CN116355763B - Symbiotic fungus for oil wheat and spruce and application thereof - Google Patents

Abstract

The application belongs to the technical field of microorganisms, and particularly relates to a symbiotic fungus of oil wheat and spruce and application thereof, wherein the fungus is deposited with the China center for type culture Collection, with a deposit address of China university of Wuhan and a deposit number of CCTCC NO: m2022611, the preservation time is 2022, 05 and 12 days. According to the application, the symbiotic fungi of the oil wheat and the spruce are separated and screened to obtain the fungus YAFEF025 with antibacterial activity, and experiments show that the YAFEF025 mycelium extract has better drug resistance to bacteria such as bacillus cereus, bacillus lentus, vibrio parahaemolyticus, pseudomonas cupurensis and the like, and a new approach is provided for researching and developing new antibacterial drugs.

Description

Symbiotic fungus for oil wheat and spruce and application thereof

Technical Field

The application belongs to the technical field of microorganisms, and particularly relates to a symbiotic fungus of oil wheat and spruce and application thereof.

Background

Endophytic fungi (endophytic fungus) are various fungi that are found in the tissues and organ interiors of healthy plants, forming no significant infection, and are natural components of the plant's micro-ecosystem. Currently, endophytic fungi have been isolated from all studied plants in algae, mosses, ferns, gymnosperms and angiosperms, indicating their widespread presence in plants. The endosymbiont fungi are systematically distributed in the cells or cell gaps of organs and tissues such as roots, stems, leaves, flowers, fruits, seeds and the like of the plants, the distribution situation depends on the host plants and the types of the endosymbiont fungi, the distribution of different organs of the host plants is different, and different endosymbiont fungi occupy different ecological niches. And meanwhile, the system is also influenced by various environmental factors such as geographic positions, climate conditions and the like.

Research shows that in the long-term co-evolution process, symbiotic bacteria and host plants form a special physiological metabolism way to generate various active compounds with novel structures, and a plurality of active symbiotic bacteria are not developed at present, so that the novel antibacterial agent has an important effect on developing novel antibacterial agents, and the crisis brought by drug-resistant strains can be effectively relieved. The primary and secondary metabolites of the endophyte have become research hotspots at present, and the fact proves that the endophyte can participate in the synthesis of plant active ingredients or transform plant secondary metabolites. More than 170 strains of endophytic fungi have been isolated by researchers from the plants T.tricuspidata, T.southern and Torreya, of which approximately 90 strains produce active substances that inhibit and kill one or more plant pathogenic fungi, which are predominantly distributed in Paecilomyces, fusarium, etc.

The Picea japonica is a variety of Picea japonica belonging to genus Picea of Pinaceae, which is a special species in China, and belongs to the national class II important protection of wild plants. The water treatment agent is mainly distributed in northeast of Sichuan and upstream of Min river basin, in Bailong river basin in Gannan region, in southeast of Shanxi, in northwest of Hubei province, in regions such as jersey, bama and the like in Qinghai province, and has high topography and mainly comprises altitudes of 2000-3000 m. The tree species has strong growth adaptability, good material quality, fewer plant diseases and insect pests, higher economic benefit and ecological value, and is the preferred dominant tree species for high-altitude forest update or barren mountain forestation.

Disclosure of Invention

The application provides a symbiotic fungus of oil wheat and spruce and application thereof, and the symbiotic fungus has strong antibacterial activity.

The application is realized by the following technical scheme:

in one aspect, the application provides a symbiotic fungus of the oil wheat and spruce, which has a preservation name of Mucor sp YAFEF025, is preserved in China center for type culture Collection, has a preservation address of China university of Wuhan, and has a preservation number of CCTCC NO: m2022611, the preservation time is 2022, 05 and 12 days.

Further, the oil-wheat spruce symbiotic fungus comprises primers shown as SEQ ID No.1 and SEQ ID No.2, and the ITS gene sequence of the oil-wheat spruce symbiotic fungus is shown as SEQ ID No. 3.

On the other hand, the application also provides application of the oil wheat spruce symbiotic fungi in preparation of antibacterial drugs.

On the other hand, the application also provides a microbial inoculum which comprises the crude mycelium extract and/or cell lysis supernatant and/or cell lysis precipitate of the oil-wheat spruce symbiotic fungi.

Further, the extraction method of the mycelium crude extract comprises the following steps:

(1) Scraping mycelia of the symbiotic bacteria of the bark of the picea oleifera, placing one fourth of mycelia in a culture dish with the specification of 60mm into a 2mL sterilizing centrifuge tube, adding 1mL sterile water, crushing for 2min, taking 500 mu L of crushed sample liquid, respectively inoculating into each 350mL tissue culture bottle filled with a culture medium, placing into a constant temperature incubator at 26 ℃, and culturing for 10d;

the culture medium comprises the following components: walnut dreg 8 g/bottle and liquid culture medium 15 mL/bottle, the liquid culture medium includes: 6g/L of sodium nitrate, 0.52g/L of potassium chloride, 0.52g/L of magnesium sulfate heptahydrate and 1.52g/L of monopotassium phosphate;

(2) And (3) drying mycelia cultured in the tissue culture bottle in a baking oven at 60 ℃ for 7 hours, removing water in a culture medium, adding 100mL of ethanol, carrying out ultrasonic vibration for 40 minutes, standing for 48 hours, separating bacterial liquid by a funnel, condensing, refluxing and drying an extraction solution by a rotary evaporator, and thus obtaining the crude extract of mycelia cultured by the symbiotic bacteria of the bark of the Picea oleifera.

In still another aspect, the application also provides a method for separating the symbiotic fungi of the oil-wheat spruce, which comprises the following steps:

(1) Cleaning the collected bark sample of the oil wheat spruce, washing the bark sample with flowing water for 24 hours, and then transferring the bark sample into a sterile workbench for disinfection;

(2) Sterilizing the surface of the bark with 75% alcohol for 10min in a sterile workbench, washing with sterile water for 5 times, sucking the excess water on the surface of the sterilized bark with sterile filter paper, and airing for later use; cutting bark of Picea oleifera into tissue blocks with length and width of 0.5cm, sterilizing on flame surface of alcohol lamp for 15s, culturing the tissue blocks on antibacterial culture medium, placing 8 tissue blocks on each culture dish, marking the culture dishes, placing the culture dishes in a 26 ℃ incubator, culturing for 10d, and obtaining mycelium;

the antibacterial culture medium comprises the following components: solid PDA medium + ampicillin 50ug/mL + kanamycin 50ug/mL;

(3) Inoculating mycelium into solid PDA culture medium, culturing for 10d, and performing molecular identification to the strain to obtain the Kyoho spruce bark symbiotic fungus.

Further, in step (3), the PDA solid medium comprises the following components: 5g/L potato extract powder, 5g/L yeast powder, 20g/L glucose, 0.5g/L magnesium sulfate heptahydrate, 1g/L potassium dihydrogen phosphate and vitamin B ₁ 0.1g/L and 16g/L of agar.

The beneficial effects of the application are as follows: according to the application, the symbiotic fungi of the oil wheat and the spruce are separated and screened to obtain the fungus YAFEF025 with antibacterial activity, and experiments show that the YAFEF025 mycelium extract has better drug resistance to bacteria such as bacillus cereus, bacillus lentus, vibrio parahaemolyticus, pseudomonas cupurensis and the like, and a new approach is provided for researching and developing new antibacterial drugs.

The strain preservation information of the application is as follows:

strain name: mucor sp YAFEF025;

preservation number: cctccc NO: m2022611;

preservation unit name: china center for type culture Collection;

preservation address: university of chinese armed chinese;

preservation time: 2022, 05, 12.

Drawings

In order to more clearly illustrate the embodiments of the application or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, it being obvious that the drawings in the following description are only some embodiments of the application, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram showing the growth of hyphae of the symbiotic fungus of the oil wheat and spruce;

FIG. 2 is a graph showing the results of detection of the antibacterial activity of the symbiotic fungi of the oil wheat and spruce, wherein a, b and c represent the results of analysis of the significance difference, a > b > c, and two c represent the significance difference to the same extent;

FIG. 3 is a diagram of mycelia under a fluorescence microscope of the symbiotic fungus of the application, i.e., the oil wheat, spruce and the like;

FIG. 4 is a graph showing the inhibition of the symbiotic fungus of the application against Bacillus cereus, wherein a, b, d represent control groups and c represent experimental groups;

FIG. 5 is a diagram showing the inhibition of the symbiotic fungus of the application against Bacillus lentus, a, b, d representing the control group and c representing the experimental group;

FIG. 6 is a graph showing the inhibition of the symbiotic fungus of the application against Vibrio parahaemolyticus, a, b, d representing the control group and c representing the experimental group;

FIG. 7 is a graph showing the inhibition of the symbiotic fungus of the oil wheat spruce to Pseudomonas cupuresis, wherein a, b and d represent control groups, and c represents experimental groups;

FIG. 8 is a graph showing the inhibition effect of the ultrasonic lysis supernatant of the symbiotic fungal cells of the oil wheat and spruce and the ultrasonic lysis sediment sample of the cells on Pseudomonas cupurensis, wherein a represents a control group, and b and c represent test groups;

FIG. 9 is a display diagram of a phylogenetic tree of the application constructed by the symbiotic fungi of Picea oleracea based on ITS.

Detailed Description

In order to make the objects, technical solutions and advantages of the present application more apparent, the technical solutions of the present application will be described in detail below. It will be apparent that the described embodiments are only some, but not all, embodiments of the application. All other embodiments, based on the examples herein, which are within the scope of the application as defined by the claims, will be within the scope of the application as defined by the claims.

The strain preservation information of the application is as follows:

strain name: mucor sp YAFEF025;

preservation number: cctccc NO: m2022611;

preservation unit name: china center for type culture Collection;

preservation address: university of chinese armed chinese;

preservation time: 2022, 05, 12.

Examples

Isolation and identification of symbiotic fungus strains of oil wheat and spruce

1. Separation of symbiotic fungi of oil wheat and spruce

And (3) cleaning the collected oil wheat spruce bark sample, washing the sample with flowing water for 24 hours, and then transferring the sample into a sterile workbench for disinfection.

Sterilizing the surface of the bark with 75% alcohol for 10min in an ultra-clean workbench, washing with sterile water for 5 times, sucking the excess water on the surface of the sterilized bark with sterile filter paper, and airing for later use; cutting bark of Picea oleifera with high pressure sterilized scissors or dissecting knife into tissue blocks with length and width of 0.5cm, and sterilizing on flame surface of alcohol lamp for 15s; the tissue blocks were placed equidistantly on PDAKAS antibacterial medium (PDAKAS antibacterial medium: potato powder dextrose agar medium + ampicillin 50ug/mL + kanamycin 50 ug/mL) for culture, 8 tissue blocks were placed per dish, the dishes were labeled, and the dishes were placed upside down in a 26℃incubator for culture for about 10d, during which time occasional observations were made.

Transferring the grown mycelium into solid PDA culture medium, culturing for 10d, and performing molecular identification to the strain to obtain the oil wheat spruce bark symbiotic fungus. The strain is shown in figure 1, fungi grow well on a PDA solid culture medium, the colony surface is villous, hyphae grow radially to the periphery in gray, hyphae are denser in the later growth period, the fungus layer is thinner, and the colony is in a regular round shape. The PDA solid culture medium comprises the following components: 5g/L potato soaked powder, 5g/L yeast powder, 20g/L glucose, 0.5g/L magnesium sulfate heptahydrate, 1g/L potassium dihydrogen phosphate and vitamin B ₁ 0.1g/L, and 16g/L of agar.

2. Identification of symbiotic fungi of oil wheat and spruce

(1) Identification of morphology

Fungi grow well on a PDA solid culture medium, the colony surface is villous, hyphae grow radially to the periphery in gray, the hyphae are denser in the later growth period, the fungus layer is thinner, and the colony is in a regular round shape.

(2) DNA extraction

(1) CTAB (cetyltrimethylammonium bromide) was heated in a 65℃water bath for 30min prior to the experiment; (2) taking 50mg of dried oil wheat and spruce symbiotic fungus mycelia in a 2mL centrifuge tube, adding 3 small steel balls, soaking the centrifuge tube in liquid nitrogen for 6min, immediately crushing the centrifuge tube by a crusher for 1.5min, adding 1mL of preheated CTAB solution, sucking and beating the mixture by a pipetting gun, fully transferring the mixture into a centrifuge tube filled with 200 mu LPVP (polyvinylpyrrolidone), suspending and adding 20 mu L of beta-mercaptoethanol in a fume hood, vibrating for 15s to fully grind the mixture, and then placing the mixture into a 65 mu L centrifuge tube ^o C, water bath for 1.5h, turning over 5-6 times every 10min, centrifuging at 4 ℃ for 10min at 12000r/min after water bath is finished; (3) taking 1mL of supernatant into a new centrifuge tube, adding a DNA phenol reagent and chloroform-isoamyl alcohol500 mu L of each mixed solution is turned upside down for 10min, and the mixture is centrifuged (4 ℃ C. 12000 r/min) for 10min (step (3) is repeated twice); (4) taking 900 mu L of supernatant, placing into a new centrifuge tube, adding 50 mu L of 3mol sodium acetate solution and 900 mu L of 95% absolute glacial ethanol (-20 ℃), shaking, and placing into a refrigerator at-20 ℃ for precipitation for 3 hours; (5) centrifuging (4 ℃ C. 12000 r/min) for 10min after precipitation, discarding supernatant, adding 500 μL75% alcohol, turning over up and down for 2-3 times, standing for 3min, and discarding supernatant; (6) adding 500 μL of 95% alcohol, turning over for 2-3 times, standing for 3min, centrifuging at 13000r for 3min, removing ethanol, and standing to dry; (7) 40. Mu.L of elution buffer EB (10 mM Tris-HCl (Ph 7.5)) was added and the mixture was centrifuged at room temperature (13000/min) for 1.5min to give fungal YAFEF025 genomic DNA.

(3) ITS analysis and identification: the sequence of the interval sequence (containing ITS1 region, 5.8S region and ITS4 region) of fungal rDNA is amplified by using a primer ITS1 (5'-CTTGGTCATTTAGAGGAAGTAA-3') shown in SEQ ID No.1 and a primer ITS4 (5'-TCCTCCGCTTATTGATATGC-3') shown in SEQ ID No.2, and the obtained ITS sequencing sequence is shown in SEQ ID No. 3: GTCGGGGTTCCGCCTGATTTAGATCAAATTTAAAAAGAGTATTATTTGGGAGGCCCCAGCACAGTTTACCGCAAGAGCTTCTCTTTATATTAAAAAAAAGTTCAGGCATTTAAACAAGATCAGGCCTTTGTACATTTCAAGAGGTTCGAGATCAGAATAGATCAAGAGACTCTCAGTATTCCTATTCAACAAAATGCTGGATAGAGGGTTTGTTTTGATACTGAAACAGGCGTGCTCATTGGAATACCAATGAGCGCAAGTTGCGTTCAAAGACTCGATGATTCACTGAATATGCAATTCACACTAGTTATCGCACTTTGCTACGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTAAAAGTTGTTTTATAGATTTTTTAGGTCTATGTTACAATATTAATTCTGAATTCTTTTGGTAAATAATAATAGGATACCAAGCCTAAGCTTGACTATGACTCGGTTAACATCCCCACCGCCTATCCTTATAGCAGTGGAGCATCCCTCAAGCGTCAAGTAATAATACAGTTCACAGTAAATAGATAATAATGGACAAGCCAAAATTATTGATTATTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCA.

(4) Construction of developmental trees

The phylogenetic tree of the symbiotic fungus of spruce oil wheat as shown in fig. 9 was constructed using MEGA software based on ITS, and the results of morphological identification of the strain and molecular biological identification were combined, and the fungus was most closely related to Mucor (Mucor sp.), so that the symbiotic fungus strain of spruce oil wheat was identified as Mucor (Mucor sp.).

Extraction of active substances of symbiotic fungi of oil wheat and spruce

1. Solid fermentation culture

Scraping mycelia of the symbiotic bacteria mycelia of the grown oil wheat spruce bark into one fourth of a culture dish with the specification of 60mm, putting the mycelia into a 2mL sterilization centrifuge tube, adding 1mL sterile water, crushing for 2min, taking 500 mu L of crushed sample liquid, respectively inoculating the crushed sample liquid into each tissue culture bottle filled with JRMM culture medium, and culturing in a constant temperature incubator at 26 ℃ for 10d.

2. Culture mycelium extraction

And (3) drying mycelia cultured in the tissue culture bottle in a baking oven at 60 ℃ for 7 hours, removing water in a culture medium, adding 100mL of ethanol, carrying out ultrasonic vibration for 40 minutes, standing for 48 hours, separating bacterial liquid by a funnel, condensing, refluxing and drying an extraction solution by a rotary evaporator, and thus obtaining the crude extract of mycelia cultured by the symbiotic bacteria of the bark of the Picea oleifera.

Test example 1

Antibacterial activity detection of mycelium crude extract of oil wheat and spruce symbiotic fungus culture

1. Activation of pathogenic bacteria

Pathogenic bacteria such as Bacillus cereus, bacillus lentus, vibrio parahaemolyticus, pseudomonas cuprum, etc. purchased from Guangdong province bacteria drug resistance monitoring and quality control center are respectively taken 5 mu L and added into a 2mL centrifuge tube, 750 mu L of LB liquid culture medium (tryptone 10 g/L+sodium chloride 10 g/L+yeast extract 5 g/L) is added, and then the centrifuge tube is put into a centrifuge tube with 37 ℃ and the rotating speed of 180 r.min ^-1 Culturing in a constant temperature shaking table for 12h to obtain pathogenic bacteria liquid, placing in a refrigerator at 4deg.C for use, and taking out activated bacteria for dilution by 1/10 times.

2. Antibiotics for control and formulation

Ampicillin (Ampicillin) (lot number: 0339, purity: 95%) was purchased from Kunming Shuoyang technologies Co. 50mg of ampicillin is precisely weighed, placed in a centrifuge tube respectively, and 1mL of DMSO solution is added to prepare 50mg/mL of antibiotic DMSO solution for later use.

3. Filter paper sheet method for detecting antibacterial activity

Taking 0.01g of crude extract of the symbiotic fungus mycelia of the oil wheat and spruce, adding 500 mu LDMSO (dimethyl sulfoxide) solution into a 2mL centrifuge tube, and diluting to 50mg/mL. Uniformly smearing the activated pathogenic bacteria liquid on LB solid culture medium (tryptone 10 g/L+sodium chloride 10 g/L+agar 15 g/L+yeast extract 5 g/L), airing, sucking the dissolved crude extract of the symbiotic fungus mycelia of the oil-wheat spruce, dipping the crude extract of the symbiotic fungus mycelia of the oil-wheat spruce with a filter paper disc with the diameter of 5mm to serve as an antibacterial activity, putting the antibacterial activity on a corresponding mark of the culture medium, dipping a filter paper disc with the diameter of 5mm to serve as a pure culture medium (the operation steps are the same as those of an experimental group, only serving as a blank control), culturing the culture medium in a constant-temperature incubator with the temperature of 37 ℃ for 12 hours, and observing whether a bacteriostasis ring appears or not and measuring the diameter of the bacteriostasis ring by a crisscross method.

The application screens and obtains the symbiotic fungus of the oil wheat and spruce (Mucor sp.), the test result is shown in figure 2, the mycelium crude extract bacillus cereus, bacillus lentus, vibrio parahaemolyticus, pseudomonas cupurensis and other pathogenic bacteria of the strain culture have better antibacterial activity, and the antibacterial diameters of bacillus cereus, bacillus lentus, vibrio parahaemolyticus and pseudomonas cupurensis are respectively 1.5cm, 1.2cm and 1.8cm.

Test example 2

Ultrasonic pyrolysis supernatant of oil wheat and spruce symbiotic fungus cells and ultrasonic pyrolysis precipitation operation step of cells and antibacterial activity detection

Scraping mycelia in 3 60mm culture dishes from the formed oil-wheat spruce bark symbiotic bacteria mycelia, putting the mycelia into a centrifuge tube, freezing the centrifuge tube by using a vacuum freeze drying agent, adding 100mL of ethanol for leaching, carrying out ultrasonic vibration for 40min, standing for 48h, respectively obtaining supernatant and precipitate, condensing, refluxing and drying by using a rotary evaporator to obtain ultrasonic pyrolysis supernatant of the oil-wheat spruce bark symbiotic bacteria cells and ultrasonic pyrolysis precipitate samples of the cells, and using the samples for antibacterial activity detection. The control is that scraping a fourth of mycelia in a 60mm culture dish from the grown-up oil wheat spruce bark symbiotic bacteria mycelia, putting the mycelia into a 2mL sterilization centrifuge tube, adding 1mL sterile water, crushing for 2min, taking 500 mu L of crushed sample liquid, inoculating the crushed sample liquid into a tissue culture bottle filled with JRMM culture medium, and placing the tissue culture bottle in a constant temperature incubator at 26 ℃ for 10d. And (3) drying mycelia cultured in the tissue culture bottle in a baking oven at 60 ℃ for 7 hours, removing water in a culture medium, adding 100mL of ethanol for leaching, performing ultrasonic vibration for 40 minutes, standing for 48 hours, separating bacterial liquid by a funnel, condensing, refluxing and drying an extraction solution by a rotary evaporator to obtain a crude mycelium extract cultured by the symbiotic bacteria of the bark of the picea oleifera, and performing antibacterial activity detection.

To sum up, FIGS. 4 to 7,a represent pure medium (JRMM medium) as crude extract without inoculating the blank medium of the bacterium; b represents DMSO solution; c represents a crude extract obtained by culturing Mucor sp.YAFEF 025 in JRMM medium; d represents an ampicillin solution. The conclusion that the fungus has antibacterial effect on bacteria was that a, b exclude the possibility of antibacterial effect of culture medium and DMSO, d illustrates the general broad-spectrum antibiotic (ampicillin) that has no antibacterial effect on bacteria used in the present application, and proves the significance of development of antibacterial activity of Mucor sp.YAFEF 025, in FIG. 8, in which a represents crude extract obtained by culturing Mucor sp.YAFEF025 in JRMM culture medium; b. an ultrasonically lysed supernatant sample representative of Mucor sp.YAFEF 025 cells; c. ultrasonic lysis of Mucor sp.YAFEF 025 cells precipitated samples; it was concluded that the ultrasonic lysis of the cells helped release the bacteriostatic active ingredients in the bacteria.

In addition to mycelium extraction by cultured strains, other culture or processing methods, such as ultrasonic lysis of the supernatant of the symbiotic fungal cells of oil wheat spruce; the ultrasonic pyrolysis precipitation of the symbiotic fungus cells of the oil wheat and the spruce, and the processed products or cultures of the symbiotic fungus cells have corresponding antibacterial activity under the antibacterial effect of the fungus, and the preparation of related antibacterial active drugs, bacterial agents and the like by using the fungus are all within the protection scope of the application.

The above description is merely an embodiment of the present application, but the scope of the present application is not limited thereto, and any person skilled in the art can easily think about changes or substitutions within the technical scope of the present application, and it is intended to cover the scope of the present application. Therefore, the protection scope of the present application shall be subject to the protection scope of the claims.

Claims (4)

1. The symbiotic fungus of the oil wheat and the spruce is characterized in that the fungus is preserved under the preservation name of Mucor sp YAFEF025 and is preserved in China center for type culture Collection, the preservation address is China university of Wuhan, and the preservation number is CCTCC NO: m2022611, the preservation time is 2022, 05 and 12 days.

2. Use of the symbiotic fungus of the oil wheat and spruce as claimed in claim 1 for the preparation of antibacterial drugs.

3. A microbial agent comprising the crude mycelium extract and/or cell lysate supernatant and/or cell lysate pellet of the oil-borne spruce fungus of claim 1.

4. A microbial agent according to claim 3, wherein the method of extracting the crude mycelium extract comprises the steps of:

(1) Scraping mycelia of the symbiotic bacteria of the bark of the picea oleifera, placing one fourth of mycelia in a culture dish with the specification of 60mm into a 2mL sterilizing centrifuge tube, adding 1mL sterile water, crushing for 2min, taking 500 mu L of crushed sample liquid, respectively inoculating into each 350mL tissue culture bottle filled with a culture medium, placing into a constant temperature incubator at 26 ℃, and culturing for 10d;

the culture medium comprises the following components: walnut dreg 8 g/bottle and liquid culture medium 15 mL/bottle, the liquid culture medium includes: 6g/L of sodium nitrate, 0.52g/L of potassium chloride, 0.52g/L of magnesium sulfate heptahydrate and 1.52g/L of monopotassium phosphate;

(2) And (3) drying mycelia cultured in the tissue culture bottle in a baking oven at 60 ℃ for 7 hours, removing water in a culture medium, adding 100mL of ethanol, carrying out ultrasonic vibration for 40 minutes, standing for 48 hours, separating bacterial liquid by a funnel, condensing, refluxing and drying an extraction solution by a rotary evaporator, and thus obtaining the crude extract of mycelia cultured by the symbiotic bacteria of the bark of the Picea oleifera.