KR101535578B1 - Redox rebalancing method in e. coli strain for maximizing fermentation product production and recombinant e. coli strain for producing n-butanol product with high productivity using the method - Google Patents

Abstract

The present invention relates to a method of re-balancing a redox state to maximize production of a fermentation product in an E. coli strain and an E. coli strain for producing a highly productive fermentation product developed using the method. More specifically, the present invention relates to (1) (2) introducing the fdh1 gene of the yeast whose 5'UTR sequence is regulated into the E. coli strain and / or (2) regulating the PDH complex in the E. coli strain to balance the redox state so that the fermentation product, And an E. coli strain for producing butanol produced by using the above method. The method for maximizing fermentation product production in E. coli strains according to the present invention is characterized in that fdh1 It is possible to produce a fermented product with high efficiency without controlling the expression level of the gene and / or by controlling the expression level of the FDH1 complex.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method of re-balancing a redox state to maximize production of fermentation products in E. coli strains, and to a method of producing a strain for producing high productivity butanol by using the above method (REDOX REBALANCING METHOD IN E. COLI STRAIN FOR MAXIMIZING FERMENTATION PRODUCT PRODUCTION AND RECOMBINANT E. COLI STRAIN FOR PRODUCING N-BUTANOL PRODUCT WITH HIGH PRODUCTIVITY USING THE METHOD}

The present invention relates to a method of re-balancing a redox state to maximize the production of fermentation products in E. coli and an E. coli strain for producing high-productivity butanol using the method. More specifically, the present invention relates to a method for maximizing fermentation product production A method for optimizing the metabolic pathway through rebalancing of the redox state in the strain, and an E. coli strain for producing fermentation products produced using the method.

Due to depletion of petroleum resources and global warming, researches for the production of high value-added chemical products such as compounds, fuels and pharmaceuticals using environmentally friendly and sustainable microorganisms are active all over the world. In particular, in order to secure the economic efficiency of the biological process, a strain having high yield and productivity through metabolic engineering and synthetic biology has been developed. However, an artificial strain development often causes an imbalance of the microbial metabolic pathway, have.

Among these metabolic imbalances, it is important to rebalance according to the redesigned metabolic pathway, especially since the redox state within the cell is indispensable for sustaining catabolism and anabolism . In particular, the nicotinamide coenzyme NAD (P) is involved in more than 300 redox reactions in cell metabolism, so it can be assumed that the redox state is important.

Unlike cellular metabolism in aerobic conditions, where oxygen is used as a final electron acceptor, it is possible to produce fermentation products (metabolites) such as ethanol, lactic acid and succinic acid in anaerobic conditions, Thereby maximizing the rate of cell growth, amount of cells and ATP yield. Therefore, changes in cellular metabolism through the traditional metabolic engineering approach (deletion and amplification of specific genes) can result in imbalance of these redox states, leading to changes in the production patterns of metabolites depending on the redox state, or even in cell growth under anaerobic conditions It becomes invisible.

Therefore, it is necessary to develop a method for designing a strain capable of maximizing the yield and productivity of the fermentation product through optimization of the redox state depending on the redesigned cell metabolic pathway.

In order to overcome the problems of the prior art, the present inventors have developed a method for efficiently producing butanol as a fermentation product by redesigning the cell metabolic pathway of the Escherichia coli strain to optimize the redox state, and completed the present invention.

Accordingly, an object of the present invention is to provide a method for producing butanol using an Escherichia coli strain comprising a step of introducing the fdh1 gene whose 5'-UTR sequence is regulated into a Escherichia coli strain to adjust an intracellular redox balance.

Another object of the present invention is to provide an Escherichia coli strain for producing butanol produced using the above method.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to accomplish the object of the present invention as described above, the present invention provides a method for producing butanol using an Escherichia coli strain comprising the step of introducing the 5'-UTR sequence-regulated fdh1 gene into a Escherichia coli strain to adjust an intracellular redox balance . ≪ / RTI >

In one embodiment of the invention, the method may further comprise the following steps of modulating the PDH complex: a) site-directed mutagenesis in which the lpd gene on the intrachromosomal chromosome Removing the anaerobic regulatory region; And b) overexpressing the endogenous gene aceEF .

In another embodiment of the present invention, the 5'-UTR sequence may be a sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 2 to 6.

In another embodiment of the present invention, the site-specific mutation may be performed using a primer represented by the nucleotide sequences of SEQ ID NOS: 15 and 16.

In another embodiment of the present invention, the step (a) may be to remove the anaerobic regulatory region by replacing the 354th amino acid of the amino acid sequence of SEQ ID NO: 1 encoded by the lpd gene with lysine .

In another embodiment of the present invention, Overexpression can be carried out using primers represented by the nucleotide sequences of SEQ ID NOS: 13 and 14.

In another embodiment of the invention, the introduction is carried out using a recombinant vector comprising a full- length expression promoter represented by the nucleotide sequence of SEQ ID NO: 49 operatively linked to the 5'-UTR sequence-regulated fdhl gene .

In another embodiment of the present invention, the method may be one that does not require a chemical inducing agent.

In addition, the present invention provides a strain of E. coli for producing butanol, which is produced using the above method.

In addition, the present invention relates to a method for producing a recombinant Escherichia coli strain, Culturing the culture solution by spraying with nitrogen gas; And a step of obtaining butanol from the culture solution.

In one embodiment of the present invention, the culture medium may be TB (terrific broth), LB (Luria Bertani), M9 minimal, 2x YT, or NZCYM.

In another embodiment of the present invention, the culture may be addition of streptomycin or kanamycin antibiotic.

The method of producing the fermentation product using the E. coli strain according to the present invention is characterized in that the fdh1 gene maximizing the expression amount is introduced through custom design of the 5'-UTR base sequence to match the redox balance, and the expression promoter It is possible to produce fermentation products with high efficiency even without a chemical inducer.

In addition, redesigning the metabolic pathways of redox factors can produce butanol with high yield and high productivity.

In addition, it is expected that the present invention can be widely applied to fermentation of not only butanol but also other fermentation products from E. coli in high yield and high productivity by using the re-equilibration method in the redox state according to the present invention.

FIG. 1 schematically shows the production route of butanol in E. coli, wherein X represents gene deletion, a bold arrow represents amplification of the gene through homologous recombination or recombinant protein, and the dotted arrow represents the balance of redox state (PEP, phosphoenolpyruvate; CA, C. acetobutylicum ; EC, E. coli ; SC, Sacharomyces cerevisiae ; TD, T. denticola ).
FIG. 2 shows the fermentation curve of the E. coli strain JHL60 according to the present invention over time.
FIG. 3 is a graph comparing the fermentation results of E. coli strains JHL60 and JHL61 (mutant PDH complexes) prepared in the present invention.
Figure 4 (A) shows the results of FDH1 mutant's predicted protein expression through 5'-UTR and FDH1 specific enzyme activity, (B) shows the linear relationship between the protein expression predicted by 5'-UTR and actual protein activity The relationship is shown graphically.
Fig. 5 (A) shows the results of anaerobic fermentation of glucose for 24 hours after introduction of the FDH1 mutant, and Fig. 5 (B) shows the batch fermentation pattern of the E. coli strain JHL85 prepared in the present invention so as to optimize the redox factor will be.
Fig. 6 shows the result of anaerobic fermentation of galactose for 60 hours after introduction of the FDH1 mutant.

The present invention provides a method for producing butanol using an Escherichia coli strain comprising a step of introducing the 5'-UTR sequence-regulated fdh1 gene into a Escherichia coli strain to adjust an intracellular redox balance.

( Hbd , crt , ter , adhE2 ) which is a butanol production pathway is introduced and the endogenous gene ( ato B) is amplified In the recombinant E. coli strain in which only butanol acts as a final electron acceptor by deleting the genes associated with the pathway for redox metabolism ( ato DA, adh E, ldh A, paa FGH, and frd ABCD, pta ) ( AceEF ) overexpression to remove the anaerobic regulation site of the pyruvate dehydrogenase (PDH) complex to enhance the NADH supply of the 5'- more precisely of NADH as by introducing: (fdh1 formate dehydrogenase) gene as a yeast-derived cells have to connect and UTR sequence formate dehydrogenase One to supply the E. coli strain and was identified a method of designing the first strain.

That is, one embodiment the present inventors in the examples of foreign genes in E. coli, Clostridium acetonitrile unit Tilikum (C. acetobutylicum) of the present invention derived from hbd, crt, adhE2 gene, and bit reppo nematic denti coke (T. denticola) derived ter The gene was introduced and overexpressed in conjunction with the 5'-UTR sequence tailored to each gene. Overexpression of endogenous atoB in E. coli resulted in the conversion of the metabolic intermediate, acetoacetyl-CoA, from the atoB gene to n-butanol. In addition, a metabolite-related gene ato that competitively utilizes a precursor of butanol , Pta , and pAa FGH gene, which is known to use NADP as a cofactor , to produce the butanol production pathway through only the hbd , crt , ter , and adhE2 genes, and the metabolic pathway genes adh E, ldh A, frd ABCD to produce the first E. coli strain (JHL60), in which butanol is the only final electron acceptor in anaerobic conditions. Then, in order to solve the unbalance of the redox cofactor of the JHL 60 strain, anaerobic regulation site of the lpd gene represented by SEQ ID NO: 1 is removed by homologous recombination method to prepare a mutant PDH complex, (JHL61), which overexpresses the aceEF gene, a subunit of the PDH complex, was prepared in order to increase the expression level of the E. coli strain. The yeast-derived fdh1 gene, which can additionally supply NADH to meet the amount of NADH available in the JHL61 strain, is linked to five 5'-UTR sequences custom-tailored to control the expression level and introduced into E. coli Thereby producing an E. coli strain capable of producing butanol at a high yield (see Example 1).

Therefore, the present invention can provide a method for producing butanol using an Escherichia coli strain comprising a step of introducing the fdh1 gene whose 5'-UTR sequence is regulated into the Escherichia coli strain to adjust an intracellular redox balance. Wherein the introduction can be performed using a recombinant vector comprising a full- length expression promoter operably linked to the 5'-UTR sequence-regulated fdhl gene.

At this time, the ato DA gene is ato A and / or ato D , And the paa FGH gene means paa F, paa G, and / or paa H, and the frd ABCD gene means frd A, frd B, frd C , and / or frd D, The aceEF gene means aceE and / or aceF , and the genes may be partially or completely deleted and / or overexpressed so that the present invention exhibits the desired activity.

In the present invention, the yeast for obtaining the fdh1 gene may be any yeast having an NAD + dependent formate dehydrogenase, preferably Candida sp., And most preferably Saccharomyces cerevisiae Saccharomyces cerevisiae ), but is not limited thereto.

The method for producing butanol of the present invention may further comprise the following step of controlling the PDH complex:

a) removing the anaerobic regulatory region from the lpd gene on the chromosome in the strain by a site-directed mutagenesis method; And

b) Overexpressing the endogenous gene aceEF .

The foreign gene introduced to design the butanol production pathway in the recombinant E. coli strain of the present invention may be the hbd , crt , ter , or adhE2 gene according to an embodiment of the present invention, but it is also possible to convert acetoacetyl-CoA to n-butanol Any gene involved in the pathway may be introduced without limitation. In addition, the recombinant E. coli strain may overexpress the endogenous ato B gene to convert acetyl-CoA into acetoacetyl-CoA. However, the recombinant Escherichia coli strain may overexpress the endogenous ato B gene if it can convert acetyl-CoA to acetoacetyl- Can be introduced from abroad. In the hbd, crt, ter and / or adhE2 gene crt gene sequence is associated with the 5'-UTR sequence shown in italics in the hbd gene, SEQ ID NO: 45 is associated with the 5'-UTR sequence shown in italics in SEQ ID NO: 37 A ter gene linked to the 5'-UTR sequence represented by the italic number 47, and an adhE2 gene linked with the 5'-UTR sequence represented by the italicized sequence of SEQ ID NO: 23.

In the present invention, the introduction, overexpression and deletion of the gene are performed by transforming a recombinant plasmid vector into E. coli. Preferably, pCOLADuet, pCDDuet, pETDuet, or pRSFDuet is used as the recombinant plasmid vector. It is not. In this case, in order to increase homologous recombination efficiency, the plasmid pFRT having four different priming sites may be used.

In addition, site-specific mutations of the lpd gene can be most preferably performed using primers represented by the nucleotide sequences of SEQ ID NOS: 15 and 16, Overexpression of the endogenous gene aceEF can most preferably be carried out using primers represented by the nucleotide sequences of SEQ ID NOs: 13 and 14, but this is the most preferred example and is not limited to the above sequence.

In addition, removing the anaerobic regulatory region in the lpd gene can be performed by substituting the lysine (Lysine) the 354th amino acid of the amino acid sequence shown in SEQ ID NO: 1 encoded by the lpd gene in the glutamine (Glutamine) But can be made without limitation by the appropriate substitution of amino acids involved in anaerobic regulation by those skilled in the art.

Also, in the present invention, the 5'-UTR sequence may be any one selected from the group consisting of the nucleotide sequences of SEQ ID NO: 2 to SEQ ID NO: 6, and the primers containing the 5'-UTR sequence are used to amplify the fdh1 gene Lt; / RTI > Here, the amplification may be performed by performing a PCR using a forward primer selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 7 to 11 and a reverse primer represented by the nucleotide sequence of SEQ ID NO: 12 have. Also, in the present invention, the all-time expression promoter may be an all-time expression promoter represented by SEQ ID NO: 49. However, the above sequences are the most preferred examples, and are not limited thereto. The sequences may have a homology of at least 60%, preferably 70%, more preferably 80% May be appropriately added, deleted, or substituted by experts in the field.

According to the butanol production method of the present invention, butanol can be produced in a high yield without inducing a chemical inducer. In other words, since no chemical inducing substance such as IPTG is generally used in the pathway for exogenous metabolism in the Escherichia coli strain, it is possible to produce butanol with excellent efficiency throughout the metabolism of cells, It is obvious that it is necessary to harmonize with the metabolic circuit.

Further, the present invention provides a strain of E. coli for producing butanol, which is produced using the butanol production method according to the present invention.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Material example ]

The E. coli strains and plasmids used in the present invention are shown in Table 1 below. The oligonucleotides used in the present invention were synthesized in Genotech (Daejeon, Korea) and shown in Table 2 below. Phusion polymerase and restriction enzymes were purchased from TaKaRa and New England Biolabs. The amplified plasmids were AccuPrep Nano-Plus Plasmid Mini Extraction kits (Bioneer, Daejeon, Korea) and the restriction enzyme-treated DNA products were GeneAll Expin Gel SV kit (GeneAll Biotechnology, Seoul, Korea). All of the materials used for the culture were purchased from BD (Sparks, MD, USA) and other chemicals were purchased from Sigma (St. Louis, MO, USA).

In the present invention, pCDF-BuOH, pACYC-SP or pBASP plasmid was used for gene introduction and overexpression, and gene manipulation for gene overexpression and deletion on the chromosome was performed using a red recombination system using pKD46 and pCP20 plasmids (Datsenko & Wanner, 2000), wherein the overexpression replaces the promoter with a strong constitutive promoter (BBa_J23100) and uses a redesigned 5'-UTR to maximize translation in E. coli .

In addition, plasmids (pFRT) with different priming sites were used to increase homologous recombination efficiency. In addition, variants (pFRT72 _variant ) with additional FLP-recombinase recognition sequences were used for homologous recombination.

Related characteristics Strain Mach1-T1 ^R F ^- φ80 (lac Z) ΔM15 Δ lac X74 hsd R (r _k ^- m _k ⁺⁾ Δ rec A1 end A1398 ton A W3110 F ^- ? ^- rph -1 IN ( rrnD , rrnE ) 1 JHL58 W3110 Δ ato Δ adhE Δ A Δ ldh paa FGH Δ Δ frd ABCD pta P _{ato B} :: BBa_J23100 JHL14 JHL58 / P _lpd :: BBa_J23100 lpd (G1060A) JHL59 JHL14 / P _aceEF :: BBa_J23100 JHL60 JHL58 / pCDF-BuOH JHL61 JHL59 / pCDF-BuOH JHL80 JHL59 / pCDF-BuOH, pCOLADuet JHL81 JHL59 / pCDF-BuOH, pCOLA-F1 JHL82 JHL59 / pCDF-BuOH, pCOLA-F2 JHL83 JHL59 / pCDF-BuOH, pCOLA-F3 JHL84 JHL59 / pCDF-BuOH, pCOLA-F4 JHL85 JHL59 / pCDF-BuOH, pCOLA-F5 Plasmid pKD4 Template plasmid for FRT-flanked kanamycin resistance gene; Amp ^R , Km ^R pKD46 Red recombinase expression vector; Amp ^R pCP20 FLP expression vector; Amp ^R pCDFDuet Expression vector, Sm ^R , cloDF13ori pCOLADuet Expression vector, Km ^R , ColAori pCR2.1-TOPO Cloning vector, Amp ^R , Km ^R pMD20-T Cloning vector, Amp ^R pFRT2 From pGEM T-Easy, FRT - Kan ^R - FRT (2) pFRT3 From pGEM T-Easy, FRT - Kan ^R - FRT (3) pFRT5 From pGEM T-Easy, FRT - Kan ^R - FRT (5) pFRT6 From pGEM T-Easy, FRT - Kan ^R - FRT (6) pFRT7 From pGEM T-Easy, FRT - Kan ^R - FRT (7) pFRT72 _variant From pMD20-T, mutant FRT - Kan ^R - FRT pAdhE2 _{WT From pCR 2.1-TOPO, P J23100} :: adhE2 CA pAdhE2 _{m From pCR 2.1-TOPO, P J23100} :: adhE2 CA (T1794C) pLpd _WT From pMD20-T, P _J23100 :: lpd _EC pLpd _m From pMD20-T, P _J23100 :: lpd ^fbr (E354K) _EC pCDF-SP _{^{cloDF13 ori, Sm R, P J23100}} :: crt - P J23100 :: hbd - P J23100 :: ter pCDF-BuOH _{^{cloDF13 ori, Sm R, P J23100}} :: crt - P J23100 :: hbd - P J23100 :: ter - P _J23100 :: adhE2 pCOLA-F1 ColA ori, Km ^R _, P _J23100 :: F1 _UTR - FDH1 _SC pCOLA-F2 ColA ori, Km ^R _, P _J23100 :: F2 _UTR - FDH1 _SC pCOLA-F3 ColA ori, Km ^R _, P _J23100 :: F3 _UTR - FDH1 _SC pCOLA-F4 ColA ori, Km ^R _, P _J23100 :: F4 _UTR - FDH1 _SC pCOLA-F5 ColA ori, Km ^R _, P _J23100 :: F5 _UTR - FDH1 _SC

designation The sequence (5'-3 ') SEQ ID NO: fdh1 (F1) _F gccGCGGCCGCttgacggctagctcagtcctaggtacagtgctagc gctgat attgcaaggagcagagc atgtcgaagggaaaggttttgct 7 fdh1 (F2) _F gccGCGGCCGCttgacggctagctcagtcctaggtacagtgctagc ggctgatgttccaaggaggagagc atgtcgaagggaaaggttttgct 8 fdh1 (F3) _F gccGCGGCCGCttgacggctagctcagtcctaggtacagtgctagc gctgat gttcgaaggaggagagc atgtcgaagggaaaggttttgct 9 fdh1 (F4) _F gccGCGGCCGCttgacggctagctcagtcctaggtacagtgctagc agaaac acaataaggaggctaag atgtcgaagggaaaggttttgct 10 fdh1 (F5) _F gccGCGGCCGCttgacggctagctcagtcctaggtacagtgctagc gctgat attagaaggaggaaagc atgtcgaagggaaaggttttgct 11 fdh1_R gccGGTACCttatttcttctgtccataagctctg 12 aceEF_over72_F gcgtcgtctggagcaacgaaagaattagtgatttttctggtaaaaattat gc atgaccggcgcgatgc 13 aceEF_over72_R gtcgcgagtttcgatcggatccacgtcatttgggaaacgttctgacat cttgacctccttatctacagc gctagcactgtacctaggactgagctagccgtcaa gctcagcggatctcatgcgc 14 lpd_G1060A_F gtccatcgcctataccaaaccagaagttgcatg 15 lpd_G1060A_R catgcaacttctggtttggtataggcgatggac 16 lpd_del3_F aacaacacgctgtctgacattcgccgtctggtgatgtaagtaaaagagcc gt tagcccgtctgtcccaac 17 lpd_del3_R acgtctctctctgaacgtggagcaagaagactggaaaggtaaattgcagacg ca tactcgctcttgggtcgg 18 C-aceEF_F gcgaagcatcgcatcgccatc 19 C-aceEF_R cggggatggtgttgatgtagttgc 20 C-lpd_F cggtgctgatggtgcccgtt 21 C-lpd_R caggagagccgcccacaacg 22 adhE2_F gccGCGGCCGCttgacggctagctcagtcctaggtacagtgctagc gcaaagcgattaaggagtacaat atgaaagttacaaatcaaaaagaactaaaac 23 adhE2_R gccGGTACCtagtctatgtgcttcatgaagctaat 24 adhE2_T1794C_F cctacaactgctggcaccggttcagaggc 25 adhE2_T1794C_R gcctctgaaccggtgccagcagttgtagg 26 FRT2_F cgatgcctcatccgcttctc gaagttcctatactttctagagaataggaacttcggaataggaacttcaagatcccctcacgctgccgc 27 FRT2_R gcaacgcagtagctggagtc agttcctattccgaagttcctattctctagaaagtataggaacttcagagcgcttttgaagctggggtg 28 FRT3_F gttagcccgtctgtcccaac gaagttcctatactttctagagaataggaacttcggaataggaacttcaagatcccctcacgctgccgc 29 FRT3_R catactcgctcttgggtcgg agttcctattccgaagttcctattctctagaaagtataggaacttcagagcgcttttgaagctggggtg 30 FRT5_F cgttgctcctgacatggctc gaagttcctatactttctagagaataggaacttcggaataggaacttcaagatcccctcacgctgccgc 31 FRT5_R gatgtcgagagcccgttgac agttcctattccgaagttcctattctctagaaagtataggaacttcagagcgcttttgaagctggggtg 32 FRT6_F gtagcaccgagtcgtaccag gaagttcctatactttctagagaataggaacttcggaataggaacttcaagatcccctcacgctgccgc 33 FRT6_R ttcggttggcctaacgcact agttcctattccgaagttcctattctctagaaagtataggaacttcagagcgcttttgaagctggggtg 34 FRT7_F gatcgtgcgaacgacctgct gaagttcctatactttctagagaataggaacttcggaataggaacttcaagatcccctcacgctgccgc 35 FRT7_R cagtactcgagtcgctccga agttcctattccgaagttcctattctctagaaagtataggaacttcagagcgcttttgaagctggggtg 36 FRT72 _v _F gcatgaccggcgcgatgc gaagttcctatactttctacagaataggaacttctcaagatcccctcacgctgccg 37 FRT72 _v _R gctcagcggatctcatgcgc gaagttcctattctgtagaaagtataggaacttcagagcgcttttgaagctggggtgg 38 lpd_F gttgacggctagctcagtcctaggtacagtgctagc gaacatcaaagggtaa ggaggatagaac atgagtactgaaatcaaaactcaggtcg 39 lpd_R tgcagacgtaaaaaaagcggcgtgg 40 lpd_over_F aacaacacgctgtctgacattcgccgtctggtgatgtaagtaaaagagccgttgacggctagctcagtcctagg 41 lpd_over_R cgtctctctgagaacgtggagcaagaagactggaaaggtaaattgcagacgtaaaaaaagcggcgtgg 42 crt_F aGGATCCttgacggctagctcagtcctaggtacagtgctagc tcattctaaa aaaggagcatctgtg atggaactaaacaatgtcatccttg 43 crt_R aGTCGACtcactatctatttttgaagccttcaat 44 hbd_F gccGTCGACttgacggctagctcagtcctaggtacagtgctagc tggcaagtctaaaggagcatcacga atgaaaaaggtatgtgttataggtg 45 hbd_R aCTCGAGttattttgaataatcgtagaaacct 46 ter_F gccCTCGAGttgacggctagctcagtcctaggtacagtgctagc tacattaa ggaggaagccg atg 47 ter_R gcc TTAATTAA GAGCTCatgccctggcgttctagatt 48 - Primers starting with "C" are designed to confirm homologous recombination results.
- Upper case represents restriction enzyme recognition sequence.
- The underlined alphabets represent different priming sequences designed to increase homologous recombination efficiency.
- The italicized alphabet is a 5'-UTR base sequence designed to maximize each gene

Butanol  Production of recombinant E. coli strain for production

As shown in the following Examples <1-1> to <1-3>, the inventors of the present invention produced a recombinant E. coli strain producing butanol with high efficiency by redesigning the butanol production pathway.

In the following examples, Terrific broth (TB) (12 g tryptone, 24 g yeast extract, 2.31 g KH ₂ PO ₄ , 12.54 g K ₂ HPO ₄ , ₄ ml glycerol per liter) , 25 g / ml of streptomycin and 15 ug / ml of kanamycin antibiotics were added to maintain a plurality of plasmids (a single plasmid was added to each well) 50 μg / ml of streptomycin antibiotics was used in the experiments required). The experiment was carried out in the following order. A single colony was inoculated in 3 ml of LB and seeded in 20 ml of the TB medium to inoculate OD ₆₀₀ value of 0.05. The cells were cultured at 37 ° C and 250 rpm for 24 hours. Using a 60 ml serum bottle And an anaerobic condition was formed by spraying nitrogen gas in the upper layer and the medium. Unless otherwise noted, 10 M NaOH was added at 24-hour intervals to calibrate the pH of the culture to about 7.2.

Performance was determined by high performance liquid chromatography (HPLC) using an Aminex HPX-87H column (Bio-Rad Laboratories, Richmond, CA, USA) to analyze the amount of carbon source and metabolites present in the medium. , 5 mM H ₂ SO ₄ was used as the mobile phase, the flow rate was set at 0.6 ml / min, and the oven temperature was set at 14 ° C. Signals of carbon source and metabolite were measured using Shodex RI-101 refractive index detector (Shodex, Klokkerfaldet, Denmark) and UV-VIS diode array detector (at 210 nm).

<1-1> Butanol  Metabolic path redesign for production

Since Escherichia coli can not produce butanol naturally, it is necessary to introduce an exogenous gene to complete the butanol production pathway. The present inventors first redesigned the metabolic pathway of E. coli having butanol as a final electron acceptor as shown in FIG.

That is, the 5'-UTR sequence was cloned into a hbd vector derived from C. acetobutylicum , which was artificially tailored to the base sequence of the corresponding gene (encoding 3-hydroxybutyryl-CoA dehydrogenase) gene, adhE2 (encoding bifunctional aldehyde / alcohol dehydrogenase) gene, and crt (encoding crotonase) gene and T. denticola- derived ter pCDF-BuOH plasmid vector into which the gene encoding trans-enoyl-CoA reductase was inserted was introduced into E. coli and overexpressed the atoB (endogenous atoB ) gene on the E. coli chromosome. In this case, by replacing the promoter with a strong constitutive promoter (BBa_J23100) shown in SEQ ID NO: 49 by using a plasmid so as to increase the expression of the intracellular enzyme without the use of chemical inducers such as IPTG, And inducer-free fermentation system. Next, to redistribute the carbon flow to the butanol production pathway, one step inactivation method using PCR products (Warner et al., (2000) PNAS, 97 (12), 6640-6645) atoAD (encoding acetoacetyl-CoA transferase, convert acetoacetyl-CoA into acetoacetate) and pta (encoding phosphate acetyltransferase, acetyl-CoA into acetate) were deleted in E. coli. And nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor, paaFGH (encoding the enzymes enoyl-CoA hydratase -isomerase, acyl-CoA hydratase and 3-hydroxybutyryl-CoA dehydrogenase, convert acetoacetyl-CoA into crotonyl-CoA) by deleting the gene in E. coli, only hbd, adhE2, crt, via ter gene Butanol production route was completed. Escherichia coli strains for the production of butanol were prepared by deletion of the genes for encoding metabolism dehydrogenase ( adhE ), encoding lactate dehydrogenase ( ldhA ), and encoding genes for frdABCD (encoding fumarate reductase), which are involved in the regeneration of redox factors in E. coli. At this time, the adhE2 gene was PCR amplified using adhE2_F and adhE2_R primers, TA cloning was performed on pCR2.1-TOPO vector to construct pAdhE2WT plasmid, and adhE2_T1794C_F and adhE2_T1794C_R were constructed to remove the KpnI restriction enzyme recognition sequence in the adhE2 gene The pAdhE2m plasmid was constructed by site-directed mutagenesis using primers. And c rt , hbd , The ter gene fragment was prepared by pCDF-SP plasmid and BamHI and SacI restriction enzymes. The adhE2 gene fragment was prepared by pAdhE2m plasmid and NotI and KpnI restriction enzymes. The pCDF-BuOH plasmid having the butanol production pathway was finally obtained by inserting the restriction enzyme-treated fragments into the corresponding cloning site of the pCDFDuet vector. The pCDF-BuOH plasmid was finally transformed into the E. coli strain by the transformation of the plasmid, A possible E. coli strain JHL60 was prepared.

In order to verify the butanol production ability of JHL60, anaerobic fermentation was conducted for 48 hours. As a result, it was confirmed that butanol having a concentration of 5.02 g / L (productivity: 0.11 g / L / h) was produced as shown in FIG. In FIG. 2, the left y-axis represents OD ₆₀₀ in log units, the left offset y-axis represents glucose concentration, the x-axis represents the fermentation time, the right y-axis represents the concentration of the metabolite, The bar shows the standard deviation of the results of two repeated experiments (circle, glucose, square, OD ₆₀₀ , triangle, butanol, diamond type, ethanol, hexagonal butyrate).

However, theoretically, in order to produce 1 mole of butanol from 1 mole of glucose, 4 moles of NADH is required. Since the JHL60 strain can produce only 2 moles of NADH from 1 mole of glucose through the corresponding process, There is a problem that the cofactors are not balanced.

<1-2> PDH  Complex complex Redesign

In order to solve the imbalance of the redox cofactor identified in the above Example <1-1>, the PDH complex was manipulated as a strategy for supplementing the redox cofactor with carbon flow to butanol. The PDH complex consists of three protein subunits consisting of pyruvate decarboxylase (encoded by aceE ), dihydrolipoamide acetyltransferase (encoded by aceF ) and dihydrolipoamide dehydrogenase (encoded by lpd ). The dihydrolipoamide dehydrogenase (LPD) subunit is less inhibited by NADH through the redesign of the active site of the LPD subunit because it is inhibited by NADH under anaerobic conditions and does not exhibit the entire PDH complex activity. Thus, the present inventors designed and constructed E. coli strain JHL61, which includes a mutant PDH complex showing an activity under anaerobic conditions, using a homologous recombination technique on an E. coli chromosome, as shown in Table 1. First, the wild type lpd The gene was amplified by PCR using lpd_F and lpd_R primers and TA cloned into pMD20-T vector to construct pLpd _WT plasmid. The mutant lpd gene (pLpd _m plasmid) was subjected to site-directed mutagenesis using the above-described pLpd _WT plasmid as a template using lpd_G1060A_F and lpd_G1060A_R primers. The mutant PDH complex was constructed by homologous recombination in which the lpd gene on the E. coli chromosome was replaced with the mutant lpd ^fbr (E354K). For the homologous recombination, the pLpd _m plasmid was used as a template and lpd_over_F and lpd_over_R primers were used. We then overexpressed the aceEF gene on the E. coli chromosome in order to increase the expression of the mutant PDH complex. This manipulation was accomplished by PCR amplification of the pFRT72 _variant as a template using aceEF_over72_F and aceEF_over72_R primers.

As shown in FIG. 3, the JHL61 strain showed 17.4% higher cell mass and 12% higher butanol productivity than the JHL60 strain by anaerobic fermentation for 24 hours to verify the butanol production ability of JHL61. In this case, the error bars in FIG. 3 represent standard deviations of the experiments repeated twice.

However, even though the JHL61 strain exhibits improved butanol fermentation and increased cell mass, pyruvate, an intermediate metabolite of the cell, can be converted to formate and acetyl-CoA through pyruvate formate lyase (PFL) .

<1-3> Design for balance of redox state

Unlike formate hydrogen lyase (FHL), which is an endogenous protein of Escherichia coli, yeast-derived formate dehydrogenase (FDH1) is widely used as a strategy for increasing NADH availability in the cell because additional NADH can be supplied from formate generated from PFL do. However, the present inventors quantitatively regulated the expression level of FDH1 to enable the NADH to be supplied in an amount necessary for the cell, ultimately rebalancing the redox state.

In order to control the expression level of FDH1, the present inventors artificially tailored five kinds of 5'-UTR sequences according to the fdh1 gene sequence using the UTR designer, and found that 5'-UTR sequences Using the forward primer (fdh1 (F1 to F5) _F) and the reverse primer fdh1_R, Saccharomyces The corresponding gene sequence was amplified in the S. cerevisiae genome. Subsequently, the amplified product was cloned into a site corresponding to the pCOLADuet vector through NotI and KpnI restriction enzyme treatments, whereby pCOLA-F1 containing the FDH1 mutant having five different expression amounts by the artificially created 5'-UTR sequence, -F2, -F3, -F4, and-F5 plasmids (see Table 1).

In addition, the present inventors measured the specific activity to measure the intracellular activity of the FDH1 mutant. First, the E. coli in the mid-log phase under anaerobic conditions were combined and washed with cold phosphate-buffered saline (PBS) buffer. Cell pellet was obtained and the Bug Buster Master Mix (EMD Bioscience) supplemented with protease inhibitor cocktail , San Diego, CA, USA) for resuspension and dissolution. The activity of FDH1 was determined by measuring the absorbance of NAD + to NADH at 340 nm using VICTOR3 1420 Multilabel Counter (PerkinElmer, Waltham, Mass., USA). Briefly, 162 mM sodium formate and 1.62 mM NAD + were added to 100 mM potassium phosphate buffer (pH 7.5), and the solution prepared as described above The cell lysate was added to proceed the reaction. The total protein concentration of the cell lysate was calculated using the Bradford assay-based Bio-Rad Protein Assay Dye (Bio-Rad, Hercules, Calif., USA) using bovine serum albumin (BSA) FDH1 activity was normalized to the total amount of protein in cell lysate and expressed as specific FDH1 activity (U / mg).

As a result, it was found that a high correlation (R ^{2 -} = 0.96) was shown as shown in FIG.

As shown in FIG. 5A, when the FDH1 mutant was introduced into a TB medium using glucose as a carbon source, the productivity of the JHL85 strain increased by 35.4% as compared with the JHL80 strain as the FDH1 expression level increased. As shown in FIG. 5B, the fermentation profile of the JHL85 strain in which the redox state of the cells was optimized through the regulation of the expression level of FDH1 revealed that butanol (productivity 0.26 g / L / h) production was possible. The results of the batch fermentation were 30 to 44% higher than those of the conventional fed-batch fermentation (Shen et al. (2011) Appl. Environ. Microbiol. 77, 2905-2915) , It was confirmed that rebalancing of the redox state according to the present invention is essential for effective production of butanol.

As a result of confirming the effect of the FDH1 mutant by using galactose, which is not well used in Escherichia coli but is found in many seaweeds as a carbon source, JHL81 strain has a final butanol production of 44.6 %, Respectively. Therefore, it was found that FDH1 mutants with low expression levels were optimized when compared with glucose - supplemented medium. In FIG. 5B, the left y-axis represents the OD ₆₀₀ in log units, the left offset y-axis represents glucose concentration, the x-axis represents the fermentation time, and the right y-axis represents the metabolite concentration (Symbols: circle, glucose, square, OD ₆₀₀ , triangle, butanol, diamond type, ethanol, hexagonal butyrate). In FIGS. 5 and 6, the error bars show the standard deviation of the results of two repeated experiments

From the above, it can be seen that the recombinant E. coli strains (JHL80, 81, 82, 83, 84, 85) produced by redistribution of the redox state according to the carbon flow in the cells according to the present invention can produce butanol with excellent efficiency And it was found that the butanol production ability of the E. coli strain can be changed according to the carbon source.

Therefore, when a redox state optimized strain is used through the redistribution method proposed by the present invention, a maximized butanol production strain can be developed according to the carbon source.

It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims . It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> POSTECH Academy-industry Foundation <120> REDOX REBALANCING METHOD IN E. COLI STRAIN FOR MAXIMIZING          FERMENTATION PRODUCT PRODUCTION AND RECOMBINANT E. COLI STRAIN          FOR PRODUCING N-BUTANOL PRODUCT WITH HIGH PRODUCTIVITY USING THE          METHOD <130> PB13-11590 <160> 49 <170> Kopatentin 2.0 <210> 1 <211> 474 <212> PRT <213> Escherichia coli - lpd <400> 1 Met Ser Thr Glu Ile Lys Thr Gln Val Val Val Leu Gly Ala Gly Pro   1 5 10 15 Ala Gly Tyr Ser Ala Ala Phe Arg Cys Ala Asp Leu Gly Leu Glu Thr              20 25 30 Val Ile Val Glu Arg Tyr Asn Thr Leu Gly Gly Val Cys Leu Asn Val          35 40 45 Gly Cys Ile Pro Ser Lys Ala Leu Leu His Val Ala Lys Val Ile Glu      50 55 60 Glu Ala Lys Ala Leu Ala Glu His Gly Ile Val Phe Gly Glu Pro Lys  65 70 75 80 Thr Asp Ile Asp Lys Ile Arg Thr Trp Lys Glu Lys Val Ile Asn Gln                  85 90 95 Leu Thr Gly Gly Leu Ala Gly Met Ala Lys Gly Arg Lys Val Lys Val             100 105 110 Val Asn Gly Leu Gly Lys Phe Thr Gly Ala Asn Thr Leu Glu Val Glu         115 120 125 Gly Glu Asn Gly Lys Thr Val Ile Asn Phe Asp Asn Ale Ile Ile Ala     130 135 140 Ala Gly Ser Arg Pro Ile Gln Leu Pro Phe Ile Pro His Glu Asp Pro 145 150 155 160 Arg Ile Trp Asp Ser Thr Asp Ala Leu Glu Leu Lys Glu Val Pro Glu                 165 170 175 Arg Leu Leu Val Met Gly Gly Gly Ile Ile Gly Leu Glu Met Gly Thr             180 185 190 Val Tyr His Ala Leu Gly Ser Gln Ile Asp Val Val Glu Met Phe Asp         195 200 205 Gln Val Ile Pro Ala Ala Asp Lys Asp Ile Val Lys Val Phe Thr Lys     210 215 220 Arg Ile Ser Lys Lys Phe Asn Leu Met Leu Glu Thr Lys Val Thr Ala 225 230 235 240 Val Glu Ala Lys Glu Asp Gly Ile Tyr Val Thr Met Glu Gly Lys Lys                 245 250 255 Ala Pro Ala Glu Pro Gln Arg Tyr Asp Ala Val Leu Val Ala Ile Gly             260 265 270 Arg Val Pro Asn Gly Lys Asn Leu Asp Ala Gly Lys Ala Gly Val Glu         275 280 285 Val Asp Asp Arg Gly Phe Ile Arg Val Asp Lys Gln Leu Arg Thr Asn     290 295 300 Val Pro His Ile Phe Ala Ile Gly Asp Ile Val Gly Gln Pro Met Leu 305 310 315 320 Ala His Lys Gly Val His Glu Gly His Val Ala Ala Glu Val Ile Ala                 325 330 335 Gly Lys Lys His Tyr Phe Asp Pro Lys Val Ile Pro Ser Ile Ala Tyr             340 345 350 Thr Glu Pro Glu Val Ala Trp Val Gly Leu Thr Glu Lys Glu Ala Lys         355 360 365 Glu Lys Gly Ile Ser Tyr Glu Thr Ala Thr Phe Pro Trp Ala Ala Ser     370 375 380 Gly Arg Ala Ile Ala Ser Asp Cys Ala Asp Gly Met Thr Lys Leu Ile 385 390 395 400 Phe Asp Lys Glu Ser His Arg Val Ile Gly Gly Ala Ile Val Gly Thr                 405 410 415 Asn Gly Gly Glu Glu Leu Gly Glu Glu Ile Gly Leu Ala Ile Glu Met Gly             420 425 430 Cys Asp Ala Glu Asp Ile Ala Leu Thr Ile His Ala His Pro Thr Leu         435 440 445 His Glu Ser Val Gly Leu Ala Ala Glu Val Phe Glu Gly Ser Ile Thr     450 455 460 Asp Leu Pro Asn Pro Lys Ala Lys Lys Lys 465 470 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5'UTR base seq. of fdh1 (F1) <400> 2 gctgatattg caaggagcag agc 23 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 5'UTR base seq. of fdh1 (F2) <400> 3 ggctgatgtt ccaaggagga gagc 24 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5'UTR base seq. of FDH1 (F3) <400> 4 gctgatgttc gaaggaggag agc 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5'UTR base seq. of FDH1 (F4) <400> 5 agaaacacaa taaggaggct aag 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5'UTR base seq. of FDH1 (F5) <400> 6 gctgatatta gaaggaggaa agc 23 <210> 7 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> fdh1 (F1) _F <400> 7 gccgcggccg cttgacggct agctcagtcc taggtacagt gctagcgctg atattgcaag 60 gagcagagca tgtcgaaggg aaaggttttg ct 92 <210> 8 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> fdh1 (F2) _F <400> 8 gccgcggccg cttgacggct agctcagtcc taggtacagt gctagcggct gatgttccaa 60 ggaggagagc atgtcgaagg gaaaggtttt gct 93 <210> 9 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> fdH1 (F3) _F <400> 9 gccgcggccg cttgacggct agctcagtcc taggtacagt gctagcgctg atgttcgaag 60 gaggagagca tgtcgaaggg aaaggttttg ct 92 <210> 10 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> fdh1 (F4) _F <400> 10 gccgcggccg cttgacggct agctcagtcc taggtacagt gctagcagaa acacaataag 60 gaggctaaga tgtcgaaggg aaaggttttg ct 92 <210> 11 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> fdh1 (F5) _F <400> 11 gccgcggccg cttgacggct agctcagtcc taggtacagt gctagcgctg atattagaag 60 gaggaaagca tgtcgaaggg aaaggttttg ct 92 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> fdh1_R <400> 12 gccggtacct tatttcttct gtccataagc tctg 34 <210> 13 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> aceEF_over72_F <400> 13 gcgtcgtctg gagcaacgaa agaattagtg atttttctgg taaaaattat gcatgaccgg 60 cgcgatgc 68 <210> 14 <211> 124 <212> DNA <213> Artificial Sequence <220> <223> aceEF_over72_R <400> 14 gtcgcgagtt tcgatcggat ccacgtcatt tgggaaacgt tctgacatct tgacctcctt 60 atctacagcg ctagcactgt acctaggact gagctagccg tcaagctcag cggatctcat 120 gcgc 124 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> lpd_G1060A_F <400> 15 gtccatcgcc tataccaaac cagaagttgc atg 33 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> lpd_G1060A_R <400> 16 catgcaactt ctggtttggt ataggcgatg gac 33 <210> 17 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lpd_del3_F <400> 17 aacaacacgc tgtctgacat tcgccgtctg gtgatgtaag taaaagagcc gttagcccgt 60 ctgtcccaac 70 <210> 18 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> lpd_del3_R <400> 18 acgtctctct gaacgtggag caagaagact ggaaaggtaa attgcagacg catactcgct 60 cttgggtcgg 70 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> C-aceEF_F <400> 19 gcgaagcatc gcatcgccat c 21 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> C-aceEF_R <400> 20 cggggatggt gttgatgtag ttgc 24 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C-lpd_F <400> 21 cggtgctgat ggtgcccgtt 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C-lpd_R <400> 22 caggagagcc gcccacaacg 20 <210> 23 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> adhE2_F <400> 23 gccgcggccg cttgacggct agctcagtcc taggtacagt gctagcgcaa agcgattaag 60 gagtacaata tgaaagttac aaatcaaaaa gaactaaaac 100 <210> 24 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> adhE2_R <400> 24 gccggtacct agtctatgtg cttcatgaag ctaat 35 <210> 25 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> adhE2_T1794C_F <400> 25 cctacaactg ctggcaccgg ttcagaggc 29 <210> 26 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> adhE2_T1794C_R <400> 26 gcctctgaac cggtgccagc agttgtagg 29 <210> 27 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> FRT2_F <400> 27 cgatgcctca tccgcttctc gaagttccta tactttctag agaataggaa cttcggaata 60 ggaacttcaa gatcccctca cgctgccgc 89 <210> 28 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> FRT2_R <400> 28 gcaacgcagt agctggagtc agttcctatt ccgaagttcc tattctctag aaagtatagg 60 aacttcagag cgcttttgaa gctggggtg 89 <210> 29 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> FRT3_F <400> 29 gttagcccgt ctgtcccaac gaagttccta tactttctag agaataggaa cttcggaata 60 ggaacttcaa gatcccctca cgctgccgc 89 <210> 30 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> FRT3_R <400> 30 catactcgct cttgggtcgg agttcctatt ccgaagttcc tattctctag aaagtatagg 60 aacttcagag cgcttttgaa gctggggtg 89 <210> 31 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> FRT5_F <400> 31 cgttgctcct gacatggctc gaagttccta tactttctag agaataggaa cttcggaata 60 ggaacttcaa gatcccctca cgctgccgc 89 <210> 32 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> FRT5_R <400> 32 gatgtcgaga gcccgttgac agttcctatt ccgaagttcc tattctctag aaagtatagg 60 aacttcagag cgcttttgaa gctggggtg 89 <210> 33 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> FRT6_F <400> 33 gtagcaccga gtcgtaccag gaagttccta tactttctag agaataggaa cttcggaata 60 ggaacttcaa gatcccctca cgctgccgc 89 <210> 34 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> FRT6_R <400> 34 ttcggttggc ctaacgcact agttcctatt ccgaagttcc tattctctag aaagtatagg 60 aacttcagag cgcttttgaa gctggggtg 89 <210> 35 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> FRT7_F <400> 35 gatcgtgcga acgacctgct gaagttccta tactttctag agaataggaa cttcggaata 60 ggaacttcaa gatcccctca cgctgccgc 89 <210> 36 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> FRT7_R <400> 36 cagtactcga gtcgctccga agttcctatt ccgaagttcc tattctctag aaagtatagg 60 aacttcagag cgcttttgaa gctggggtg 89 <210> 37 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> FRT72v_F <400> 37 gcatgaccgg cgcgatgcga agttcctata ctttctacag aataggaact tctcaagatc 60 ccctcacgct gccg 74 <210> 38 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> FRT72v_R <400> 38 gctcagcgga tctcatgcgc gaagttccta ttctgtagaa agtataggaa cttcagagcg 60 cttttgaagc tggggtgg 78 <210> 39 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> lpd_F <400> 39 gttgacggct agctcagtcc taggtacagt gctagcgaac atcaaagggt aaggaggata 60 gaacatgagt actgaaatca aaactcaggt cg 92 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> lpd_R <400> 40 tgcagacgta aaaaaagcgg cgtgg 25 <210> 41 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> lpd_over_F <400> 41 aacaacacgc tgtctgacat tcgccgtctg gtgatgtaag taaaagagcc gttgacggct 60 agctcagtcc tagg 74 <210> 42 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> lpd_over_R <400> 42 cgtctctctg aacgtggagc aagaagactg gaaaggtaaa ttgcagacgt aaaaaaagcg 60 gcgtgg 66 <210> 43 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> crt_F <400> 43 aggatccttg acggctagct cagtcctagg tacagtgcta gctcattcta aaaaaggagc 60 atctgtgatg gaactaaaca atgtcatcct tg 92 <210> 44 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> crt_R <400> 44 agtcgactca ctatctattt ttgaagcctt caat 34 <210> 45 <211> 94 <212> DNA <213> Artificial Sequence <220> <223> hbd_F <400> 45 gccgtcgact tgacggctag ctcagtccta ggtacagtgc tagctggcaa gtctaaagga 60 gcatcacgaa tgaaaaaggt atgtgttata ggtg 94 <210> 46 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> hbd_R <400> 46 actcgagtta ttttgaataa tcgtagaaac ct 32 <210> 47 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> ter_F <400> 47 gccctcgagt tgacggctag ctcagtccta ggtacagtgc tagctacatt aaggaggaag 60 ccgatg 66 <210> 48 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> ter_R <400> 48 gccttaatta agagctcatg ccctggcgtt ctagatt 37 <210> 49 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> constitutive promoter (BBa_J23100) <400> 49 ttgacggcta gctcagtcct aggtacagtg ctagc 35

Claims (9)

Introducing the fdhl gene whose 5'-UTR sequence is regulated into the E. coli strain, and adjusting the intracellular redox balance, thereby producing butanol by using an E. coli strain.
Wherein the 5'-UTR sequence comprises a sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 2 to SEQ ID NO: 6.
The method according to claim 1,
Wherein the method further comprises the step of modulating the PDH complex.
a) removing the anaerobic regulatory region from the lpd gene on the chromosome in the strain by a site-directed mutagenesis method; And
b) Overexpressing the endogenous gene aceEF .
delete 3. The method of claim 2,
Wherein the site-specific mutation is carried out using a primer represented by the nucleotide sequences of SEQ ID NOS: 15 and 16.
3. The method of claim 2,
Wherein the step (a) removes the anaerobic regulatory region by replacing the 354th amino acid of the amino acid sequence of SEQ ID NO: 1 encoded by the lpd gene with lysine.
3. The method of claim 2,
remind Characterized in that overexpression is carried out using primers represented by the nucleotide sequences of SEQ ID NOS: 13 and 14.
The method according to claim 1,
Wherein said introduction is carried out using a recombinant vector comprising a full- length expression promoter represented by the nucleotide sequence of SEQ ID NO: 49 operably linked to the 5'-UTR sequence regulated fdhl gene.
The method according to claim 1,
Characterized in that the process does not require a chemical inducing substance.
An E. coli strain for producing butanol, which is produced using the method according to claim 1.

Images