KR101502680B1 - Peptide for diagnosing granulosa-cell tumors of the ovary and uses thereof - Google Patents

Abstract

The present invention relates to peptides for the diagnosis of ovarian granular tumor cells and their use, and more specifically, to peptides comprising the amino acid sequence of SEQ ID NO: 21 and specifically to the phosphorylation of FOXL2 serine 33 residue to thereby diagnose ovarian granular tumor cells To compositions and kits using such peptides. The peptide consisting of the amino acid sequence of SEQ ID NO: 21 according to the present invention and the antibody specifically binding thereto can specifically bind serine, which is the 33rd amino acid of phosphorylated FOXL2, and are useful for diagnosis of ovarian granular tumor cells It is expected to be available.

Description

PEPTIDE FOR DIAGNOSING GRANULOSA-CELL TUMORS OF THE OVARY AND USES THEREOF BACKGROUND OF THE INVENTION 1. Field of the Invention < RTI ID = 0.0 >

The present invention relates to peptides for the diagnosis of ovarian granular tumor cells and their use, and more specifically, to peptides comprising the amino acid sequence of SEQ ID NO: 21 and specifically to the phosphorylation of FOXL2 serine 33 residue to thereby diagnose ovarian granular tumor cells Diagnostic compositions, and kits using the peptides that can be used in the methods of the present invention.

FOXL2 is known as a winged-helix / forkhead (FH) domain transcription factor, and various studies are currently being conducted on FOXL2. In 2010, the European Molecular Biology Research Institute (Molecular Biology Research) published a report in a prominent scientific journal, Cell, which reported a study that overcame the scientific fact that sex is determined solely by the XY chromosome. The researchers found that the female ovary of a female mouse knockout mouse, FOXL2 gene, changed into a testis-like tissue and secreted testosterone, a male hormone. In this process, ovarian granule cells Was gradually changed into a setori cell involved in sperm maturation.

FOXL2 mRNA was expressed in both the ovaries of immature and adult ovaries, and the expression of FOXL2 mRNA was expressed in the ovaries of immature and adult mice. Especially, the expression of FOXL2 mRNA in undifferentiated FOXL2 has been reported to be a factor regulating the growth of follicles by confirming that it is expressed specifically in granulosa cells.

On the other hand, there is a well-developed disease in the 20s, including ovarian granulosa cell tumor (GCT) and theca cell tumor. Ovarian granulosa cell tumors produce estrogen, There are symptoms such as menstrual irregularities and postmenopausal vaginal bleeding. Three-fourths of granulosa cell tumors belong to stage, tumor growth rate is slow and recurrence is very late, so disease-free period is more than 10 years. For treatment, there are hysterectomy or bilateral salpingo-oophorectomy. Early diagnosis of ovarian granulomatous tumor cells is very important because these ovarian granular tumor cells are less than 5% of all ovarian cancer, but more than 90% of patients are diagnosed and treated before 20s.

In this regard, a study published in the New England Journal of Medicine in June 2009 found that point mutation (402C-> 2) was found in a gene called FOXL2 in 97% of adult-type GCT patients through whole-transcriptome paired- G) were reported. It is only known that a single, recurrent somatic mutation (402C- > G) of FOXL2 can be judged as a potential mediator in the pathogenesis of adult GCT (see US Patent Publication No. US2011 / 0195070), ovarian granuloma cell There is no known specific mechanism for development and a composition or kit for diagnosing ovarian granular tumor cells using the mechanism.

Disclosure of Invention Technical Problem [8] The present invention provides a peptide comprising the amino acid sequence of SEQ ID NO: 21 in order to solve the above problems in the prior art.

It is another object of the present invention to provide an antibody or an antigen-binding fragment thereof that specifically binds to the peptide.

It is still another object of the present invention to provide a composition for diagnosing ovarian granular cell tumor disease comprising the above antibody or antigen-binding fragment thereof.

It is still another object of the present invention to provide a kit for diagnosing ovarian granulocyte tumor disease comprising the above antibody or antigen-binding fragment thereof.

It is another object of the present invention to provide a method for providing information for diagnosing ovarian granulosa cell tumor disease using the antibody or antigen-binding fragment thereof.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

The present invention provides a peptide comprising the amino acid sequence of SEQ ID NO: 21.

The present invention also provides an antibody or an antigen-binding fragment thereof that specifically binds to a peptide consisting of the amino acid sequence of SEQ ID NO: 21.

In one embodiment of the present invention, the antibody or antigen-binding fragment thereof is characterized by specifically binding serine, the 33rd amino acid of phosphorylated FOXL2.

The present invention also provides a composition for diagnosing ovarian granular cell tumor diseases comprising the above antibody or antigen-binding fragment thereof.

Furthermore, the present invention provides a kit for diagnosing ovarian granulocyte tumor disease comprising the antibody or an antigen-binding fragment thereof.

In addition, the present invention provides a method for providing information for diagnosis of ovarian granulosa cell tumor disease using the antibody or antigen-binding fragment thereof.

The peptide consisting of the amino acid sequence of SEQ ID NO: 21 according to the present invention and the antibody specifically binding thereto can specifically bind serine, which is the 33rd amino acid of phosphorylated FOXL2, and are useful for diagnosis of ovarian granular tumor cells It is expected to be available.

Brief Description of the Drawings Fig. 1 is a diagram showing the results of the nucleotide sequence conservation analysis of the S33 residue between non-mammalian mammal and FOXL2 mammal.
FIG. 2 is a graph showing the results of the protein stability test according to FOXL2 S33 phosphorylation. FIG.
FIG. 3 is a graph showing the results of confirming the ubiquitination and humidification patterns involved in FOXL2 protein stability. FIG.
FIG. 4 is a graph showing the results of a residue confirmation experiment related to ubiquitination of FOXL2. FIG.
FIG. 5 is a graph showing the result of confirming the ubiquitination and water-wise patterning by FOXL2 S33 phosphorylation. FIG.
Figure 6 is a diagram showing the ubiquitination and humoral mechanisms following FOXL2 S33 phosphorylation.
7 is a graph showing the results of confirming the degree of S33 phosphorylation of FOXL2 C134W (GCT).
FIG. 8 is a graph showing the results of confirming the direct phosphorylation-related relationship between FOXL2 C134W and S33 residues.
9 is a diagram showing a domain mapping process for producing FOXL2 S33 phosphorylation-specific antibody.
FIG. 10 shows the results of confirming the specificity of the FOXL2 S33 phosphorylation-specific antibody. FIG.
Figure 11 shows the purification procedure for the specificity of the FOXL2 S33 phosphorylation specific antibody.
FIG. 12 is a graph showing the results of confirming the degree of FOXL2 S33 phosphorylation-FOXL2 phosphorylation by immunohistochemistry in GCT patient tissue samples. FIG.

FOXL2 is a transcription factor with the forkhead (FH) domain and has various effects on biological processes such as developmental process from gonads, regulation of cell cycle as well as metabolism. In the ovaries lacking FOXL2, the differentiation of ovarian granule cells was abnormally regulated, and the C134W mutation among FOXL2 mutants was reported to be present in 97% of ovarian granular tumor cells.

We confirmed the phosphorylation of the FOXL2 serine 33 residue through posttranslational modification analysis of the FOXL2 protein and confirmed the ubiquitination and humidification mechanism following the FOXL2 S33 phosphorylation. Based on this, Thereby completing the invention.

That is, according to one embodiment of the present invention, phosphorylation affects the stability of FOXL2 (see Example 4). When S33 is phosphorylated, K25 ubiquitination is increased, K36 is decreased, and when S33 is non- It was confirmed that humification was increased and K25 ubiquitination was reduced (see Example 5).

In addition, according to one embodiment of the present invention, when overexpression of the FOXL2 C134W mutation reported to have been found in 97% of GCT patients, it was confirmed that the degree of S33 residue phosphorylation was more phosphorylated than WT (wild type) Phosphorylation of the FOXL2 C134W mutation was also found to be directly related to the S33 residue (see Example 6)

The present inventors produced a peptide sequence which was phosphorylated on the FOXL2 S33 residue to prepare FOXL2 S33 specific antibody. Thus, the present invention provides a peptide comprising the amino acid sequence of SEQ ID NO: 21.

The present invention also provides an antibody or an antigen-binding fragment thereof that specifically binds to a peptide consisting of the amino acid sequence of SEQ ID NO: 21.

"Antibody" in the present invention means a specific protein molecule directed against an antigenic site. For purposes of the present invention, an antibody refers to an antibody that specifically binds to an antibody that specifically binds to a peptide consisting of the amino acid sequence of SEQ ID NO: 21, that is, serine, which is the 33rd amino acid of phosphorylated FOXL2, A polyclonal antibody, a monoclonal antibody, and a recombinant antibody.

A polyclonal antibody can be produced by a method well known in the art for obtaining an antibody-containing serum by injecting an animal with a peptide antigen consisting of the amino acid sequence of SEQ ID NO: 21 as described above and collecting blood from the animal. Such polyclonal antibodies can be prepared from any animal species host, such as goats, rabbits, sheep, monkeys, horses, pigs, small dogs, and the like.

Monoclonal antibodies may be obtained from the hybridoma method (see Kohler and Milstein (1976) European Jounal of Immunology 6: 511-519), or the phage antibody library (Clackson et al, Nature, 352: 624 222, 58, 1-597, 1991) techniques, but are not limited thereto. In addition, the antibody prepared by the above method is preferably isolated and purified by methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography and the like, but the method is not limited thereto.

In accordance with one embodiment of the present invention, the immunity of the antibody or antigen-binding fragment thereof of the present invention was confirmed to be strong (see Example 7), and the stronger staining intensity was confirmed in the GCT tissue with C134W mutation (Example 8 ), It was confirmed that the antibody of the present invention or an antigen-binding fragment thereof is an antibody specifically binding to ovarian granular tumor cells.

The present invention also provides a composition for diagnosing ovarian granuloma tumor cells comprising an antibody or an antigen-binding fragment thereof that specifically binds to the peptide. Herein, the term "diagnosis" in the present invention means to confirm existence or characteristic of a pathological condition. For purposes of the present invention, the diagnosis is to identify the presence or characteristic of ovarian granular tumor cells.

Furthermore, the present invention provides an ovarian granuloma tumor cell diagnostic kit comprising an antibody or an antigen-binding fragment thereof that specifically binds to the peptide. Preferably, the ovarian granuloma tumor cell diagnostic kit may further comprise one or more other component compositions, solutions or devices suitable for the assay method.

In addition, the present invention provides a method for providing information for diagnosis of ovarian granulosa cell tumor disease. More specifically, the method may comprise contacting the antibody or antigen-binding fragment thereof that specifically binds to the peptide with a sample, such as tissue or blood, collected from a patient with ovarian granulocyte tumor disease.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example 1. Experimental preparation

1-1. FOXL2  Mutation Cloning

In order to clone various FOXL2 mutants, recombinant PCR was carried out using the primers shown in Table 1 below. The amplified PCR products were ligated to pCMV-Myc vector using EcoRl and Xhol restriction enzymes, Respectively. On the other hand, the FOXL2 C134W + S33A mutation was cloned using the C134W mutation as the template and the S33A forward and reverse primers.

Mutation type Forward primer (5 '- >3')
Reverse primer (5 'to 3') FOXL2 SEQ ID NO: 1 CTAGAATTCAAATGATGGCCAGCTACCCC SEQ ID NO: 2 CTACTCGAGTCAGAGATCGAGGCGCGAATG S33A SEQ ID NO: 3 CCGGCCCCAGGCAAGGGCGGTGGGGGT SEQ ID NO: 4 ACCCCCACCGCCCTTGCCTGGGGCCGG S33D SEQ ID NO: 5 CCGCCGGATCCAGGCAAGGGCGGT SEQ ID NO: 6 ACCGCCCTTGCCTGGATCCGGCGG S263A SEQ ID NO: 7 CAGGCCATGGCGCTGCCCCCCGGC SEQ ID NO: 8 GCCGGGGGGCAGCGCCATGGCCTG K25R SEQ ID NO: 9 GGTCGCACAGTCAGAGAGCCAGAA SEQ ID NO: 10 TTCTGGCTCTCTGACTGTGCGACC K36R SEQ ID NO: 11 CCAGGCAGAGGCGGTGGGGGTGGC SEQ ID NO: 12 GCCACCCCCACCGCCTCTGCCTGG K48R SEQ ID NO: 13 GCCCCGGAGAGACCGGACCCG SEQ ID NO: 14 CGGGTCCGGTCTCTCCGGGGC K54R SEQ ID NO: 15 CCGGACCCGGCGCAGAGACCC SEQ ID NO: 16 GGGTCTCTGCGCCGGGTCCGG K87R SEQ ID NO: 17 ATCATCGCGAGATTCCCGTTC SEQ ID NO: 18 GAACGGGAATCTCGCGATGAT C134W SEQ ID NO: 19 GCCTGGGAAGACATGTTCGA SEQ ID NO: 20 ATGTCTTCCCAGGCCGGGTC

1-2. Cell culture

Human granulosa cells (KGN) were cultured in DMEM / F12 media containing 10% FBS and 1% penicillin-streptomycin for the experiments of this Example. KGN cells were obtained from Yosihiro Nishi and Toshihiko Yanase.

1-3. Cell line ( cell line Production

To construct a clone in which FOXL2 stably expresses in cells, constructs of FOXL2 WT (wile type), S33D, S33A and C134W were cloned into pcDNA6 plasmid using EcoRI and XhoI restriction enzymes. Then, 10 μg of DNA was transfected into 1 × 10 ⁷ KGN cells and screened with blasticidin for 3 to 4 weeks.

1-4. For protein overexpression in cells Transfection

In order to overexpress the plasmid introduced into the cell, 3 μg of the plasmid to be introduced per 1 × 10 ^{6 of} KGN cells was introduced. To this introduction, a Neon electrotransfection kit (Invitro transfection kit) was transfected.

Example 2. Experimental Method

2-1. Western blotting

The cultured cells were collected and proteins were extracted from the cells using NP-40 (Nonidet P-40) solution. Bicinchoninic acid (BCA) protein assay was performed to quantify the extracted protein. The quantified protein was electrophoresed using SDS-PAGE and transferred to a polyvinylidene fluoride (PVDF) membrane. Each antibody was then incubated with each antibody. The secondary antibody was then identified using a ChemDoc machine.

2-2. Immunoprecipitation method

Cells were sampled and lysed in NP-40 lysis buffer to quantify the amount of protein. Then, the antibody of the specific protein to be precipitated and the normal IgG of the control antibody were independently cultured and then incubated with the proteinase agrose G binding to the antibody. The cultured samples and beads were washed three times with NP-40 buffer, and the sample was loaded using the Western blotting method, and the band was confirmed with an antibody of another protein to be bound.

2-3. Ubiqutination SUMOrylation method

The overexpressed samples were treated with 50 [mu] M of the proteasome inhibitor MG132, and the proteins were sampled with NP-40 buffer. Then, overexpressed proteins were precipitated using immunoprecipitation method, and samples were loaded using Western blotting method, followed by incubation with Ubiqutine antibody and SUMO antibody, and the band was confirmed with a chemdoc machine.

2-4. Statistical analysis

Each experiment was repeated three times with triplicate to calculate the mean value and standard error. Statistical analysis was performed using Student's t-test using SAS statistical software (SAS Enterprise Guide, USA) and interpreted as having significance at p <0.05.

Example 3. Phosphorylation analysis of FOXL2 protein

Analysis of the posttranslational modification of the FOXL2 protein using liquid chromatography confirmed the phosphorylation of serine, the 33rd anion of FOXL2.

In order to confirm the importance of the FOXL2 serine 33 (S33) residue in the evolution, sequencing sequence analysis of FOXL2 species was carried out, and the results are shown in FIG.

As shown in Fig. 1, 33 residues of serine in the mammal were found to be conservatively located.

Example 4. Protein stability experiment

To determine whether FOXL2 S33 residue phosphorylation affects the stability of the FOXL2 protein, experiments were performed as follows.

 The S33A protein and the S33D protein, which are non-phosphorylation mutations of FOXL2, were overexpressed using the transfection method of Example 1-4 and treated with 10 μg of a protein synthesis inhibitor, cyclohexamide, at 0, 6, 12 , The sample was sampled every 24 hours, and the western blotting of Example 2-1 was performed. The results are shown in Fig.

As shown in Fig. 2, it was confirmed that the non-phosphorylation mutation increased the protein stability and the hyperphosphorylation mutation decreased the protein stability.

From the above results, it was found that the phosphorylation affects the stability of FOXL2.

Example 5. Ubiquitination and SUMOrylation [

5-1. Identification of ubiquitinization and embryogenesis involved in protein stability

The ubiquitination and humoral aspects involved in the stability of the FOXL2 protein were confirmed by Western blotting of Example 2-1 and immunoprecipitation of Example 2-2, and the results are shown in FIG.

As shown in FIG. 3, the non-phosphorylation mutation due to FOXL2 phosphorylation decreases the ubiquitination of FOXL2, increases the degree of immobilization to increase protein stability, and the hyperphosphorylation mutant S33D increases the ubiquitination and decreases the protein stability I could.

From the above results, it can be seen that as the ubiquitination increases, the protein degradation increases and the protein stability decreases.

5-2. FOXL2 S33 Residue  Phosphorylated Ubiquitination  And Humiliation  Confirm

The following experiment was conducted to examine the correlation between ubiquitination and humidification, which is controlled by phosphorylation, as well as confirming residues involved in ubiquitination and humoralization involved in phosphorylation of the S33 residue of FOXL2.

That is, K mutants (K25, K36, K48, K54 and K87), which are residues involved in ubiquitination and humification, were prepared (see Example 1), and overexpression of MDM2 E3 ligase involved in FOXL2 ubiquitination The amount was measured using the Western blotting method of Example 2-1, and the results are shown in FIG.

As shown in Fig. 4, it was confirmed that there was no difference in the amount of protein in the mutation of the K25 residue.

From the above results, it was found that the K25 residue directly decreased the protein stability in association with the ubiquitination of the FOXL2 protein.

In addition, the Ubiqutination SUMOrylation method of Example 2-3 was performed to confirm whether the K25 residue was directly ubiquitinated when the FOXL S33 residue was phosphorylated and the K36 residue was directly dehydrated when the FOXL2 S33 residue was non-phosphorylated, The results are shown in Fig.

As shown in FIG. 5, when the mutation of K25 occurs, it does not become ubiquitous, and it can be confirmed that when the mutation of the K36 residue occurs, the mutation does not occur.

From the above results, it can be seen that when S33 is phosphorylated, K25 ubiquitination is increased, K36 is decreased, and when S33 is non-phosphorylated, K36 is increased and K25 ubiquitination is decreased. The phosphorylation of FOXL2 S33 residue leads to ubiquitination The mechanism is shown in Fig.

Example 6. Determination of the degree of phosphorylation in ovarian granular tumor cells (GCT)

To investigate the relationship between the FOXL2-induced disease and phosphorylation of the S33 residue of FOXL2, the following experiment was conducted.

That is, the mutations of FOXL2 produced in Example 1 were overexpressed, and the degree of phosphorylation of the FOXL2 S33 residue was confirmed using the Western blotting method of Example 2-1, and the results are shown in FIG.

As shown in FIG. 7, when overexpression of the C134W mutation reported recently in 97% of GCT patients, the S33 residue phosphorylation degree was more phosphorylated than WT (wild type).

In addition, in order to examine the phosphorylation relationship between the FOXL2 C134W mutation and the S33 residue, the ubiquitination and humidification patterns were confirmed by the same method as in Example 5, and the results are shown in FIG.

As shown in FIG. 8, it was confirmed that the mutation of FOXL2 C134W increased the ubiquitination and the decrease in the degree of immobilization. However, such changes were not confirmed in samples with S33A mutation in C134W.

From the above results, it was found that the hyperphosphorylation of the FOXL2 C134W mutation was directly related to the S33 residue.

Example  7. FOXL2 S33  Production and purification of phosphorylated antibodies

7-1. FOXL2 S33  Phosphorylation-specific Peptides  synthesis

To prepare the FOXL2 S33 specific antibody, a peptide sequence having been phosphorylated on the FOXL2 S33 residue was prepared, and the specific production process of the peptide was schematically shown in FIG. For the control, S33 antibody was used.

The FOXL2 S33 residue peptide mapped according to FIG. 9 has the amino acid sequence of NH2-PEGPPPS (phospsorylation) PGKG-COOH (SEQ ID NO: 21).

Also, for more accurate purification, the FOXL2 residue peptide mapped according to FIG. 9 had the amino acid sequence of NH2-PEGPPPSPGKG-COOH (SEQ ID NO: 22) and was used for antibody purification of Example 7-3 described below.

7-2. FOXL2 S33  Production of phosphorylation-specific antibody

An antibody was prepared by injecting 5 mg of the peptide consisting of the amino acid sequence of SEQ ID NO: 21 synthesized in Example 7-1 into Rabbit (R1, R2) by induction of the antigen antibody reaction. Antibodies were prepared according to the antibody production protocol, and serum was obtained from each rabbit to confirm the immunoreactivity of each antibody. The results are shown in FIG.

As shown in FIG. 10, it was confirmed that the immunity of the FOXL2 S33 phosphorylated antibody was stronger, and it was confirmed from the above results that an accurate antibody was produced.

7-3. Antibody purification

Since the antibody produced by Example 7-2 is inferior in specificity due to polyclonal antibody, the antibody prepared in Example 7-2 was purified in order to increase such specificity. Respectively. Namely, Proteinase A agarose beads were used in the prepared serum to remove non-specific bead binding. A proteinase A agarose bead affinity column was prepared using a peptide consisting of the amino acid sequence of SEQ ID NO: 22, followed by purification of non-phospho peptide flow through. After purification, only specific FOXL2 specific antibodies were purified and the proteinase A agarose bead affinity column of the peptide consisting of the amino acid sequence of SEQ ID NO: 21 was prepared and the phospho peptide flow through was purified. Only the specific S33 phospho-FOXL2 specific antibody was purified through the purification process.

Example  8. Ovarian Granule Tumor Cells (GCT)  Immunohistochemical analysis

GCT and other ovarian cancer tissues were sampled from Bundang CHA and Catholic University of Daegu and immunohistochemically stained with FOXL2 S33 antibody.

More specifically, the colon tissue was fixed with formalin, and the preserved tissue embedded in paraffin was used as a tissue specimen to make a 5 μm thick continuous section, and the section was used for immunohistochemical staining. Immunohistochemical staining was performed by filling the Coplin container with the diluted antigenic determinant recovery solution, placing it in a thermostatic chamber, covering the lid, and preliminarily heating the mixture at 95 to 99 ° C for 40 minutes. The slide was removed and incubated at room temperature for 20 minutes and then incubated with peroxidase-blocking reagent and buffer for 5 minutes. After washing, the FOXL2 S33 phosphorylation-specific antibody prepared in Example 7 and the FOXL2 WT-specific antibody were incubated for 30 minutes as a control, and antibody-specific immunohistochemical staining was performed using DAKO staining reagent kit. The sections were then photographed with an Olympus CKX41 microscope and the results are shown in FIG.

As shown in Fig. 12, stronger staining intensity could be confirmed in GCT tissue with C134W mutation.

From the above results, it was found that the FOXL2 S33 phosphorylation-specific antibody according to the present invention or an antigen-binding fragment thereof specifically binds to ovarian granular tumor cells, and thus it is excellent in diagnosing ovarian granulosa cell tumors.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation          CATHOLIC UNIVERSITY OF DAEGU INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> PEPTIDE FOR DIAGNOSING GRANULOSA-CELL TUMORS OF THE OVARY AND          USES THEREOF <130> PB13-11198 <160> 22 <170> Kopatentin 2.0 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 primer F1 <400> 1 ctagaattca aatgatggcc agctacccc 29 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 primer R1 <400> 2 ctactcgagt cagagatcga ggcgcgaatg 30 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 S33A primer F1 <400> 3 ccggccccag gcaagggcgg tgggggt 27 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > FOXL2 S33A primer R1 <400> 4 acccccaccg cccttgcctg gggccgg 27 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 S33D primer F1 <400> 5 ccgccggatc caggcaaggg cggt 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 S33D primer R1 <400> 6 accgcccttg cctggatccg gcgg 24 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 S263A primer F1 <400> 7 caggccatgg cgctgccccc cggc 24 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 S263A primer R1 <400> 8 gccggggggc agcgccatgg cctg 24 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 K25R primer F1 <400> 9 ggtcgcacag tcagagagcc agaa 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 K25R primer R1 <400> 10 ttctggctct ctgactgtgc gacc 24 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 K36R primer F1 <400> 11 ccaggcagag gcggtggggg tggc 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 K36R primer R1 <400> 12 gccaccccca ccgcctctgc ctgg 24 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 K48R primer F1 <400> 13 gccccggaga gaccggaccc g 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 K48R primer R1 <400> 14 cgggtccggt ctctccgggg c 21 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 K54R primer F1 <400> 15 ccggacccgg cgcagagacc c 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 K54R primer R1 <400> 16 gggtctctgc gccgggtccg g 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 K87R primer F1 <400> 17 atcatcgcga gattcccgtt c 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 K87R primer R1 <400> 18 gaacgggaat ctcgcgatga t 21 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 C134W primer F1 <400> 19 gcctgggaag acatgttcga 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FOXL2 C134W primer R1 <400> 20 atgtcttccc aggccgggtc 20 <210> 21 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> FOXL2 S33 phospho peptide <220> <221> MOD_RES <222> (7) <223> PHOSPHORYLATION, <400> 21 Pro Glu Gly Pro Pro Pro Ser Pro Gly Lys Gly   1 5 10 <210> 22 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> FOXL2 S33 non-phospho peptide <400> 22 Pro Glu Gly Pro Pro Pro Ser Pro Gly Lys Gly   1 5 10

Claims (6)

delete A composition for diagnosing ovarian granulocyte tumor disease comprising an antibody or an antigen-binding fragment thereof specifically binding to a peptide consisting of the amino acid sequence of SEQ ID NO: 21 and specifically recognizing a phosphorylated serine residue in the amino acid sequence of SEQ ID NO: .
3. The composition of claim 2, wherein the phosphorylated serine residue in the amino acid sequence of SEQ ID NO: 21 is serine, the 33rd amino acid of phosphorylated FOXL2 (forkhead box L2).
delete A kit for diagnosing ovarian granulocyte tumor disease comprising an antibody or an antigen-binding fragment thereof, which specifically binds to a peptide consisting of the amino acid sequence of SEQ ID NO: 21 and specifically recognizes a phosphorylated serine residue in the amino acid sequence of SEQ ID NO: .
A method for providing information for diagnosis of ovarian granulocyte tumor disease,
An antibody or an antigen-binding fragment thereof, which specifically binds to a peptide consisting of the amino acid sequence of SEQ ID NO: 21 and specifically recognizes a phosphorylated serine residue in the amino acid sequence of SEQ ID NO: 21 .

Images