KR101537806B1 - Composition for controlling pathogen or improving resistance to pathogen in plant comprising Lacquer tree extract as effective component - Google Patents

Abstract

The present invention relates to a plant pathogen control composition and a composition for enhancing tolerance, which contain Rhus verniciflua extract as an active ingredient, and more particularly to a composition for controlling plant pathogens and enhancing tolerance, which contains Rhus verniciflua extract as an active ingredient, The present invention relates to a method for controlling plant pathogens and enhancing tolerance of plant pathogens. The present invention relates to an extract of Rhus verniciflua, which is a toxic substance that induces allergy (urushiol urushiol can be removed and safely provided to the consumer as well as promoting the early growth of the plant and strongly expressing the genes related to plant pathogenic defense which are a problem in cultivation and exhibit resistance to virus disease substantially The inventive Rhus verniciflua extract does not It can be useful for cultivated crops as a useful pesticide for controlling plant pathogens or promoting tolerance.

Description

TECHNICAL FIELD The present invention relates to a composition for controlling plant pathogens and enhancing tolerance, which contains Rhus verniciflua extract as an active ingredient.

The present invention relates to a plant pathogen control composition and a composition for enhancing tolerance, which contain Rhus verniciflua extract as an active ingredient, and more particularly to a composition for controlling plant pathogens and enhancing tolerance, which contains Rhus verniciflua extract as an active ingredient, A plant pathogen control or tolerance enhancing method comprising the step of inhibiting plant pathogens and an organism pesticide for enhancing tolerance, which comprises Rhus verniciflua extract as an active ingredient.

Rhus Verniciflua Stokes) is known as the origin of the Tibetan and Himalayan regions of the Central Asian highlands, and about 70 genera and 600 species are distributed throughout the world. In Korea, there are many species such as common lacquer tree, lacquer tree, liana, lacquer tree, Six species of lacquer trees are growing. It is generally known that the sap of lacquer is composed of urushiol (59.5%), gum (7.1%), compound containing nitrogen (2.6%) and water (30.8%). Phosphorus is a kind of plant physiological phase secretion. As soon as it is collected, it is an off-white oil-like liquid. It has sweet taste and sweet taste. When it comes in contact with air, it turns brown.

Lacquer is a mysterious medicinal substance which has toxicity and weakness at the same time. In the Orient, lacquer has been used for edible and medicinal purposes since ancient times. It has been introduced as a medicament to treat gastrointestinal diseases, constipation and hemorrhage in Dong-bo-gyung.

Recent studies have shown that urushiol, a major component of sap of lacquer tree and causing allergies, has strong anticancer, antioxidant and antimicrobial activities. In addition, the extracts of rhus verniciflua and flavonoids extracted from the woody part showed an inhibitory action on angiogenesis, thus inhibiting the proliferation and metastasis of cancer cells and inducing the differentiation of cancer cells into normal cells. Antioxidant, hangover and gastritis inhibition It also proved to be effective. The chemical structure of urushiol is a catechol compound having two hydroxyl groups on the benzene ring and having a side chain R group, which is a fatty acid having a carbon number of 15, and is bound to the side chain by a number of double bonds Phenol derivatives are present. However, as described above, poisonous poison is very poisonous to many kinds of diseases of the human body, which can cause allergic dermatitis and respiratory failure.

In crop cultivation, many plant pathogens, insect pests and weeds inhibit the growth of crops. If these crops are not controlled, a considerable amount of yield reduction will usually occur, depending on the crop. Many chemical pesticides have been developed and used to control the above harmful organisms. However, not only the toxicity of the chemical pesticide itself, but also the toxicity of the pesticide due to abuse in plant diseases, pest and weed control, environmental pollution such as groundwater and soil, Ecosystem disturbance and increasing resistance to harmful organisms. Recently, eco-friendly agriculture has attracted attention along with organic agriculture. In particular, bio-pesticides have been developed as eco-friendly pesticides using environmentally friendly biomaterials away from the above chemical pesticides. Biological pesticide is an environment friendly crop protection agent that is safe for man-made and ecosystem, unlike synthetic pesticides. It can produce agricultural products with high added value. It effectively controls pests that are difficult to control with synthetic pesticides, It is possible to solve the problem caused by abuse of the apparatus.

On the other hand, Korean Patent No. 0525681 discloses a composition for extracting Rhus verniciflua and Salmonella suppressing Rhus verniciflua inhibiting broiler growth, a feed containing the Rhus verniciflua extract composition, and a broiler feeding method. However, the Rhus verniciflua extract of the present invention can be used as an active ingredient , There is no description about a composition for controlling plant pathogens and for enhancing tolerance.

The present invention has been made in view of the above-mentioned needs, and it has been confirmed in the present invention that urushiol, which is a poisonous substance, is removed from Rhus verniciflua extract, and thus no allergic rhubarb is induced even when drinking for a long period of time. As a result of comparing the pumpkin sprayed with the rhus verniciflua extract of the present invention and the unpainted pumpkin, it was found that the early growth of the pumpkin treated with the Rhus verniciflua extract was promoted and not only the gene related to the defense against the plant pathogenic bacteria was significantly increased, Cucumber mosaic virus and watermelon mosaic virus. Accordingly, it is an object of the present invention to provide a Rhus verniciflua extract which is not only safe for a user but also promotes a protective effect against pathogens of plants, and can be usefully used for the production of plants with enhanced immune response and tolerance.

In order to solve the above problems, the present invention provides a plant pathogen control composition and a composition for enhancing tolerance, comprising Rhus verniciflua extract as an active ingredient.

The present invention also provides a method of controlling a pathogen or enhancing tolerance of a plant, comprising the step of treating the composition with a plant.

The present invention also provides a pesticide for controlling plant pathogens and enhancing tolerance, which contains Rhus verniciflua extract as an active ingredient.

The Rhus verniciflua extract of the present invention not only protects consumers from urushiol, which is an allergen-inducing toxic substance, but also promotes early growth of the plants and protects against plant pathogenic bacteria And exhibit substantially resistance to viral diseases. Therefore, the Rhus verniciflua extract of the present invention can be useful as a plant pathogen control agent or a biocidal pesticide for resistance enhancement, which is safe for the user and useful for growing crops.

FIG. 1 is a graph showing the results of HPLC qualitative analysis for confirming the presence or absence of urushiol in the extract of Rhus verniciflua according to the present invention. FIG. (A): Room temperature extract, (B): Hot high-pressure hot-water extract, (C): Hot-water extract that releases steam generated at high temperature and high pressure.
FIG. 2 is a graph showing the results of measuring the lengths of the plant lengths of pumpkin and non-sprayed pumpkin sprayed with the Rhus verniciflua extract of the present invention. C: Pumpkin not sprayed with the rush extract, S: Pumpkin sprayed with the rush extract.
Fig. 3 is a photoperiod of a non-sprayed pumpkin sprayed with a mosaic virus symptomatic vampire extract showing no visible mosaic virus. A, B, C: Leaves and fruit of pumpkin sprayed with extracts of rushes, D, E, F: Leaves and fruit of pumpkin not sprayed with extracts of rushes.
FIG. 4 is a graph showing the result of RT-PCR for diagnosis of an onset virus. FIG. C: Pumpkin not sprayed with the rush extract, S: Pumpkin sprayed with the rush extract.
FIG. 5 is a graph showing the results of RT-PCR to evaluate the effect of the spraying of the extract of the present invention on the expression of a plant pathogen-related gene. C: Pumpkin not sprayed with the rush extract, S: Pumpkin sprayed with the rush extract.

In order to achieve the object of the present invention, the present invention provides a plant pathogen control composition and a composition for enhancing tolerance, which contain Rhus verniciflua extract as an active ingredient.

In the composition according to one embodiment, the lacquer is a lacquer tree (Rhus verniciflua), dog sumac (R. trichocarpa), geomyang sumac (R. succedanea), acid geomyang sumac (R. sylvertris) or sumac (R. javanica ), Preferably Rhus ( Rhus verniciflua . < / RTI > The lacquer tree may be, but not limited to, lacquer tree bark.

In the composition according to an embodiment of the present invention, the Rhus verniciflua extract may be extracted with high-pressure hot water from Rhus verniciflua. Preferably, Rhus verniciflua is extracted at a pressure of 0.5 to 1.5 MPa and a temperature of 100 to 120 ° C for 4 to 8 hours More preferably extracting the lacquer at a pressure of 0.5 to 1.5 MPa and a temperature of 105 to 115 ° C for 5 to 7 hours and most preferably extracting the lacquer tree at a pressure of 1 MPa at a temperature of 111 ° C for 6 hours But is not limited thereto.

In the composition according to one embodiment of the present invention, the Rhus verniciflua extract is subjected to high-pressure hot water extraction, and can be produced by releasing steam generated after hot water extraction. More specifically,

(a) collected Rhus ( Rhus verniciflua bark by hot air drying at 50 to 80 ° C for 2 to 5 days;

(b) adding water to the hot-air dried luccus bark of step (a) and subjecting it to hot water extraction at a pressure of 0.5 to 1.5 MPa and a temperature of 100 to 120 ° C for 4 to 8 hours; And

(c) discharging the steam generated after the hot water extraction in the step (b), but the present invention is not limited thereto.

The plant pathogenic bacterium according to an embodiment of the present invention may be a plant virus, preferably, it may be a virus and a virus, more preferably a Watermelon Mosaic Virus or a Cucumber Mosaic Virus But is not limited thereto.

The plant may be a dicotyledonous plant and is preferably selected from the group consisting of pumpkin, tomato, cucumber, tobacco, Arabidopsis, potato, eggplant, red pepper, burdock, cilantro, lettuce, bellflower, spinach, modern sweet potato, celery, , And can be a dicotyledon such as parsley, cabbage, cabbage, obtuse, watermelon, melon, pea, strawberry, soybean, mung bean, kidney bean, pea and the like, and is most preferably pumpkin.

The present invention also provides a method of controlling a pathogen or enhancing tolerance of a plant, comprising the step of treating the composition with a plant. The plant pathogen control or tolerance enhancing method can be carried out by spraying the plant with the composition containing the Rhus verniciflua extract, or by dipping or treating the plants. In the case of immersing the composition, the composition can be poured into the soil around the plant, or the plant or seed can be immersed in the composition, and in the case of the method of doming, the composition can be injected by piercing the soil or the tree around the plant .

In a method according to an embodiment of the present invention, the plant pathogenic bacterium may be a plant virus, preferably it may be a foil and a virus, more preferably a Watermelon Mosaic Virus or a Cucumber Mosaic Virus Virus), but is not limited thereto. The plant may be a dicotyledonous plant and is preferably selected from the group consisting of pumpkin, tomato, cucumber, tobacco, Arabidopsis, potato, eggplant, red pepper, burdock, cilantro, lettuce, bellflower, spinach, modern sweet potato, celery, , And can be a dicotyledon such as parsley, cabbage, cabbage, obtuse, watermelon, melon, pea, strawberry, soybean, mung bean, kidney bean, pea and the like, and is most preferably pumpkin.

The present invention also provides a pesticide for controlling plant pathogens and enhancing tolerance, which contains Rhus verniciflua extract as an active ingredient.

The biocidal pesticide according to the present invention may be prepared in the form of a liquid pesticide, and may be added in the form of a powdered powder, or may be granulated by formulating it into a powder. However, the formulation is not particularly limited. In other words, it can be formulated as a biological pesticide to overcome this in environmentally friendly organic farming with limited supply of chemical pesticide. The Rhus verniciflua extract may be sprayed or sprayed as it is in a liquid state, treated with soil or trees around the crops, or dipped in plants or seeds.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

One. Manufacture of Rhus verniciflua extract

The bark of Rhus verniciflua of 5-year old was collected from the bark of Rhus verniciflua for 3 days, shredded using a hot-air drier at 60 ° C, finely pulverized, High pressure hot water extraction is performed. The high temperature and high pressure hot water extraction was performed by using a crawling machine (control industry oriental medicine, far infrared ray bio-stove). In the present invention, the Rhus verniciflua extract was used as an effective ingredient in which the naturally chilled extract was extracted after high-temperature high-pressure hot water extraction. In the present invention, the hot water extraction was completed at a pressure of 1 MPa and a temperature of 111 ° C for 6 hours, A step of opening the control valve and forcibly discharging the generated pressure and steam in the high-temperature high-pressure hot water extraction was additionally performed. As a control, in order to analyze the effect of the room temperature extract extracted at room temperature for 48 hours and the effect of steam emission on the change of urushiol content and antioxidant activity using 1000 g of the hot-air dried lacquer bark, To ensure no release, completely cooled extracts without valves or lids were used for analysis.

The production conditions of the Rhus verniciflua extract of the present invention division Lacquer bark weight (g) menstruum Air pressure (MPa) Temperature (℃) Extraction time Room temperature extraction 1000 Water (15 l) 0 Room temperature 48 hours High-temperature high-pressure hot water extraction 1000 Water (15 l) One 111 6 hours

2. allergy  Triggering experiment

In order to examine the degree of induction of allergic rhizome of rusks extract of Urushichus rhizome extract which released uriciol at high temperature and high pressure according to the present invention, the extract was filtered once a day for 36 days and then 200 ml , And after 36 days, spot, itching and inflammation were confirmed.

3. HPLC Using Urushiol ( urushiol ) Qualitative analysis

Rhus uriciol (15: 1), urushiol (15: 2) and urushiol (15: 3) were obtained from phyto lab Gmbh & Co . ≪ / RTI > The column used was Atlantls dC18 (3 탆, 2.1 x 150 mm), column oven temperature was 30 캜, flow rate was 0.3 ml / min, and mobile phase was methanol containing 0.1% formic acid and 0.1% formic acid 2, and 10 μl of each of the above extracts at room temperature, high-temperature high-pressure hot-water extract, and hot-water extract from which the high-temperature and high-pressure steam of the present invention was released was injected at a wavelength of 220 nm.

Gradient conditions for HPLC mobile phase for urushiol qualitative analysis Mobile phase Solvent A: Water containing 0.1% formic acid
Solvent B: Methanol containing 0.1% formic acid Gradient conditions




Time (minutes)  A (%)  B (%) 0 50 50 15 0 100 25 0 100 30 50 50 35 50 50

4. Rhus verniciflua extract treatment and pumpkin gun RNA  detach

The ricin leaf extract, which released the steam generated at high temperature and high pressure of the present invention, was diluted and sprayed at a ratio of 500 times. Plant height of the pumpkin treated with the control and Rhus verniciflua extract was investigated at 4 weeks after the planting, and pumpkin without the extract of Rhus verniciflua was used as the control plant.

Total RNA isolation was performed using leaves of pumpkin cultivated for 8 weeks. The collected pumpkin leaves were continuously frozen in liquid nitrogen and crushed in a mortar. 5 ml of Trizol reagent was added to finely pulverized pumpkin sample. After reacting at room temperature for 5 minutes, chloroform was added and the mixture was vigorously shaken, reacted at 0 ° C for 10 minutes, centrifuged at 13,000 rpm at 4 ° C for 10 minutes Respectively. The supernatant was transferred to a new tube, to which chloroform was added, followed by reaction at room temperature for 10 minutes and centrifugation at 13,000 rpm for 10 minutes at 4 ° C. The separated supernatant was transferred to a new tube, and 1/10 of the volume of the supernatant was added with 3M NaOAc and twice the volume of 100% ethanol, and reacted at -20 ° C for one day. After the sample was centrifuged, the precipitated RNA pellet was washed with 70% ethanol, dried, resuspended in sterilized water treated with DEPC (diethyl pyrocarbonate), and then a certain amount was loaded on the RNA gel and quantified.

5. cDNA  Synthetic and Reverse transcription ( RT ) - PCR  Analysis method

Total RNAs isolated from zucchini and non-treated control cultivated by treating the Rhus verniciflua extract with steam generated at high temperature and high pressure according to the present invention were quantitated, and the total RNAs were treated with DNase and reacted at 37 ° C for 10 minutes. To obtain more pure RNA from the reacted samples, the triazole solution was added, and the mixture was allowed to stand at room temperature for 5 minutes, then vortexed with chloroform. After centrifugation at 13,000 rpm for 15 minutes, the supernatant was transferred to a new tube. To the supernatant was added 1/10 of the volume of 3M NaOAc and twice the volume of 100% ethanol. The supernatant was then centrifuged at 13,000 rpm And centrifuged for 10 minutes. The newly formed pellets were washed with 70% ethanol, dried at room temperature for 5 minutes, and completely dissolved in sterilized water treated with DEPC (diethyl pyrocarbonate) at 60 ° C for 10 minutes. Total RNA obtained was diluted to a concentration of 0.25 μg / μl, and 4 μl thereof was used for cDNA synthesis. Sterile water treated with oligo, dT, dNTP and DEPC was added to the total RNA. The reaction was allowed to proceed at 65 ° C for 5 minutes and then immediately cooled using ice. 5 × first-strand buffer, 0.1M DTT, and RNaseOUT (Invitrogen) were added to the reaction sample, followed by shaking gently, followed by reaction at 37 ° C for 2 minutes. Reverse transcriptase (M-MLV RT, Invitrogen) was added and reacted at 37 ° C for 50 minutes. The reaction was stopped at 70 ° C for 15 minutes to synthesize cDNA.

RT-PCR analysis was carried out using the primers of Table 3. CpActin was used to quantify cDNA of amber, CMV and WMV2 were used for diagnosis of virus infection in pumpkin, RT-PCR was performed for WRKY4, OFAD, CMV-cp, WMV2-cp and CDPK, PCR. RT-PCR reaction conditions included initial denaturation at 94 ° C for 5 minutes; 25 cycles of 1 minute denaturation at 94 DEG C, 1 minute annealing at 55 DEG C and 1 minute polymerization at 72 DEG C; Followed by an additional 10 minute polymerization at 72 ° C. 12 μl of each of the reacted samples was separated and separated by electrophoresis on 1% agarose gel. Each reaction was repeated three times for clarity of the results. The bands detected on the agarose gel were cloned into a pGEM T-easy vector, followed by sequencing. Homology was confirmed by nucleotide sequence analysis using a NCBI (National Center for Biotechnology Information) 2-blast program Respectively.

The primers used in the present invention gene primer The sequence (5 '- > 3') CpActin Forward TGAAGCACCTCTCAATCCCA (SEQ ID NO: 1) Reverse CCTGTTGTACGACCACTGGC (SEQ ID NO: 2 CMV Forward CCACACGGTAGAATCAAAT (SEQ ID NO: 3) Reverse GCTCGCCTGTTGAAGTCGCA (SEQ ID NO: 4) WMV2 Forward CTTATAACGACCCGAAATGCTA (SEQ ID NO: 5) Reverse AGTCCGTATATGCCTAGAT (SEQ ID NO: 6) WRKY4 Forward ACCGTTACGGGAAACAGCTT (SEQ ID NO: 7) Reverse TTGGGCTTCTTTCCAGGTTT (SEQ ID NO: 8) OFAD Forward CATCAGAATGGGACTGGCTG (SEQ ID NO: 9) Reverse TCCACATTGCCTTCACGAAT (SEQ ID NO: 10) CMV-cp Forward CTGCTATGTTTGGCGATGGT (SEQ ID NO: 11) Reverse ACGGCGTACTTACGCATGTC (SEQ ID NO: 12) WMV2-cp Forward ATTTGGATGCAGGGAAGGAC (SEQ ID NO: 13) Reverse TGTGCCGGTTTTTGTCTGTT (SEQ ID NO: 14) CDPK Forward GGAGAAGGCAACTGGGAAAG (SEQ ID NO: 15) Reverse ACCTCCAGCACACAACTCCA (SEQ ID NO: 16)

Example  1. Rhus verniciflua extract Urushiol ( urushiol ) Qualitative analysis and allergy  Triggering experiment

In order to evaluate the safety of Rhus verniciflua extract, qualitative analysis of urushiol (urushiol), which is a toxic substance that induces allergy, was conducted by using HPLC. Twelve subjects were given rusks extract of the present invention for 36 days, Respectively.

The poisonous substances that cause allergen in Rhus verniciflua correspond to the peaks detected at retention times of 17, 19, and 21 min with urushiol (15: 1), urushiol (15: 2) and urushiol (15: The results of performing HPLC to analyze the urushiol content of the Rhus verniciflua extract of the present invention are shown in FIG. Uruciol (15: 2) and urushiol (15: 3) were detected similarly at room temperature and high temperature and high pressure hot water extracts, and urushiol (15: 1) was reduced to some extent at high temperature and high pressure hot water extraction. Uruciol (15: 1), urushiol (15: 2) and urushiol (15: 3) were found to be negligible in the case of hot water extracts which released steam generated at high temperature and high pressure.

In order to examine the effect of the extract of Rhus verniciflua on the human body, in which the urushiol was removed at high temperature and high pressure of the present invention, the extract of the present invention was filtered, and 12 rats, which were taken 200 ml once a day for 36 days, Table 4 shows the results of spots, itching, and inflammation induction tests. No spots and irritations were evident at all, and insignificant levels of itching were observed in 2 patients, but this did not reach the extent of causing spots or inflammation. Thus, it was confirmed that the extract of the present invention did not induce any allergies.

The results of the allergy induction test of the Rhus verniciflua extract of the present invention One 2 3 4 5 6 7 8 9 10 11 12 Half point 0 0 0 0 0 0 0 0 0 0 0 0 itch One One 0 0 0 0 0 0 0 0 0 0 Inflammation 0 0 0 0 0 0 0 0 0 0 0 0

Example  2. Growth of pumpkin by treatment with Rhus verniciflua extract

FIG. 2 shows the results of measuring the plant length of 4 weeks old pumpkin in order to investigate the difference in the growth of the pumpkin sprayed with the extract of Rhus verniciflua with steam generated at the time of high temperature and high pressure of the present invention from which urushiol was removed. The plant height of the control without the extract of Rhus verniciflua was 125.1cm. The plant height of the pumpkin sprayed with Rhus verniciflua extract was 144.6cm. As a result, it was found that Rhus verniciflua extract had an effect of promoting early growth of pumpkin.

Example  3. Effect of plant pathogen control by treatment of Rhus verniciflua extract

The results of RT-PCR were shown in FIG. 4 in order to confirm whether any kind of virus was infected by a visible symptom of the virus in pumpkin which was formulated with amber and not sprayed with 6-week-old Rhus verniciflua extract (FIG. 3). Cucumber Mosaic Virus (CMV) is a major virus that deteriorates crop yield and quality. In addition to the mosaic symptoms, the key virus is dwarfed and the leaf color changes. RT-PCR analysis showed that the pumpkin-infected virus that did not spray the rumaceae extract was resistant to cucumber mosaic virus (CMV), watermelon mosaic virus (WMV2), and watermelon mosaic virus ). It was confirmed that the pumpkin that developed on the pumpkin not sprayed with the extract of the present invention and sprayed with the extract of Rhus verniciflua grows healthy without causing the disease (FIG. 3).

In order to investigate the relationship between the treatment of Rhus verniciflua extract and plant defense gene expression, the nucleotide sequence of the plant defense gene of amber was screened through NCBI and RT-PCR was performed using primers. It is known that CP (Capsid Protein) gene, which is a virus-derived gene, has been developed as a resistance gene for resistance to CMV and WMV when it is introduced into plants. RT-PCR results showed that CMV It was confirmed that WMV-related coat protein is strongly expressed. Therefore, CMV and WMV-related coat protein genes were strongly expressed in plants by the treatment with Rhus verniciflua extract, and they acted as a mechanism of resistance to viruses.

In addition, the genes for WRKY4 (WRKY DNA-binding protein 4), CDDPK (calcium-dependent protein kinase) and OFAD (omega-6 fatty acid desaturase) (Fig. 5). In plants, the WRKY4 and CDPK genes are known to play a role in resistance to parasitic pathogens that kill the host, and the OFAD gene is known to cause rapid response to oxidative stress in the signaling network in which the plant is wounded by pathogenic attack Is known as a gene.

Therefore, the Rhus verniciflua extract of the present invention accelerates the early growth of crops, and the plant-pathogen defense-related genes are not only strongly expressed but also exhibit substantial resistance to viral diseases. Therefore, the Rhus verniciflua extract of the present invention is safe for users, Can be useful as a useful plant pest control agent or bio-pesticide for resistance enhancement.

<110> KNU-Industry Cooperation Foundation <120> Composition for controlling pathogen or improving resistance to          pathogen in plant Lacquer tree extract as effective          component <130> PN12208 <160> 16 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tgaagcacct ctcaatccca 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 cctgttgtac gaccactggc 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ccacacggta gaatcaaat 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gctcgcctgt tgaagtcgca 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 cttataacga cccgaaatgc ta 22 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agtccgtata tgcctagat 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 accgttacgg gaaacagctt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ttgggcttct ttccaggttt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 catcagaatg ggactggctg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tccacattgc cttcacgaat 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 catcagaatg ggactggctg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 acggcgtact tacgcatgtc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 atttggatgc agggaaggac 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tgtgccggtt tttgtctgtt 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ggagaaggca actgggaaag 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 acctccagca cacaactcca 20

Claims (16)

A composition for controlling Watermelon Mosaic Virus or Cucumber Mosaic Virus containing Rhus verniciflua extract as an active ingredient. The composition for controlling Watermelon Mosaic Virus or Cucumber Mosaic Virus according to claim 1, wherein the Rhus verniciflua is a lacquer tree bark. The composition for controlling Watermelon Mosaic Virus or Cucumber Mosaic Virus according to claim 1, wherein the Rhus verniciflua extract is a high-pressure hot-water extract of lacquer tree. [Claim 4] The method according to claim 3, wherein the lacquer high pressure hot-water extract is prepared by subjecting Rhus verniciflua to hot water extraction at a pressure of 0.5 to 1.5 MPa and a temperature of 100 to 120 DEG C for 4 to 8 hours, or a watermelon mosaic virus A composition for controlling Cucumber Mosaic Virus. The composition for controlling Watermelon Mosaic Virus or Cucumber Mosaic Virus according to claim 4, wherein the lacquer high pressure hot-water extract is produced by releasing steam generated after hot water extraction. The method according to claim 1, wherein the Rhus verniciflua extract
(a) hot-air drying the collected Rhus verniciflua bark at 50-80 for 2-5 days;
(b) adding water to the hot-air dried luccus bark of step (a) and subjecting it to hot water extraction at a pressure of 0.5 to 1.5 MPa and a temperature of 100 to 120 ° C for 4 to 8 hours; And
(c) releasing the steam generated after the hot water extraction in the step (b). The composition for controlling Watermelon Mosaic Virus or Cucumber Mosaic Virus. delete delete delete delete A method for controlling Watermelon Mosaic Virus or Cucumber Mosaic Virus comprising treating the composition of any one of claims 1 to 6 on amber. delete delete delete delete A biocidal pesticide for controlling Watermelon Mosaic Virus or Cucumber Mosaic Virus containing Rhus verniciflua extract as an active ingredient.

Images