KR101514436B1 - Method of identifying Pseudoalteromonas sp. - Google Patents

Abstract

The present invention relates to a method for separating pathogenic bacteria living in sea tangle by using sea tangle. The present invention specifically separates Pseudoalteromonas sp. only which is an organism causing bacterial spot disease of sea tangle by using sea tangle bacteria culture medium (DA) and is capable of blocking early the spread of damage by applying a bacterial spot disease diagnosis and warning system.

Description

{Method of identifying Pseudoalteromonas sp.}

The present invention relates to a kelp culture medium for isolating specific hospital bacteria living in kelp, and more particularly to a kelp culture medium for isolating kelp from Pseudoalteromonas sp. , Which is a cause of bacterial spot disease in kelp . The present invention also relates to a method for separating hospital bacteria using the same.

As seaweeds can not be distinguished from roots, stems, and leaves as seen in higher plants, nutrients are consumed throughout the plant because of lack of vascular development. Korean people have been using seaweed as a food for a long time and have been paying great attention to the production of seaweed. Currently, seaweed production in Korea is a large-scale fishery resource that accounts for about 25% of the total aquatic production, and is known as a world seaweed producer.

Laminaria, one of the seaweeds, is characterized by its attachments, stems, and foliage. The size is about 2 ~ 3m in length and 25 ~ 30m in width. The middle part of the leaf is formed as a thick middle part, and the middle part has vertical grooves on both sides. The outer part of the major part gradually becomes thinner, and the edge has a large wrinkle like a wave. There is a vertical concave convex pattern on both sides of the middle part of the young kelp, but it disappears as it grows, and lies in the water with the groove side up.

The kelp is distributed in the area where the turbulence and the Korean wave are merged. In Korea, it was originally distributed only in the north of Wonsan. However, since the kelp was introduced in Hokkaido in Japan and the gametophyte was cultivated in the indoor water tank, It can be guessed that it was naturally born. Since ancient times, kelp has been used for edible use in Japan and China, including Korea, and has been regarded as medicinally more important as a source of iodine in China.

On the other hand, bacterial spot disease that occurs in cultured sea tangle is a disease in which the leaves die out due to enlargement of the hole in the affected part due to the hole disease caused by the frosting of the animal.

There are innumerable pores in the flesh of infected kelp and the most common part is the area of 40 ~ 200cm from the base of the folium. In the early stage of infection, pores are formed at the edge of the foliage, and the range is broadened in the middle stage. In the latter stage, the edge of the foliage is corroded, and the remaining major foliage is discolored to yellow and finally the whole foliage is completely discolored and melted at the end .

The microscopic examination of the posterior opening of the hole reveals that it consists of superficial cells (yellowish green cells with a diameter of 10 to 20 μm) inward and outward from the follicle and thread-like cells on the outside of the follicle. Transparent, The cuticle layer protects the internal tissue. However, the perforated follicles have no cuticle layer and the surface cells have been removed as well. When these lesions extend to surrounding tissue and reach the back of the follicle, a hole is drilled.

The period of occurrence of such hole diseases is from July to August, when the salinity is decreased due to the precipitation of spring or summer or the influx of the river water, or when the fishery is aged due to dirt, the sea water temperature in June- Or it is caused by an abnormal phenomenon of seawater salinity or water temperature change such as fluctuations of the spring or summer diary, and may be caused when the growth of the kelp is poor.

Pseudoalteromonas sp. Bacteria of the genus Alteromonas is the causative organism of bacterial disease holes are divided into the genus Alteromonas and Pseudoalteromonas the difference in the base sequence of the 16S rRNA gene was now named as Pseudoalteromonas elyakovii.

The causative organism was gram-negative, aerobic bacillus and had a round shape. The size of the cells was 0.8 ㎛ × 1.8-4 ㎛ when cultured on marine agar and the growth temperature was 10-37 ℃ (optimal 25- 30 ℃) and can not develop at 40 ℃.

In recent years, it has been reported that filamentous decolorization, cell swelling, protoplast destruction and leaf lobe disappear due to infection of Pseudoalteromonas sp. Therefore, in order to complement the investigation and investigation of pathogens, a method is needed to isolate pathogenic bacteria and to isolate pathogenic bacteria from seaweed for analysis of its taxonomic and physiological characteristics.

In Korean Patent Laid-Open Publication No. 10-2001-0086897, the antibody induced by ADP of S. pneumoniae reacts not only with the cell lysate of other bacteria but also with the various microbial strains isolated from the clinical isolates Discloses a method for identifying S. pneumoniae by using an alcohol dehydrogenase (ADH) of pneumococcus which is secreted out of the cells and highly conserved, or an adh gene expressing the protein. Korean Patent Laid-Open Publication No. 10-2010-0128300 discloses that agarase produced by a microorganism has not only excellent salt stability but also microorganisms of the genus Pseudomonas aeruginosa which is a saccharification technology which utilizes the mugwort as a substrate without pretreatment, And the like. Korean Patent Laid-Open Publication No. 10-2004-0007121 discloses that α-1,3-glycosidic bonds of natural polysaccharides such as agar and agarose are specifically (Pseudoalteromons sp. BL-3), a low-molecular-weight? -Agarase produced by the strain, which produces? -Agarase, (Agarooligosacchrodes), which exhibits physiological activities such as antioxidant and apoptosis inducing effects, and enzyme-treated DNA fragments on electrophoresis agarose gels. Molecular-weight alpha-agarase that is secreted by the novel marine microorganism Pseudomonas aeruginosa spiellae-3, which can be utilized for the purpose of extracting and isolating the microorganism. However, the above prior art documents are different from the method capable of specifically separating only Pseudoalteromonas sp. Causative bacteria of bacterial spot disease of kelp, as in the present invention, The badge is also different.

The present invention provides a seaweed broth and a seaweed hospital bacterial isolation method capable of specifically separating only Pseudoalteromonas sp., The cause of bacterial pores.

The present invention provides a method for detecting a causative agent of a bacterial vascular disease by using a tuna starch medium capable of pure culture of Pseudoalteromonas sp.

A method of preparing a seaweed culture medium capable of pure culture of Pseudoalteromonas sp. Of the present invention comprises dissolving seaweed powder and NaCl in 1 L of distilled water, adding agar powder to dissolve the seaweed broth, and dissolving the dissolved solution in an autoclave at 121 ° C For 15 minutes. The sterilization is carried out by cooling the medium to 60 DEG C, and then adding about 25 ml of the solution to petridish, followed by coagulation.

Bacterial isolates from kelp farms using kelp media were prepared by removing the contaminated source from the outside of the kelp leaf by using tap water and 70% alcohol, treating it with sterile seawater at 1: 9 (1 g / 9 ml) After grinding, the mixture is kept at room temperature for 10 minutes. Then, 100 μl of the supernatant is plated on the trituration medium prepared above, and the bacteria are isolated by culturing at 20-25 ° C for 7 days.

The separation method of kelp hospital bacteria using the kelp culture medium of the present invention can be applied to diagnosis of diseases of kelp and diagnosis of hole diseases by the specific separation of Pseudoalteromonas sp.

Figure 1 shows the kelp medium of the present invention.
FIG. 2 is a photograph showing bacterial isolates of kelp hospital using the kelp medium of the present invention.
Fig. 3 shows a hospital bacterium isolated and cultured for different types of media containing the tuna starch of the present invention.

In order to achieve the object of the present invention, the present invention provides a method for preparing a kelp culture medium in which a kelp medium is prepared by dissolving a certain amount of NaCl in a powder and distilled water as an effective constituent of kelp powder, A process for isolating kelp hospital bacteria by culturing the same on a plurality of mediums containing the kelp medium of the present invention, and identifying and identifying bacteria using a specific primer as a cultured sample.

Hereinafter, the method for separating kelp hospital bacteria from kelp culture medium will be described with reference to examples, but the present invention is not limited thereto.

Example 1: Preparation method of tallow solid medium

Figure 1 shows the kelp medium of the present invention. In the process of preparing the kelp solid medium of the present invention, the kelp powder is collected and sorted by collecting and selecting proper tallow material; A washing step of removing the salt and impurities from the selected kelp using natural washing water or an additive at an appropriate temperature; A cutting step of cutting the kelp after the washing step to a proper size of about 1 to 3 cm to increase the surface area of the kelp; Drying the cut kelp at 50-60 < 0 > C for about 3-5 hours; And a grinding process in which the completely dried kelp is grinded at 8 to 9 meshes in a grinder so as to be in the form of a powder.

10-30 g of kelp powder and 10 g of NaCl are added to an Erlenmeyer flask and dissolved in 1 L of distilled water. Then, 15 g of agar powder is added and dissolved. After the solution in which the composition is dissolved is autoclaved at 121 ° C for 15 minutes, the sterilized medium is cooled to 60 ° C, and the solution is mixed with petridish in an amount of about 25 ml.

Example 2: Separation process of kelp hospital bacteria

The kelp disease was tested using the kelp solid medium of the present invention. The kelp samples used to isolate the bacterial pathogens from kelp were collected from April to September 2014 in kelp farms in Wando, Jeonnam, Pusan and Gyeongsangbuk-do, They were quickly transported to the laboratory and used for disease testing.

The disease test was conducted on samples of diseased keratinocytes and dislodged kelp corps which were determined to be infected with bacteria. The classification of the samples was simply classified as 1 ~ 3 samples in appearance, and 4 ~ 5 samples in which microbial pores were detected as infectious disease by bacteria (see Table 1).

Bacteria were removed by removing the contamination source from the outer part of the seaweed by using 70% alcohol and tap water, and then treating with 1: 9 (1g / 9ml) sterilized seawater. 100 μl of the solution was applied to brain heart infusion agar (BHIA), marine agar (MA) and 3% kelp media (DA) containing 0.5% alginate, and cultured at 20-25 ° C for 7 days Bacteria were isolated. It was judged to be positive when more than 50 identical colonies were isolated from the culture medium of the bacteria. FIG. 2 is a photograph showing bacterial isolates of kelp hospital using the kelp medium of the present invention.

In addition, according to the results of preparing the medium by varying the content of the tallow powder in an amount of 10 to 30 g, 1 liter of distilled water (1%) was added to 10 g of the kelp powder and 1 liter of distilled water was added to 20 g of the kelp powder (3%) when 1 L of distilled water was added to 30 g of kelp powder rather than 2% (2%). Accordingly, it is preferable that the sea tangle powder is contained at a ratio of at least 3%.

Example 3. Identification of Bacteria in Kelp Hospital

The bacterium isolated from the culture medium was extracted with boiling method, and the primers used for the polymerase chain reaction based on 16S ribosomal RNA gene of prokaryotes were as follows.

519F: 5'-CAGCMGCCGCGGTAATWC-3 '1094R: CTTAACCCAACATCTCACGA

Polymerase chain reaction (PCR) was performed using the above primers. The reaction conditions were pre-denatured at 94 ° C for 5 minutes, followed by denaturation at 94 ° C for 30 seconds, annealing at 57 ° C for 30 seconds, extension at 72 ° C for 1 minute, and post-extension at 72 ° C for 5 minutes Respectively.

PCR amplification products were identified using 1.5% agarose gel, purified using a gel DNA extration kit, and sequenced using ABI PRISM dye terminator sequencing chemistry. The analyzed nucleotide sequences were identified by blast search of national center for biotechnology infermation (NCBI).

Example 4. Separation test results of kelp hospital bacteria

Fig. 3 shows a hospital bacterium isolated and cultured for different types of media containing the tuna starch of the present invention. Table 1 below shows bacteria isolated according to the conventional commercially available BHIA medium (Brain heart infusion agar), MA medium (marine agar) and Dasima agar of the present invention, respectively. The number of isolated bacteria was measured by colony forming unit.

Number of bacteria separated by culture medium sample
External symptom
Separated bacteria (number of bacteria) BHIA MA DA One Dropout Negative Marine bacterium (130)
Alteromonas sp. (123) Negative 2 Dropout Unidentified bacteria (52) Pseudoalteromonas sp. (70) Pseudoalterromonas sp. (83) 3 Dropout Vibrio sp. (820) Vibrio sp. (960)
Vibrio sp. (720)
Vibrio sp. (80) Pseudoalterromonas sp. (350)
Pseudoalterromonas sp. (248) 4 Borehole hole Vibrio sp. (320) Marine bacterium (1200)
Pseudoalterromonas sp. (640) Pseudoalterromonas sp. (53) 5 Borehole hole Not tested Reinekea sp. (2080)
Pseudoalterromonas sp. (700) Negative

The results of Table 1 show that in the case of the first sample (lesion: loss of lobe), only Marine bacterium (130) and Alteromonas sp. (123) were separated. 2 samples (yeopche eliminated) In this was unidentified bacterium (52) away from the BHIA, was isolated the 70 dogs and 83 respectively Pseudoalteromonas sp. In the MA and DA. Vibrio sp. In BHIA was detected in the third sample (lyophilisation). (820) were isolated, and three different species of Vibrio sp. Were isolated from MA. However, in DA, 350 and 248 isolates of Pseudoalteromonas sp.

In the fourth sample (leaf hole), Vibrio sp. (320) were isolated. In MA, Marine bacterium (1200) and Pseudoalteromonas sp. (640) were separated. However, in DA, Pseudoalteromonas sp. (53) were separated. In the fifth sample (leaf hole), Reinekea sp. (2080) and Pseudoalterromonas sp. (700) were separated.

In the medium-specific BHIA based on the results of the detected strains were Vibrio sp. Is separated, Marine bacterium, Alteromonas sp. In MA, Pseudoalteromonas sp., Vibrio sp ., Reinekea sp. That were isolated, the DA Pseudoalteromonas sp. And the DA medium was Pseudoalteromonas sp. It can be used in diagnosis of diseases.

Since the kelp media of the present invention can be separated by purely culturing Pseudoalteromonas sp., Which is a causative organism of bacterial pore disease occurring in the sea tangle, it is possible to detect the bacterial pore disease early infection of kelp, The system can be applied to the disease diagnosis and forecasting system of bacterial pores to prevent the spread of the disease early.

Claims (7)

Pearl powder, NaCl, agar powder and distilled water. The pseudoalteromonas sp. Lt; RTI ID = 0.0 >
[3] The method according to claim 1, wherein the kelp powder is 10 g or more based on 1 L of distilled water.
Adding 10 to 30 g of kelp powder, 10 g of NaCl and 15 g of agar powder to dissolve by adding 1 L of distilled water,
Sterilizing the dissolved solution in an autoclave at 121 DEG C for 15 minutes,
After cooling, the medium of the sterilizing phase to 60 ℃, only the manufacturing method specifically to remove the culture medium available seaweed Pseudoalteromonas sp. The cause of seaweed hole disease which comprises a step of coagulation put into 25ml volume in petridish
After removing the contamination source adhering to the outside by using tap water and 70% alcohol in the abnormal region of the sea tangle, the seaweed removed from the contaminated source was ground to a ratio of 1 g: 9 ml to the sterile seawater, 100 쨉 l of the tuna broth of claim 1 is cultured at 20-25 캜 for 7 days to isolate only Pseudoalteromonas sp., A causative organism of kelp hole disease, in a specially isolated cultured sea tangle pseudoalteromonas sp. How to diagnose infection delete delete delete

Images