선택적으로 분리추출하였다. 상기 β-락토글로불린 또는 BSA의 가수분해물들은 모두 동결건조하여 보관하였다.A beta -lactoglobulin solution (Sigma, L3908) or BSA (Sigma, A7906) was prepared in distilled water using 0.5 M NaOH at a concentration of 20 mg / ml and the pH of each solution was adjusted to 8.0 . The alcalase solution and the β-lactoglobulin solution or the BSA solution (substrate) were each dissolved in a 1: 1 (w / v) solution in distilled water to prepare an alkaline solution, 100 by volume. The enzymatic reaction (hydrolysis) of each protein solution was carried out at 40 ° C (5, 60, 120, 240 min) with time. After completion of the enzymatic reaction, the enzymatic activity was inactivated by heating at 90 ° C for 10 min. Was taken as the total hydrolyzate of? -Lactoglobulin or BSA and the precipitate discarded. On the other hand, a part of the hydrolyzate was selectively separated and extracted with a Vivaspin concentrator 20 (Vivaspin concentrator 20, GE Healthcare, Sweden) having a molecular weight of 3 kDa in excess of 3 kDa and 3 kDa or less. The hydrolysates of? -Lactoglobulin or BSA were all stored by lyophilization.

<실시예 2. HPLC를 이용한 유청 단백질의 알칼라아제의 가수분해물의 분석>&Lt; Example 2: Analysis of hydrolyzate of alkalase of whey protein using HPLC >

하기 조건을 이용하여 β-락토글로불린, BSA 및 실시예 1에서 얻은 이들의 알칼라아제 총 가수분해물(180분 반응)의 HPLC를 수행하였다. 알칼라아제에 의한 가수분해물의 HPLC 결과는 도 1에 나타내었다. HPLC 기기는 RP-HPLC 시스템(Waters 2487 Dural Dector, 600 Controller, 2410 Refractive index Detector, Milford, MA, USA)으로 분석하였다. Lactoglobulin, BSA and the total hydrolyzate of the alkalase obtained in Example 1 (180-minute reaction) were subjected to HPLC using the following conditions. The HPLC results of the hydrolyzate by alkalase are shown in Fig. HPLC instruments were analyzed by RP-HPLC system (Waters 2487 Dural Dector, 600 Controller, 2410 Refractive Index Detector, Milford, Mass., USA).

Column : protein C18 (4.6×250㎜, Vydac, Hesperia, CA. U.S.A)Column: protein C18 (4.6 x 250 mm, Vydac, Hesperia, CA. U.S.A)

Flow rate : 1㎖/minFlow rate: 1 ml / min

Elution solution : solution A - 0.1% of TFA in distilled water Elution solution: solution A - 0.1% of TFA in distilled water

solution B - 0.1% of TFA in acetonitrilesolution B - 0.1% of TFA in acetonitrile

Elution condition : linear gradientElution condition: linear gradient

Elution time : 40minElution time: 40min

Infection volume : 20㎕ of sample, concentrated 5 times in freezing drying machineInfection volume: 20 μl of sample, concentrated 5 times in freezing drying machine

Absorbance of the elute column : 214nm Absorbance of the elute column: 214 nm

도 1을 참고하면, β-락토글로불린 및 BSA를 180분 동안 가수분해시킨 가수분해물은 대조구에 비해 여러 종류의 피크(peak)가 나타남으로써 분자량이 작은 펩티드가 많이 생성되었음을 알 수 있다. Referring to FIG. 1, the hydrolyzate obtained by hydrolyzing? -Lactoglobulin and BSA for 180 minutes exhibited various peaks compared to the control, indicating that many peptides having a small molecular weight were produced.

<실시예 3. 유청 단백질 가수분해물의 알레르기 또는 아토피 관련 사이토카인의 억제 효과 확인>Example 3. Confirmation of inhibitory effect of allergy or atopy-related cytokine of whey protein hydrolyzate [

유청 단백질이 알러지와 관련된 싸이토카인의 분비에 미치는 영향을 비만세포인 RBL-2H3 세포와 HMC-1(Human mast cell-1) 세포를 이용하여 확인하였다. HMC-1은 12웰(well) 세포배양접시에 4×105/웰(well)로 조정하여 10% FBS 함유 IMDM(Gibco, USA)배지로 5% CO2, 37℃ 세포배양기에서 배양하였다. RBL 2H3 세포는 12웰 세포배양접시에 4×105/웰로 조정하여 10% FBS 함유 MEM(Gibco, USA)배지로 5% CO2, 37℃ 세포배양기에서 배양하였다. The effect of whey protein on the secretion of allograft-related cytokines was confirmed using mast cells RBL-2H3 cells and HMC-1 (human mast cell-1) cells. HMC-1 was cultured in a 12% cell culture dish at 4 × 10 5 / well in a 5% CO 2 , 37 ° C cell culture medium with IMDM (Gibco, USA) containing 10% FBS. RBL 2H3 cells were cultured in a 12% cell culture dish at 4 × 10 5 / well and cultured in a 5% CO 2 , 37 ° C cell culture medium with MEM containing 10% FBS (Gibco, USA).

각 세포를 배양 8시간 후에 각 유청 단백질 및 이의 가수분해물(5~50㎍/㎖)을 시료로서 처리하여 30분간 반응시키고 PMA(Phorbol 12-myristate 13-acetate)를 처리하고 6시간 반응시킨 후 세포를 취하고 RNA 분리키트(Invitregon, USA)를 이용하여 총 RNA를 분리하였다. 이 후, 상기 총 RNA를 Promega사(USA)의 cDNA 합성 키트(oligo dT, dNTP, M-MLV RT, RNAs inhibitor)를 이용하여 RT-PCR을 수행하여 TNF-α(tumor necrosis factor-α), IL-6(interleukin-6) 및 IL-13(interleukin-13)의 발현을 조사하여 도 2 및 3에 나타내었다. RT-PCR 조건은 94℃에서 5분(1 cycle), 94℃에서 30초; 58℃에서 30초; 72℃에서 30초(22~23 cycle 반복), 72℃에서 7분(1 cycle)로 하였고 사용한 PCR용 프라이머(primer)는 하기 표 1에 나타난 것을 이용하였다. Each cell was treated with each whey protein and its hydrolyzate (5 to 50 μg / ml) as a sample for 8 hours, incubated for 30 minutes, treated with Phorbol 12-myristate 13-acetate (PMA) And total RNA was isolated using an RNA isolation kit (Invitrogen, USA). The total RNA was then subjected to RT-PCR using a cDNA synthesis kit (oligo dT, dNTP, M-MLV RT, RNAs inhibitor) of Promega (USA) to determine the TNF-α (tumor necrosis factor- The expression of IL-6 (interleukin-6) and IL-13 (interleukin-13) was examined and shown in FIGS. RT-PCR conditions were 94 ° C for 5 minutes (1 cycle), 94 ° C for 30 seconds; 30 seconds at 58 占 폚; 72 ° C for 30 seconds (22 to 23 cycles repeated) and 72 ° C for 7 minutes (1 cycle). The PCR primers used were those shown in Table 1 below.

타겟
유전자
target
gene
Size (bp) Size (bp) Forward Forward Reverse Reverse
GAPDHGAPDH 346346 CCATCACCATCTTCCAGGAGCCATCACCATCTTCCAGGAG ACAGTCTTCTGGGTGGCAGTACAGTCTTCTGGGTGGCAGT TNF-α TNF-a 354 354 TTCTGTCTACTGAACTTCGGGGTGATCGGTCC TTCTGTCTACTGAACTTCGGGGTGATCGGTCC GTATGAGATAGCAAATCGGCTGACGGTGTGGG GTATGAGATAGCAAATCGGCTGACGGTGTGGG IL-6 IL-6 139 139 TCCAGTTGCCTTCTTGGGAC TCCAGTTGCCTTCTTGGGAC GTGTAATTAAGCCTCCGACTTG GTGTAATTAAGCCTCCGACTTG IL-13 IL-13 482482 ACGGTCATTGCTCTCACTTGCCACGGTCATTGCTCTCACTTGCC CTTCCCGCCTACCCAAGACATTCTTCCCGCCTACCCAAGACATT

도 2A의 상단 그림은 HMC-1 세포에 β-락토글로불린을 5㎍/㎖ 처리하였을 경우 발현되는 IL-6의 발현량을 확인한 것이며 하단 그림은 이를 수치화하여 나타낸 것이다. 도 2B는 RBL-2H3 세포에 β-락토글로불린을 50㎍/㎖ 처리하였을 경우 발현되는 TNF-α 및 IL-13의 발현량을 확인한 것이다. The upper part of FIG. 2A shows the expression amount of IL-6 expressed when HGF-1 cells were treated with 5 μg / ml of β-lactoglobulin, and the lower figure shows the result in numerical value. FIG. 2B shows the expression levels of TNF-α and IL-13 expressed when RBL-2H3 cells were treated with 50 μg / ml of β-lactoglobulin.

상기 도 2의 결과를 참고하면, β-락토글로불린의 알칼라아제 가수분해물 중 3kDa 이하인 가수분해물이 IL-6, TNF-α 및 IL-13의 발현 억제 효과가 우수한 것으로 확인된다. 2, hydrolysates of 3 kDa or less in the hydrolysates of β-lactoglobulin hydrolysates of β-lactoglobulin have excellent inhibitory effects on expression of IL-6, TNF-α and IL-13.

도 3의 왼쪽 그림은 HMC-1 세포에 BSA를 5㎍ 처리하였을 경우 발현되는 TNF-α의 발현량을 확인한 것으로서, BSA의 알칼라아제 가수분해물 중 3kDa 이하인 가수분해물이 TNF-α의 발현 억제 효과가 우수함을 알 수 있다. 도 3의 오른쪽 그림은 이 결과를 수치화하여 나타낸 것이다. 3 shows the expression level of TNF-α when 5 μg of BSA was treated in HMC-1 cells. The hydrolysates of 3 kDa or less in the alkaline hydrolysates of BSA inhibited the expression of TNF-α Is excellent. The right figure in Figure 3 shows this result numerically.

따라서, 상기 결과들을 통해, β-락토글로불린 또는 BSA의 알칼라아제 가수분해물 중 3kDa 이하인 것이 항아토피 피부염 또는 항알레르기 질환의 조성물로서 이용하기에 적합한 것으로 판단된다. Therefore, it is believed that the above-mentioned results indicate that the 3-kDa or less of the alkalase hydrolyzate of? -Lactoglobulin or BSA is suitable for use as a composition of an anti-atopic dermatitis or antiallergic disease.

<실시예 4. 독성실험> <Example 4: Toxicity test>

실시예 4-1. 급성독성Example 4-1. Acute toxicity

본 발명의 β-락토글로불린 또는 BSA의 가수분해물 중 3kDa 이하인 가수분해물을 단기간에 과량을 섭취하였을 때 급성적(24시간 이내)으로 동물체내에 미치는 독성을 조사하고, 치사율을 결정하기 위하여 본 실험을 수행하였다. 일반적인 마우스인 ICR 마우스 계통 30마리를 대조군과 실험군에 각각 10마리씩 배정하였다. 대조군에는 PEG-400:tween-80:에탄올(8:1:1, v:v:v) 만을 투여하고, 실험군은 본 발명의 β-락토글로불린 또는 BSA의 가수분해물 중 3kDa 이하인 가수분해물을 상기 PEG-400:tween-80:에탄올(8:1:1, v:v:v)에 녹여 각각 경구투여하였다. 투여 24시간 후에 각각의 치사율을 조사한 결과, 대조군과 2g/㎏/day 농도의 본 발명의 β-락토글로불린 또는 BSA의 가수분해물 중 3kDa 이하인 가수분해물을 투여한 실험군에서 마우스가 모두 생존하는 것으로 확인되었다.In order to investigate the toxicity of the hydrolyzate of? -Lactoglobulin or BSA of the present invention to an animal body in an acute (within 24 hours) when an excessive amount of hydrolyzate of 3 kDa or less in a short period of time was ingested and to determine the mortality rate, Respectively. Twenty mice of the general mouse ICR mouse line were assigned to each of the control and experimental groups. In the control group, only the PEG-400: tween-80: ethanol (8: 1: 1, v: v: v) was administered and in the experimental group, the hydrolyzate of? -Lactoglobulin or BSA, -400: tween-80: ethanol (8: 1: 1, v: v: v). After 24 hours of administration, the mortality rate was examined, and it was found that mice were all survived in the control group and the hydrolyzate of β-lactoglobulin or BSA of the present invention having a concentration of 2 g / ㎏ / day of less than 3 kDa .

실시예 4-2. 실험군 및 대조군의 장기 및 조직 독성 실험Example 4-2. Organ organs toxicity test in experimental group and control group

장기 독성 실험은 본 발명의 β-락토글로불린 또는 BSA의 가수분해물 중 3kDa 이하인 가수분해물을 각 농도로 8주 동안 C57BL/6J 마우스(각 군당 10마리)에 투여하여 실험하였다. 동물의 각 장기(조직)에 미치는 영향을 조사하기 위하여 본 발명의 β-락토글로불린 또는 BSA의 가수분해물 중 3kDa 이하인 가수분해물을 투여한 실험군과 PEG-400:tween-80:에탄올(8:1:1, v:v:v)만을 투여한 대조군의 동물들로부터 8주 후 혈액을 채취하여 GPT(glutamate-pyruvate transferase) 및 BUN(blood urea nitrogen)의 혈액 내 농도를 Select E(Vital Scientific NV, Netherland) 기기를 이용하여 측정하였다. 그 결과, 간독성과 관계있는 것으로 알려진 GPT와 신장독성과 관계있는 것으로 알려진 BUN의 경우, 대조군과 비교하여 실험군은 별다른 차이를 보이지 않았다. 또한, 각 동물로부터 간과 신장을 절취하여 통상적인 조직절편 제작과정을 거쳐 광학현미경으로 조직학적 관찰을 시행하였으며 모든 조직에서 특이한 이상이 관찰되지 않았다. In the long-term toxicity test, hydrolysates of β-lactoglobulin or BSA hydrolysates of 3 kDa or less were administered to C57BL / 6J mice (10 per group) for 8 weeks at each concentration. (PEG-400: tween-80: ethanol (8: 1: 1)) was added to the hydrolyzate of β-lactoglobulin or BSA of the present invention, Blood was collected from the animals of the control group administered only with v: v: v, v: v: v) at 8 weeks and blood concentrations of glutamate-pyruvate transferase (GPT) and blood urea nitrogen (BUN) ) Instrument. As a result, GPT, which is known to be related to hepatotoxicity, and BUN, which is known to be related to renal toxicity, showed no significant difference compared to the control group. In addition, liver and kidney were cut from each animal, followed by a general tissue section preparation, histological observation with an optical microscope, and no abnormalities were observed in all tissues.

<제제예 1. 약학적 제제>&Lt; Formulation Example 1 >

제제예 1-1. 정제의 제조Formulation Example 1-1. Manufacture of tablets

본 발명의 실시예 1의 β-락토글로불린 또는 BSA의 3kDa 이하의 가수분해물 200g을 락토오스 175.9g, 감자전분 180g 및 콜로이드성 규산 32g과 혼합하였다. 이 혼합물에 10% 젤라틴 용액을 첨가시킨 후, 분쇄해서 14 메쉬체를 통과시켰다. 이것을 건조시키고 여기에 감자전분 160g, 활석 50g 및 스테아린산 마그네슘 5g을 첨가해서 얻은 혼합물을 정제로 만들었다. 200 g of the hydrolyzate of 3 kDa or less of? -Lactoglobulin or BSA of Example 1 of the present invention was mixed with 175.9 g of lactose, 180 g of potato starch and 32 g of colloidal silicic acid. To this mixture was added a 10% gelatin solution, which was pulverized and passed through a 14-mesh sieve. This was dried, and a mixture obtained by adding 160 g of potato starch, 50 g of talc and 5 g of magnesium stearate was made into tablets.

제제예 1-2. 주사액제의 제조Formulation Example 1-2. Injection preparation

본 발명의 실시예 1의 β-락토글로불린 또는 BSA의 3kDa 이하의 가수분해물 1g, 염화나트륨 0.6g 및 아스코르브산 0.1g을 증류수에 용해시켜서 100㎖를 만들었다. 이 용액을 병에 넣고 20℃에서 30분간 가열하여 멸균시켰다.1 g of 3-kDa or less hydrolyzate of? -Lactoglobulin or BSA of Example 1 of the present invention, 0.6 g of sodium chloride and 0.1 g of ascorbic acid were dissolved in distilled water to make 100 ml. This solution was placed in a bottle and sterilized by heating at 20 DEG C for 30 minutes.

<제제예 2. 식품 제조><Formulation Example 2: Food Preparation>

제제예 2-1. 조리용 양념의 제조Formulation Example 2-1. Manufacture of cooking seasonings

본 발명의 실시예 1의 β-락토글로불린 또는 BSA의 3kDa 이하의 가수분해물을 조리용 양념에 1 중량%로 첨가하여 건강 증진용 조리용 양념을 제조하였다.Lactoglobulin of Example 1 of the present invention or a hydrolyzate of 3 kDa or less of BSA was added to the cooking seasoning at 1 wt% to prepare a cooking sauce for health promotion.

제제예 2-2. 밀가루 식품의 제조Formulation Example 2-2. Manufacture of flour food products

본 발명의 실시예 1의 β-락토글로불린 또는 BSA의 3kDa 이하의 가수분해물을 밀가루에 0.1 중량%로 첨가하고, 이 혼합물을 이용하여 빵, 케이크, 쿠키, 크래커 및 면류를 제조하여 건강 증진용 식품을 제조하였다.Lacto-globulin of Example 1 of the present invention or a hydrolyzate of BSA of 3 kDa or less was added to wheat flour at 0.1 wt%, and bread, cake, cookies, crackers and noodles were prepared using this mixture, .

제제예 2-3. 스프 및 육즙(gravies)의 제조Preparation Example 2-3. Manufacture of soups and gravies

본 발명의 실시예 1의 β-락토글로불린 또는 BSA의 3kDa 이하의 가수분해물을 스프 및 육즙에 0.1 중량%로 첨가하여 건강 증진용 수프 및 육즙을 제조하였다.Lactoglobulin of Example 1 of the present invention or a hydrolyzate of 3 kDa or less of BSA was added to soup and juice at 0.1 wt% to prepare health promotion soup and juice.

제제예 2-4. 유제품(dairy products)의 제조Formulation Example 2-4. Manufacture of dairy products

본 발명의 실시예 1의 β-락토글로불린 또는 BSA의 3kDa 이하의 가수분해물을 우유에 0.1 중량%로 첨가하고, 상기 우유를 이용하여 버터 및 아이스크림과 같은 다양한 유제품을 제조하였다.Lactoglobulin of Example 1 of the present invention or a hydrolyzate of 3 kDa or less of BSA was added to milk in an amount of 0.1% by weight and various dairy products such as butter and ice cream were prepared using the milk.

제제예 2-5. 야채주스 제조Formulation Example 2-5. Vegetable juice manufacturing

본 발명의 실시예 1의 β-락토글로불린 또는 BSA의 3kDa 이하의 가수분해물 0.5g을 토마토주스 또는 당근주스 1,000㎖에 가하여 건강 증진용 야채주스를 제조하였다.0.5 g of the 3-kDa or less hydrolyzate of? -Lactoglobulin or BSA of Example 1 of the present invention was added to 1,000 ml of tomato juice or carrot juice to prepare vegetable juice for health promotion.

제제예 2-6. 과일주스 제조Formulation Example 2-6. Manufacture of fruit juice

본 발명의 실시예 1의 β-락토글로불린 또는 BSA의 3kDa 이하의 가수분해물 0.1g을 사과주스 또는 포도주스 1,000㎖에 가하여 건강 증진용 과일주스를 제조하였다.
0.1 g of the hydrolyzate of 3 kDa or less of? -Lactoglobulin or BSA of Example 1 of the present invention was added to 1,000 ml of apple juice or grape juice to prepare fruit juice for health promotion.

Claims (6)

β-락토글로불린(β-lactoglobulin, β-LG) 및 소혈청알부민(Bovine Serum Albumin, BSA) 중 1종 이상의 유청 단백질에 알칼라아제(alcalase)를 처리하여 분자량 3kDa 이하인 것만 선택적으로 추출한 가수분해물을 함유하는 것을 특징으로 하는 아토피 피부염 또는 알레르기 질환의 예방 또는 치료용 조성물.One or more whey proteins of β-lactoglobulin (β-LG) and bovine serum albumin (BSA) are treated with an alcalase to selectively hydrolyze hydrolyzate having a molecular weight of 3 kDa or less Or a pharmaceutically acceptable salt thereof, for the prophylaxis or treatment of atopic dermatitis or allergic diseases. 삭제delete 제1항에 있어서,
상기 알레르기 질환은 아나필락시스 쇼크, 식품 알레르기, 알레르기성 비염, 화분증, 기관지천식, 약제 알레르기, 식물 알레르기, 두드러기, 습진 및 알레르기성 접촉성 피부염에서 선택되는 질환인 것을 특징으로 하는 아토피 피부염 또는 알레르기 질환의 예방 또는 치료용 조성물.
The method according to claim 1,
Wherein the allergic disease is selected from anaphylactic shock, food allergy, allergic rhinitis, hay fever, bronchial asthma, drug allergy, plant allergies, urticaria, eczema and allergic contact dermatitis. Or &lt; / RTI &gt;
β-락토글로불린(β-lactoglobulin, β-LG) 및 소혈청알부민(Bovine Serum Albumin, BSA) 중 1종 이상의 유청 단백질에 알칼라아제(alcalase)를 처리하여 분자량 3kDa 이하인 것만 선택적으로 추출한 가수분해물을 함유하는 것을 특징으로 하는 아토피 피부염 또는 알레르기 질환의 예방 또는 개선용 건강기능식품.One or more whey proteins of β-lactoglobulin (β-LG) and bovine serum albumin (BSA) are treated with an alcalase to selectively hydrolyze hydrolyzate having a molecular weight of 3 kDa or less Or a pharmaceutically acceptable salt thereof, for the prevention or amelioration of atopic dermatitis or allergic diseases. 삭제delete 제4항에 있어서,
상기 알레르기 질환은 아나필락시스 쇼크, 식품 알레르기, 알레르기성 비염, 화분증, 기관지천식, 약제 알레르기, 식물 알레르기, 두드러기, 습진 및 알레르기성 접촉성 피부염에서 선택되는 질환인 것을 특징으로 하는 아토피 피부염 또는 알레르기 질환의 예방 또는 개선용 건강기능식품.
5. The method of claim 4,
Wherein the allergic disease is selected from anaphylactic shock, food allergy, allergic rhinitis, hay fever, bronchial asthma, drug allergy, plant allergies, urticaria, eczema and allergic contact dermatitis. Or health functional food for improvement.
KR1020130137694A 2013-11-13 2013-11-13 Composition comprising hydrolysate of whey protein using alcalase for preventing or treating atopic dermatitis or allergic diseases KR101565299B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130137694A KR101565299B1 (en) 2013-11-13 2013-11-13 Composition comprising hydrolysate of whey protein using alcalase for preventing or treating atopic dermatitis or allergic diseases

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130137694A KR101565299B1 (en) 2013-11-13 2013-11-13 Composition comprising hydrolysate of whey protein using alcalase for preventing or treating atopic dermatitis or allergic diseases

Publications (2)

Publication Number Publication Date
KR20150055666A KR20150055666A (en) 2015-05-22
KR101565299B1 true KR101565299B1 (en) 2015-11-04

Family

ID=53391163

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130137694A KR101565299B1 (en) 2013-11-13 2013-11-13 Composition comprising hydrolysate of whey protein using alcalase for preventing or treating atopic dermatitis or allergic diseases

Country Status (1)

Country Link
KR (1) KR101565299B1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113226465A (en) * 2018-12-19 2021-08-06 雀巢产品有限公司 Composition for preventing or reducing transepidermal water loss and improving skin barrier function
KR102622616B1 (en) * 2022-09-20 2024-01-10 충남대학교산학협력단 Anti-oxidative, anti-inflammatory or anti-aging Composition comprising bioactive peptide from whey protein hydrolysates

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
[논문] CNU JOURNAL OF AGRICULTURAL SCIENCE*
Nutr Rev. 2010 Apr;68(4):232-45*

Also Published As

Publication number Publication date
KR20150055666A (en) 2015-05-22

Similar Documents

Publication Publication Date Title
JP6022738B2 (en) Composition for enhancing memory learning function and / or cognitive function
TWI739738B (en) Water-soluble mussel extract
KR101705548B1 (en) Composition for enhancing immune response comprising extract of Apios americana Medikus or fermented extract of the same
KR20150145440A (en) a composition comprising an extract of fermented Sword Bean as an active ingredient for preventing or treating inflammation, or allergy
JP4986413B2 (en) Composition for improving blood circulation
KR101565299B1 (en) Composition comprising hydrolysate of whey protein using alcalase for preventing or treating atopic dermatitis or allergic diseases
KR20220097277A (en) Enzyme hydrolysate of antler for immunopotentiation with enhancing activity of immune cell comprising NK cell
KR101859552B1 (en) Composition for immune enhancement comprising fermented milk with Curcuma longa L. powder
JP2016222646A (en) Composition comprising peptide for suppressing inflammation
KR101626291B1 (en) Composition comprising hydrolysate of whey protein using alkaline protease for preventing or treating inflammatory diseases
KR20230110470A (en) A composition for the prevention or treatment of hypertension containing edible insects hydrolysates and fractions thereof
KR101408101B1 (en) Food for improving liver function comprising black rice culture of Lentinus edodes mycelia adding Hovenia dulcis extract as effective component
KR101464592B1 (en) Composition comprising hydrolysate of whey protein prepared by using alcalase for preventing or treating inflammatory diseases
KR101843280B1 (en) Food composition for immune enhancement comprising enzymatic hydrolysate of tuna cooking drip as active ingredient
KR101767837B1 (en) Method for producing mixture extract of sea cucumber and sea mustard with enhanced immunity activity
CN1972600A (en) Cysteine protease from ginger (zingiber) as a food improver and anti-inflammatory
KR20180046021A (en) Composition including neoagarooligosaccharide for preventing, improving or treating inflammatory disease
KR101217713B1 (en) Methods for fermentative production of fibrinolytic enzyme from Auricularia auricula-judae and uses thereof
KR20120049047A (en) Antiinflammatory composition comprising enzymatic hydrolysates of crassostrea gigas
KR101730073B1 (en) A composition for prevention and treatment of infectious diseases comprising Allium hookeri as an active ingredient
KR101856448B1 (en) Composition comprising silkworm having silk protein for preventing or treating nonalcoholic hepatitis
TWI466896B (en) Peptides isolated from a hydrolysate of tuna cooking juice and uses of said hydrolysate and peptides
KR102444748B1 (en) A composition for improving intestinal health comprising cockles powder or cockles liquid
KR102348924B1 (en) Composition for preventing or treating inflammasome mediated disease comprising fructose-alginine
KR20100096442A (en) Methods for fermentative production of fibrinolytic enzyme from auricularia auricula-judae and uses thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20180921

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20190926

Year of fee payment: 5