KR101459817B1 - A novel Cytochrome P450 hydroxylase and process for preparing hydroxylated Cyclosporin A employing the same - Google Patents

Abstract

The present invention relates to a novel cytochrome P450 hydroxylase (CYP) derived from Sebecia bennyone, a polynucleotide encoding said CYP, an expression vector comprising said polynucleotide, A method for producing the CYP using the transformant, an expression vector comprising the polynucleotide encoding the CYP and the electron transfer enzyme, the polynucleotide encoding the CYP and the electron transferase (Γ-hydroxy) -CyA is produced by using a transformant into which an expression vector for CYP and an expression vector containing the polynucleotide encoding an electron transfer enzyme is introduced . Using the method of producing the hydroxylated cyclosporin A of the present invention, 4- (γ-hydroxy) -CyA can be produced at a higher efficiency than the conventional method, and thus it can be widely used for the development and production of various hair growth agents.

Description

A novel cytochrome P450 hydroxylase and a method for producing the hydroxylated cyclosporin A using the cytochrome P450 hydroxylase and a process for preparing the hydroxylated cyclosporin A,

The present invention relates to a novel cytochrome P450 hydroxylase, and a process for producing the hydroxylated cyclosporin A using the cytochrome P450 hydroxylase. More particularly, the present invention relates to a novel cytochrome P450 hydroxylase derived from Sebecia bennyana ), A polynucleotide encoding the CYP, an expression vector containing the polynucleotide, a transformant into which the expression vector has been introduced, a method of producing the CYP using the transformant, a method of producing the CYP and an electron transfer enzyme A transformant into which an expression vector containing each of the polynucleotides encoding the CYP and the electronic transcription enzyme is introduced, and a polynucleotide encoding a polynucleotide encoding the CYP and the electron transfer enzyme (Γ-hydroxy) -Cy A < / RTI >

The human hair has about 100,000 to 150,000 hairs, and each hair has a different cycle and grows through anagen, catagen, and telogen. This cycle repeats over 3 to 6 years, resulting in an average of 50 to 100 hairs per day dropping normally. In general, alopecia refers to the increase in the number of abnormal hair loss due to shortening of hair growth rate in the growing period and increasing number of hair in the retrogressive or resting period among these cycles.

The causes of hair loss have been discussed, such as poor blood circulation, hyperhidrosis, excessive secretion of sebum, peroxidation, hypofunction of the scalp, genetic factors, aging, and stress. However, the cause of hair loss has not been clarified to date. Recently, the number of people who are suffering from hair loss due to changes in dietary habits and stress due to social environment is increasing, and the age is also lowered. It is increasing.

In the treatment and prevention of such alopecia, the most widely used formulations to date are minoxidil-containing preparations, which are one of two FDA approved hair growth agents to date. Minoxidil was a hypertension remedy developed for the purpose of lowering the blood pressure, but it became a more famous drug as a hair growth drug because of the side effects caused by side effects. Minoxidil is not exactly known before, but it is thought to promote hair growth by supplying nutrients to hair follicles by increasing blood flow through vasodilating effect.

In addition, finasteride, a major component of Merck's Propecia, which has recently been launched, inhibits the conversion of male hormone testosterone to the more potent male hormone dihydrotestosterone. In December 1997, a 1 mg tablet was approved by the FDA for the treatment of male alopecia, and it is currently on the market and has been shown to have significant effects on clinical results, but some male function inhibitory adverse effects have also been reported (J. Am. Acad. Dermatol ., 1998; 39; 578-589). However, this drug is not as excellent as minoxidil, and clinical research is actively pursued for better hair growth due to concerns about side effects.

On the other hand, cyclosporins are a typical immunosuppressive agent and have various physiological effects such as renal toxicity, hepatotoxicity, hypertension, periodontal hypertrophy, and hair growth effect due to the effect of inhibiting viruses, fungi and protozoans and side effects (Advances in Pharmacol., 1996 ; 35: 114-246 and Drug Safety, 1994; 10: 310-317). Cyclosporin A (CyA) is a cyclic oligopeptide of cyclosporin A (CyA). It is a powerful immunosuppressive agent for treating the rejection of organ transplant patients. It has the potential to cause kidney toxicity, liver toxicity, hypertension, Hypertrophy, and hair growth effects. CyA is the most abundant of the 24 structurally similar metabolites (cyclosporin A to Z) that are produced when an incomplete fungus, Toypocladium inflatum, is cultured under aerobic conditions. CyA and its analogs are activated by a multifunctional single enzyme called Cyclosporin Synthetase, which in turn activates 11 amino acids, N-methylation, and is a non-ribosomal mechanism to form peptide bonds. do.

Among the various side effects of CyA, the possibility of development as a hair growth agent using the side effect of hair growth over a long period of time has been performed by various studies. Among them, extensive studies have been carried out on animal hair growth experiments, human alopecia areata, human male alopecia, and alopecia suppression effects in hairless animals by chemotherapy. Respectively.

CyA is converted to various derivatives by bioconversion by various bacteria and fungi. (Γ-hydroxy) -CyA, 4- (γ-hydroxy) -4-N-demethyl-CyA in the form of a hydroxyl group added at position 4 by Sebekia benihana , a rare actinomycete (Γ-hydroxy) -CyA (Korean Patent Laid-Open Publication No. 2004-88593). Among these, 4- (γ-hydroxy) It is known that the inhibitory activity is reduced and the hair growth effect is maintained (Korean Patent No. 316604). Such a reaction is known to be carried out by cytochrome P450 hydroxylase (CYP) and an electron transferase expressed in the above-mentioned strain. The CYP is known to be effective in all kinds of organisms such as plants, bacteria, As a kind of hemoprotein containing expressed heme, iron ions contained in the heme exhibit characteristic absorption at 450 nm when bound to carbon monoxide (CO), and enzymes that catalyze various oxidation reactions in vivo . It is known that five CYPs (CYP501, CYP502, CYP503, CYP504, and CYP506) are expressed in Sebecia bennyana, and the activity of these enzymes is known to be 4- (? -hydroxy) -CyA, but the conversion yield is low and it is difficult to use it industrially.

Under these circumstances, the inventors of the present invention have made extensive efforts to develop a method for improving the hydroxylation efficiency during the biotransformation of CyA by microorganisms, and as a result, they have discovered a novel enzyme protein mediating the hydroxylation of CyA, It was confirmed that the use of the transformant mutated to be expressed together with the enzyme can improve the hydroxyl efficiency of CyA, and the present invention has been completed.

One object of the present invention is to provide a novel cytochrome P450 hydroxylase (CYP) mediating the hydroxylation of CyA.

Another object of the present invention is to provide a polynucleotide encoding said CYP.

It is still another object of the present invention to provide an expression vector comprising the polynucleotide.

It is still another object of the present invention to provide a transformant into which the above expression vector has been introduced.

It is still another object of the present invention to provide a method for producing the CYP using the transformant.

It is still another object of the present invention to provide an expression vector comprising the respective polynucleotides encoding the CYP and the electron transfer enzyme.

It is still another object of the present invention to provide a transformant into which an expression vector containing each polynucleotide encoding the CYP and the electron transfer enzyme is introduced.

Yet another object of the present invention is to provide a method for producing 4- (γ-hydroxy) -CyA by using a transformant into which an expression vector containing each polynucleotide encoding the CYP and the electron transfer enzyme is introduced will be.

In one embodiment of the present invention, the present invention provides a novel cytochrome P450 hydroxylase (CYP) mediating the hydroxylation of cyclosporin A (CyA).

The present inventors have found that CyA can be hydrolyzed from Sebekia benihana , which is a kind of actinomycetes capable of producing a derivative (4- (γ-hydroxy) -CyA) having reduced immunosuppressive activity by hydrolyzing CyA And to clarify novel enzyme proteins. For this purpose, genomic DNA of the strain was analyzed to screen for genes encoding novel CYPs other than the five known CYPs. As a result, a gene expected to encode a total of 16 new CYPs (CYP001 to CYP016) was identified, and a gene coding for CYP involved in the production of 4- (γ-hydroxy) -CyA was screened As a result, it was confirmed that the expression amount of 4- (γ-hydroxy) -CyA was decreased in the S. benihana strain in which CYP008 was deleted, as compared with that of the wild-type strain, and thus CYP008 was found to be capable of hydroxylating CyA Example 1).

The term "Cyclosporin A (CyA)" according to the present invention is a cyclic peptide composed of one amino acid and may exist in various forms depending on the structure of the amino acid, and refers to a compound having the following structure do. The above-mentioned CyA is used as an immunosuppressant for suppressing tissue graft rejection following organ transplantation, and exhibits an activity of promoting hair growth as a side effect. For the purpose of the present invention, CyA is used as a precursor for producing 4- (γ-hydroxy) -CyA, but is not particularly limited thereto.

The term "Cytochrome P450 hydroxylase (CYP)" of the present invention refers to a species of hemoprotein expressed in all species of nature, catalyzes various oxidation reactions, and contains heme, When the iron ion contained in the heme is bonded to carbon monoxide (CO), it exhibits a characteristic absorption of 450 nm and uses various compounds such as polyketide, fatty acid, vitamin, steroid-based antibiotic, etc. as a substrate . For the purpose of the present invention, the CYP is used for carrying out a reaction to hydrolyze CyA, and is not particularly limited. Preferably, it is CYP derived from actinomycetes, more preferably CYP501 , CYP502, CYP503, CYP504, CYP506, or any of the newly selected CYP001 to CYP016 in the present invention, and most preferably a novel CYP008 derived from Sebecia bennyone. Particularly, the novel CYP008 is not particularly limited, but a protein having an amino acid sequence of SEQ ID NO: 1 or having an amino acid sequence having 70% or more, more preferably 80% or more, and more preferably 90% or more homology thereto .

The term "homology" of the present invention means a base sequence or a similar degree of an amino acid sequence of a gene encoding a protein. If the homology is sufficiently high, the expression product of the gene may have the same or similar activity.

In another aspect of the present invention, there is provided a method for producing a polynucleotide comprising the steps of: preparing a polynucleotide encoding CYP008, an expression vector comprising the polynucleotide, a transformant into which the expression vector is introduced to express CYP008, Lt; RTI ID = 0.0 > CYP008 < / RTI >

The polynucleotide encoding the novel CYP provided in the present invention is not particularly limited but may be a polynucleotide derived from Sebecia bennyone strain, preferably a polynucleotide sequence of SEQ ID NO: 2 or a polynucleotide having 70% Or more, more preferably 80% or more, and more preferably 90% or more homology with the nucleotide sequence shown in SEQ ID NO: 2, but is not particularly limited thereto.

The term "expression vector" of the present invention means a DNA product containing a nucleotide sequence of a gene operably linked to a suitable regulatory sequence so as to be capable of expressing the gene of interest in a suitable host. The regulatory sequence includes a promoter capable of initiating transcription, an optional operator sequence for modulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling the termination of transcription and translation, A DNA encoding a peptide, an enhancer sequence, a non-translated region on the 5 'side and a 3' side of a desired gene, a selective marker region, or a replicable unit. The expression vector can be prepared and purified using standard recombinant DNA techniques. The expression vector is not particularly limited as long as it expresses a desired gene in various host cells of prokaryotic and eukaryotic cells and produces a desired protein. However, the expression vector has a promoter that exhibits strong activity, A vector capable of producing a large amount of exogenous protein in a form similar to that of the wild type. Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in their natural or recombinant state. For example, pWE15, M13, λEMBL3, λEMBL4, λFIXII, λDASHII, λZAPII, λgt10, λgt11, Charon4A and Charon21A can be used as the phage vector or cosmid vector, and pDZ vector, pBR system, pUC system , pBluescriptII system, pGEM system, pTZ system, pCL system, pET system and the like can be used. The usable vector is not particularly limited, and known expression vectors can be used. Preferably a pDZ vector or the like can be used. For purposes of the present invention, the expression vector can be used to express CYP008 mediating the hydroxylation of CyA, including, but not limited to, a polynucleotide encoding CYP008.

As used herein, the term "transformant" means a cell in which a vector having a gene encoding at least one target protein is introduced into a host cell to infect the target protein to express the target protein, and all of eukaryotic cells and prokaryotic cells Cells, including, but not limited to, bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium; Yeast cells; Fungal cells such as Pichia pastoris; Insect cells such as Drosophila and Spodoptera Sf9 cells; Animal cells such as CHO, COS, NSO, 293, Bowmanella cells; Or plant cells.

The method for producing CYP008 provided by the present invention comprises the steps of (i) culturing the transformant to obtain a culture; And (ii) recovering CYP008 from the culture.

In another embodiment of the present invention, the present invention provides an expression vector comprising a polynucleotide encoding CYP and an electron transfer enzyme, a transformant into which the expression vector is introduced, (? -Hydroxy) -CyA is produced by using the above method.

In order to confirm whether CYP008, a novel CYP derived from Sebecia benny 1, could mediate the hydroxylation of CyA, the present inventors used a gene coding for two hydroxylases (CTY506 and CYP008) and three sets of electronic transfer enzymes (YJ405, YJ407, YJ409) were prepared by introducing each of the prepared expression vectors into Sebecia bennyone (SEQ ID NO: 2), and the expression vectors (pYJ1621, pYJ1623 and pYJ1625) (Example 3), confirming whether or not the gene encoding the desired hydroxylase and the gene coding for the electron transfer enzyme were normally introduced into these transformants (Examples 4, 5 and 6), and these Each transformant was cultured in a liquid medium or a solid medium. As a result, it was confirmed that 4- (γ-hydroxy) -CyA can be produced at a content as high as 1.1 to 1.8 times higher than that of wild-type Sebecia bennyone It was (Examples 7,8).

The term "electron transfer enzyme " of the present invention refers to an enzyme that provides electrons or hydrogen ions used as driving force through NAD, NADP, etc., which are auxiliaries to enzymes involved in in vivo oxidation or reduction reactions . Typically, it is known that putidaredoxin and putidaredoxin reductase, ferredoxin and ferredoxin reductase, flavodoxin and flavodoxin reductase ) And the like are formed in pairs. For the purposes of the present invention, the above-described electron transfer enzyme is used to supply a hydrogen ion to CYP to provide a driving force for hydrolyzing CyA by CYP.

The expression vector comprising each of the polynucleotides encoding the CYP and the electron transfer enzyme is constructed to include the polynucleotide encoding the CYP and the polynucleotide encoding the electron transfer enzyme, May be constructed such that polynucleotides encoding one or more CYPs are continuously connected, and more preferably, a polynucleotide encoding a variety of polynucleotides derived from Sebecia vanilan, which is used as a host cell It is preferable to use an expression vector constructed such that a polynucleotide encoding CYP506 and a polynucleotide encoding CYP008 are continuously connected to each other, and most preferably, a polynucleotide encoding CYP008 and a polynucleotide encoding CYP008 are continuously connected. In addition, the polynucleotide encoding the above-described electrotransfer enzyme can be obtained by using two proteins (eg, futidaradoxine and futidarethoxyl reductase, ferredoxin and ferredoxin reductase, flavoboxin and flavoboxin reductase) May be constituted so that the polynucleotide encoding the enzyme is continuously connected, and the electron transfer enzyme may include one kind or two or more kinds, but is not particularly limited thereto.

The transformant into which the expression vector containing the respective polynucleotides encoding the CYP and the electron transfer enzyme is introduced is not particularly limited, but the expression vector is introduced into a host cell capable of hydrolyzing at least CyA, (γ-hydroxy) -CyA, and the host cell capable of hydrolyzing the CyA is not particularly limited, but is preferably a microorganism of actinomycetes capable of hydrolyzing CyA , More preferably can be a C. elegans microorganism capable of hydrolyzing CyA, and most preferably can be a Sebecia vanilla one capable of hydrolyzing CyA.

The method for producing 4- (γ-hydroxy) -CyA provided by the present invention comprises the steps of: (i) preparing an expression vector containing each polynucleotide encoding cytochrome P450 hydroxylase (CYP) and an electron transfer enzyme ; (Ii) introducing the prepared expression vector into a host cell capable of hydrolyzing CyA to prepare a transformant; (Iii) culturing the transformant to obtain a culture; And (iv) recovering 4- (γ-hydroxy) -CyA from the culture.

The CYP may be CYP derived from a microorganism of the genus Severobia, more preferably CYP derived from Sebecia bennyana, and most preferably, Derived CYP501, CYP502, CYP503, CYP504, CYP506, CYP008, and combinations thereof.

In addition, the electron transfer enzyme is not limited to, but is not limited to, putidaredoxin and putidaredoxin reductase derived from P. putida , ferredoxin derived from S. benihana and S. coelicolor A3 2) ferredoxin reductase, flavoboxin from E. coli , and flavoboxin reductase.

Preferably, a combination comprising CYP506 and CYP008 as CYP and a combination of futidaradoxine and futidaradoxine reductase as electronic transfer enzymes, CYP506 and CYP008 as CYP, and ferretoxin and ferretoxin reductase as electronic transfer enzymes A combination including CYP506 and CYP008 as CYP, and a combination including Flavoxin and Flavobacterium Reducing Enzyme as electronic transfer enzymes, but the present invention is not limited thereto.

The host cell may be a microorganism of actinomycetes capable of hydrolyzing CyA, more preferably a microorganism of Sebecia which can hydrolyze CyA, and most preferably, It can be a Sebecia Benny one that can hydrolyze CyA.

The culture of the transformant may be carried out by a method such as liquid culture or solid culture depending on the kind of medium, and may be carried out by a batch culture method, a continuous culture method, Culturing method and the like, and the culturing conditions are not particularly limited. However, the culture conditions are not particularly limited, but may be carried out by using a basic compound (e.g., sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid) 9, preferably pH 6 to 8, most preferably pH 6.8), and oxygen or an oxygen-containing gas mixture can be introduced into the culture to maintain aerobic conditions, and the incubation temperature can range from 20 to 45 ° C, Preferably 25 to < RTI ID = 0.0 > 40 C, < / RTI > and preferably about 10 to 160 hours. The ornithine produced by the above culture may be secreted into the medium or left in the cells.

In addition, the culture medium used may be a carbon source such as sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as soybean oil, sunflower seeds Alcohols such as glycerol and ethanol, and organic acids such as acetic acid, etc. may be used individually or in combination with one or more of the following: ; Examples of nitrogen sources include nitrogen-containing organic compounds such as peptone, yeast extract, juice, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, Ammonium nitrate) may be used individually or in combination; As the phosphorus source, potassium dihydrogenphosphate, dipotassium hydrogenphosphate and the corresponding sodium-containing salt may be used individually or in combination; Other metal salts such as magnesium sulfate or iron sulfate, amino acids and vitamins.

Using the method of producing the hydroxylated cyclosporin A of the present invention, 4- (γ-hydroxy) -CyA can be produced at a higher efficiency than the conventional method, and thus it can be widely used for the development and production of various hair growth agents.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic diagram showing the construction of an expression vector for producing 4- (y-hydroxy) -CyA.
Figure 2 is a schematic diagram showing a transformation method through conjugation of S. benihana .
FIG. 3A is a schematic diagram showing the desired genes (CYP506, CYP008, camA and camB ) contained in the expression vector pYJ1621,
3B is an electrophoresis image showing the result of PCR amplification of genomic DNA of YJ405.
3C is an electrophoresis image showing the result of analysis of the genomic DNA of YJ405 by Southern blot hybridization method.
4A is a schematic diagram showing the desired genes (CYP506, CYP008, FD506 and SCO0681) contained in the expression vector pYJ1623.
4B is an electrophoresis image showing the result of PCR amplification of genomic DNA of YJ407.
4C is an electrophoresis image showing the result of analysis of the genomic DNA of YJ407 by Southern blot hybridization.
5A is a schematic diagram showing the desired genes (CYP506, CYP008, fldA and fpr ) contained in the expression vector pYJ1625.
5B is an electrophoresis image showing the result of PCR amplification of genomic DNA of YJ409.
5C is an electrophoresis image showing the result of analysis of genomic DNA of YJ409 by Southern blot hybridization method.
FIG. 6 shows the results of analysis of 4- (γ-hydroxy) -CyA produced in the strain of the control by HPLC-ESI-MS.
FIG. 7 shows the results of analysis of the water oxidation rate of 4- (γ-hydroxy) -CyA produced by the liquid culture method.
FIG. 8 shows the results of analyzing the water oxidation rate of 4- (γ-hydroxy) -CyA produced by the solid culture method.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  1: mediates the hydroxylation of cyclosporin A New CYP  Selection of genes

In order to improve the water oxidation rate of cyclosporin A, 16 novel CYP genes were selected in addition to five known CYP genes through the genome analysis of S. benihana (KTTC 9610) (Table 1).

CYP gene selected from S. benihana No. CYP name Description One
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21 CYP501
CYP502
CYP503
CYP504
CYP506
CYP001
CYP002
CYP003
CYP004
CYP005
CYP006
CYP007
CYP008
CYP009
CYP010
CYP011
CYP012
CYP013
CYP014
CYP015
CYP016 Accession no. DI130758.1
Accession no. DI131915.1
Accession no. DI126285.1
Accession no. DI129591.1
Accession no. DI139785.1

As shown in Table 1, sixteen kinds of CYP genes from 6 to 21 were selected. Among the selected genes, in order to select a gene encoding a protein capable of mediating the hydroxylation of cyclosporin A, (Γ-hydroxy) -CyA) expressed in the respective mutant strains was measured, and then the amount of the 4- (γ-hydroxy) -CyA Of the wild type strains were selected. As a result, it was confirmed that only the CYP008 gene can express a protein that is capable of mediating the hydroxylation of cyclosporin A.

Example  2: 4- (γ- hydroxy ) - CyA Lt; RTI ID = 0.0 >

A CYP008 gene which has been confirmed to encode a protein exhibiting a hydroxylation activity to cyclosporin A and a CYP506 gene (NCBI accession No. DI139785.1) which has already proven its hydroxylation activity and which encodes a protein exhibiting an electron transfer activity Expression vector containing the gene was prepared. At this time, the electron transfer to the gene encoding a protein showing the activity were used for the three groups, 1 group was used camA gene, putidaredoxin gene camB and putidaredoxin reductase of P. putida origin, is one group 2 using was used as the ferredoxin gene of FD506 and S. coelicolor A3 (2) derived from the ferredoxin reductase gene, SCO0681 present in the 3'-downstream of CYP506 genes in S. benihana, No. 3 group of flavodoxin fldA gene of E. coli-derived And fpr gene, a ferredoxin (flavodoxin) reductase, were used.

These genes were obtained by performing PCR (polymerase chain reaction) so as to include the RBS (ribosome binding site) and the start codon to the stop codon. The PCR primers used were the primers of SEQ ID NOs: 3 and 4 for amplifying the CYP008 gene, the primers of SEQ ID NOS: 5 and 6 for amplifying the CYP506 gene, the sequence for amplifying the camA gene No. 7 and 8 of the primer, SEQ ID NO: for amplifying camB genes 9 and 10 primers, SEQ ID NO: for amplifying FD506 genes 11 and 12 primers, SEQ ID NO: 13 and 14 primers for amplifying SCO0681 gene, fldA The primers of SEQ ID NOs: 15 and 16 for amplifying the genes and the primers of SEQ ID NOS: 17 and 18 for amplifying the fpr gene were used, and the nucleotide sequences of the primers are shown in Table 2. Each gene fragment obtained by PCR amplification was cloned into pLitmus28 vector by treatment with restriction enzymes EcoRI (or PacI) and XbaI.

The PCR primer sequence of each gene gene Type of primer The base sequence (5'-3 ') SEQ ID NO: CYP008 Forward TACGTAGAATTCACTAGTCCTCGCGCTGGTTTCATA 3 Reverse TCTAGAGGTTCAGCCGAGGGTGAC 4 CYP506 Forward TACGTAGAATTCACTAGTAGCGGAACGCGTAATATC 5 Reverse TCTAGAATCCACTTCGAGTTCCAT 6 camA Forward TTAATTAAACTAGTATCGATACACATGGGAGTGCGTGCTAAGTG 7 Reverse TCTAGATTCAGGCACTACTCAGTTCAGCTT 8 camB Forward TTAATTAAACTAGTCATAGCGTGTGAGGATAAACAGAT 9 Reverse TCTAGATTTACCATTGCCTATCGGGAACA 10 FD506 Forward GAATTCTACGTAACTAGTATGGAACTCGAAGTGGAT 11 Reverse TCTAGATCATGAAGGGTCCGCAGGCGA 12 SCO0681 Forward GAATTCTACGTAACTAGTGATCTGTCACCGCTCGAA 13 Reverse TCTAGATCAGGCGCCGCTCTCGCGGAG 14 fldA Forward GAATTCTACGTAACTAGTTTCAATAAGTTTCAAGAG 15 Reverse TCTAGATCAGGCATTGAGAATTTCGTC 16 fpr Forward GAATTCTACGTAACTAGTAAGGCAAGTCAATCAAAA 17 Reverse TCTAGATTACCAGTAATGCTCCGCTGT 18

Each expression vector containing the gene encoding the protein exhibiting the two hydroxyl activities and the gene encoding the protein exhibiting the three groups of the electronic transition activity was prepared (FIG. 1). BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic diagram showing the construction of an expression vector for producing 4- (y-hydroxy) -CyA. As shown in Fig. 1, ermE was used as a promoter in three expression vectors, and CYP008 gene and CYP506 gene were sequentially linked as a gene encoding a protein exhibiting hydroxylation activity, Were synthesized in the pLitmus28 vector together with the genes of each group coding for the protein representing the protein and then cloned with the integration vector pSET152 to prepare an expression vector for the hydroxylation of cyclosporin A. At this time, the expression vector containing the first group was named "pYJ1621", the expression vector containing the second group was named "pYJ1623", and the expression vector containing the third group was named "pYJ1625".

As a negative control, an expression vector containing only the gene coding for the protein exhibiting the above two hydroxyl activities and not containing the gene coding for the protein exhibiting the electron transfer activity was prepared and named "pYJ1627".

Example  3: 4- (γ- hydroxy ) - CyA Production of Transformants to Produce

First, each of the expression vectors prepared in Example 2 was introduced into E. coli ET12567 / pUZ8002 to obtain transformants, and 25 μg / ml of apramycin was added to the LB liquid medium After culturing at 37 占 폚 for 12 hours, 1 ml of the culture was transferred to 50 ml of LB liquid medium and cultured at 37 占 폚 until the optical density (OD600) became 0.4-0.5. The culture was centrifuged, washed twice with LB liquid medium without antibiotics, and concentrated with 500 μl of LB.

After mixing 500 μl of 2xTY (0.16% trptone, 0.1% yeast extract, 0.05% NaCl) in 80 μl of S. benihana spore, the mixture was centrifuged, resuspended, and heat shocked at 50 ° C for 10 minutes To obtain a mycelial liquid.

500 μl of each of the above E. coli concentrates and 500 μl of mycelia was mixed and each of the mixtures was applied to mISP4 solid medium (Difco ISP4 medium 3.7%, yeast extract 0.05% and tryptone 0.15%), And cultured for 18-20 hours. 30 μl / ml of nalidixic acid and 30 μl / ml of apramycin were plated on the cultured solid medium, further cultured for 15-20 days, and then each colony showing antibiotic resistance (Fig. 2). Figure 2 is a schematic diagram showing a transformation method through conjugation of S. benihana .

The transformant into which the expression vector pYJ1621 was introduced was named "YJ405", the transformant into which the expression vector pYJ1623 was introduced was named "YJ407", and the transformant into which the expression vector pYJ1625 was introduced was named "YJ409" , And the transformant to which the expression vector pYJ1627, which is a negative control, was introduced was named "YJ410 ".

Example  4: Assay of transformants into which group 1 was introduced

Whether or not the desired gene (CYP506, CYP008, camA and camB ) was normally introduced into the transformant YJ405 into which the expression vector pYJ1621 containing the group 1 was introduced among the transformants prepared by the above method was determined by the PCR method And southern blot hybridization, respectively.

First, in the case of the PCR method, PCR was performed using the primers of YJ405 as the template and the primers shown in Table 5 to obtain PCR fragments, and the obtained PCR fragments were electrophoresed (FIGS. 3A and 3B ). FIG. 3A is a schematic diagram showing a target gene (CYP506, CYP008, camA and camB ) contained in the expression vector pYJ1621, and FIG. 3B is an electrophoresis image showing the result of PCR amplification of the genomic DNA of YJ405. As shown in Figure 3b, there genomic DNA of the YJ405 was confirmed that contains the gene of CYP8 1.3kb, 1.3kb of CYP506 gene, camA camB gene and genes of the 0.3kb 1.3kb.

Next, in case of southern blot hybridization, the genomic DNA of YJ405 was used as a probe for detection of CYP008 gene and CYP506 gene region of about 2.8 kb (SEQ ID NO: 19) and kit (DIG labeling and detection kit , Roche) (Figure 3c). 3C is an electrophoresis image showing the result of analysis of the genomic DNA of YJ405 by Southern blot hybridization method. As shown in FIG. 3C, a band of 2.8 kb, which is the size of the DNA fragment used as the probe, was confirmed and it was confirmed that the hydroxylated gene and the electron transfer gene were inserted into the recombinant strain YJ405.

Example  5: Assay of transformants into which group 2 was introduced

Whether or not the desired genes (CYP506, CYP008, FD506 and SCO0681 ) were normally introduced into the transformant YJ407 into which the expression vector pYJ1623 containing the second group among the transformants prepared by the above method was introduced was determined by the PCR method And southern blot hybridization, respectively.

First, in the case of the PCR method, PCR was performed using the primers of YJ407 as the template and the primers shown in Table 5 to obtain PCR fragments, and the obtained PCR fragments were electrophoresed (FIGS. 4A and 4B ). FIG. 4A is a schematic diagram showing the target genes (CYP506, CYP008, FD506 and SCO0681 ) contained in the expression vector pYJ1623, and FIG. 4B is an electrophoresis image showing the result of PCR amplification of the genomic DNA of YJ407. As shown in FIG. 4b, is genomic DNA of the YJ407 was confirmed that contains the gene of CYP8 1.3kb, 1.3kb of CYP506 gene, FD506 SCO0681 gene and genes of the 1.4kb 0.2kb.

Next, in the case of southern blot hybridization, genomic DNA of YJ407 was amplified by PCR using a part of CYP008 gene (after restriction enzyme AscI cleavage site), CYP506 gene and a part of FD506 gene (transferring restriction enzyme AscI fragment) of about 2.5 kb Southern blot hybridization using a probe 2 (SEQ ID NO: 20) capable of detecting the gene region and a kit (DIG labeling and detection kit, Roche) was performed (FIG. 4C is an electrophoresis image showing the result of analysis of the genomic DNA of YJ407 by Southern blot hybridization. As shown in FIG. 4C, a band of 2.5 kb, which is the size of the DNA fragment used as the probe, was confirmed and it was confirmed that the hydroxylated gene and the electron transfer gene were inserted into the recombinant strain YJ407.

Example  6: Assay of transformants in which group 3 was introduced

Whether or not the desired gene (CYP506, CYP008, fldA and fpr ) was normally introduced into the transformant YJ409 into which the expression vector pYJ1625 containing the group 3 was introduced among the transformants prepared by the above method was determined by PCR And southern blot hybridization, respectively.

First, in the case of the PCR method, the PCR fragment was obtained by using the genomic DNA of YJ409 as a template and each of the primers described in Table 5 above, and the obtained PCR fragment was subjected to electrophoresis (FIGS. 5A and 5B ). FIG. 5A is a schematic diagram showing the target genes (CYP506, CYP008, fldA and fpr ) contained in the expression vector pYJ1625, and FIG. 5B is an electrophoresis image showing the result of PCR amplification of the genomic DNA of YJ409. As shown in FIG. 5b, is genomic DNA of the YJ409 was confirmed that contains the gene of CYP8 1.3kb, 1.3kb of CYP506 gene, fldA gene and the fpr gene of 0.7kb of 0.5kb.

Next, in the case of southern blot hybridization, the genomic DNA of YJ409 was used to amplify a gene region of about 1.9 kb, which is part of the CYP506 gene (after restriction enzyme NruI cleavage site) and part of the fldA gene (before restriction enzyme SspI cleavage site) Southern blot hybridization using probe 3 (SEQ ID NO: 21) and kit (DIG labeling and detection kit, Roche) was performed (FIG. 5C). 5C is an electrophoresis image showing the result of analysis of genomic DNA of YJ409 by Southern blot hybridization method. As shown in FIG. 5C, a band of 1.9 kb, which is the size of the DNA fragment used as the probe, was confirmed and it was confirmed that the hydroxylated gene and the electron transfer gene were inserted into the recombinant strain YJ409.

Example  7: Production of 4- (γ- hydroxy ) - CyA Production of

Each of the transformants prepared above was cultured by a liquid culture method to produce 4- (γ-hydroxy) -CyA and the content of 4- (γ-hydroxy) -CyA produced was measured.

Specifically, each of the transformants prepared above was inoculated into 5 ml of GSMY liquid medium (glucose 0.7%, soluble starch 0.75%, yeast extract 0.45%, malt extract 0.5%, calcium carbonate 0.005 %). The cells were cultured for 3 days while shaking at 30 DEG C at 230 rpm. Each of the cultures was centrifuged to obtain individual cells. 50 mg of each of the obtained cells was inoculated into 50 mL of GSMY liquid medium containing 25 mu g / mL of apramycin and cultured for 2 days while shaking at 30 DEG C at 230 rpm. To each of the cultures, cyclosporin A 1.25 mg was added and then further cultured for 3 days under the same conditions. When the cultivation was completed, the cultures were centrifuged to obtain respective microbial cells, and the microbial cells were allowed to stand for 12 hours by adding twice the volume of the culture volume of ethyl acetate, from which the respective ethyl acetate layers were obtained. The solvent was removed from the obtained ethyl acetate layer to obtain each sample, which was dissolved in 200 μl of methanol and used as a sample for HPLC and HPLC-ESI-MS analysis. At this time, a wild type strain was used as a control group.

The HPLC (high performance liquid chromatography) analysis was performed using a device (waters (Milford, MA) model 2690 separation module), columns (Gemini 5u C18 110A, 250x4.60mm, 5micron from Phenomenex), absorption wavelength (100 mL / min), pump pressure (50.0 psi), column temperature (50 DEG C), solvent A (25% methanol), solvent B (100% acetonitrile) Solvent B 40% for 5-20 minutes, solvent B 100% for 21-40 minutes, solvent B 40% for 45-60 minutes).

HPLC-Electrospray ionization-mass spectrometry (HPLC-ESI-MS) analysis was carried out using a device (waters (Milford, MA) model 2690 separation module), column (XTetra? MS C18 3.5 占 퐉, 2.1x50 mm) (40% solvent A for 0-40 min.), Solvent B (80% acetonitrile in which 5 mM ammonium acetate and 0.05% acetic acid were dissolved), flow rate (0.22 ml / min) 5% Solvent A for 41-47 minutes and 40% Solvent A for 48-60 minutes). The sample passed through the column was passed through a micromass (Baverly, MA) Quattro LC triple-tandem quadrupole mass spectrometer and applied to a cation mode detector (FIG. 6). FIG. 6 shows the results of HPLC-ESI-MS analysis of 4- (γ-hydroxy) -CyA produced in the control strain, wherein A represents HPLC-ESI-MS chromatogram and B represents ESI-MS spectra . As shown in FIG. 6, not only the 4- (γ-hydroxy) -CyA is produced by the S. benihana wild-type strain as a control group, but also the derivatives in which hydroxylated derivatives 4 methyl leucine and 6 methyl leucine are hydroxylated together -4,6- (γ-hydroxy) -CyA) were also produced in very small amounts.

As described above, the results of HPLC and HPLC-ESI-MS analysis are shown in FIG. FIG. 7 shows the results of analysis of the water oxidation rate of 4- (γ-hydroxy) -CyA produced by a liquid culture method, wherein A represents an HPLC chromatogram of 4- (γ-hydroxy) -CyA and B represents 4- (γ-hydroxy) -CyA and a water oxidation rate of each transformant, wherein a represents 4- (γ-hydroxy) -CyA and b represents CyA.

As shown in FIG. 7, when the production amount of 4- (γ-hydroxy) -CyA was compared, 0.55 mg (44%) of the production was produced in the control group and 0.56 mg 0.63 mg (50%) was produced in the transformant YJ405, 0.61 mg (49%) in the transformant YJ407, and 0.84 mg in the transformant YJ409 67%) were produced.

As compared with the negative control (YJ410) in which only the control and the hydroxylase were overexpressed, the yield of 4- (γ-hydroxy) -CyA was not significantly different, (YJ405, YJ407 and YJ409) produced 4- (γ-hydroxy) -CyA with an improved yield of 1.1 to 1.5 times.

Therefore, in order to increase the production of 4- (γ-hydroxy) -CyA, it was found that the electron transfer enzyme should be overexpressed alone or together with hydroxylase.

Example  8: Production of 4- (γ- hydroxy ) - CyA Production of

Each of the transformants prepared above was cultured by a solid culture method to produce 4- (γ-hydroxy) -CyA and the content of 4- (γ-hydroxy) -CyA produced was measured.

Specifically, each of the transformants prepared above was inoculated into 5 ml of GSMY liquid medium containing 25 占 퐂 / ml of apramycin, cultured for 3 days while shaking at 30 占 폚 at 230 rpm, and 20 占 퐇 of each of the cultures Was plated in 50 ml of GSMY solid medium supplemented with 1.25 mg of cyclosporin A and incubated at 30 ° C for 5 days. When the culture was completed, the solid medium was cut into a size of 0.5-0.8 mm, and methanol was added to extract it, followed by vacuum drying and concentration. To the methanol concentrate was added a mixed solvent (water: ethyl acetate = 1: 3, v / v) for 12 hours, from which the respective ethyl acetate layers were obtained. The solvent was removed from the obtained ethyl acetate layer to obtain each sample, which was dissolved in 200 μl of methanol and used as a sample for HPLC and HPLC-ESI-MS analysis. At this time, a wild type strain was used as a control group.

HPLC and HPLC-ESI-MS analysis using the sample were carried out in the same manner as in Example 7, and the results are shown in FIG.

FIG. 8 shows the results of analysis of the water oxidation rate of 4- (γ-hydroxy) -CyA produced by the solid culture method, wherein A represents HPLC chromatogram of 4- (γ-hydroxy) -CyA and B represents 4- (γ-hydroxy) -CyA and a water oxidation rate of each transformant, wherein a represents 4- (γ-hydroxy) -CyA and b represents CyA.

As shown in FIG. 8, when the production amount of 4- (γ-hydroxy) -CyA was compared, 0.55 mg (44% of the total conversion rate) was produced in the control group and 0.56 mg in the negative control group YJ410 The transformant YJ405 produced 0.69 mg of the transformant YJ405 and the transformant YJ409 produced 1.01 mg of the transformant YJ407. 81%) was produced.

As compared with the control group and the negative control group (YJ410) in which only the hydroxylase was overexpressed, the yield of 4- (γ-hydroxy) -CyA was not significantly different from the results of Example 7, Further over-expressed transformants (YJ405, YJ407 and YJ409) were found to produce 4- (γ-hydroxy) -CyA with an improved yield of 1.2 to 1.8 fold.

Therefore, it was once again shown that the electron transfer enzyme should be overexpressed alone or together with the hydroxylase to increase production of 4- (γ-hydroxy) -CyA.

<110> Ewha University-Industry Collaboration Foundation          SNU R & DB FOUNDATION <120> A novel Cytochrome P450 hydroxylase and process preparing          hydroxylated Cyclosporin A employing the same <130> PA111000 / KR <160> 21 <170> Kopatentin 2.0 <210> 1 <211> 394 <212> PRT <213> CYP008 <400> 1 Val Asn Ile Asp Leu Val Asp Gln Asp His Tyr Ala Thr Phe Gly Pro   1 5 10 15 Pro His Glu Gln Met Arg Trp Leu Arg Glu His Ala Pro Val Tyr Trp              20 25 30 His Glu Gly Glu Pro Gly Phe Trp Ala Val Thr Arg His Glu Asp Val          35 40 45 Val His Val Ser Ser His Ser Asp Leu Phe Ser Ser Ala Arg Arg Leu      50 55 60 Ala Leu Phe Asn Glu Met Pro Glu Glu Gln Arg Glu Leu Gln Arg Met  65 70 75 80 Met Met Leu Asn Gln Asp Pro Pro Glu His Thr Arg Arg Arg Ser Leu                  85 90 95 Val Asn Arg Gly Phe Thr Pro Arg Thr Ile Arg Ala Leu Glu Gln His             100 105 110 Ile Arg Asp Ile Cys Asp Asp Leu Leu Asp Gln Cys Ser Gly Glu Gly         115 120 125 Asp Phe Val Thr Asp Leu Ala Ala Pro Leu Pro Leu Tyr Val Ile Cys     130 135 140 Glu Leu Leu Gly Ala Pro Val Ala Asp Arg Asp Lys Ile Phe Ala Trp 145 150 155 160 Ser Asn Arg Met Ile Gly Ala Gln Asp Pro Asp Tyr Ala Ala Ser Pro                 165 170 175 Glu Gly Gly Gly Ala Ala Glu Val Tyr Ala Tyr Ala Ser Glu             180 185 190 Leu Ala Ala Gln Arg Arg Ala Ala Pro Arg Asp Asp Ile Val Thr Lys         195 200 205 Leu Leu Gln Ser Asp Glu Asn Gly Glu Ser Leu Thr Glu Asn Glu Phe     210 215 220 Glu Leu Phe Val Leu Leu Le Val Val Ala Gly Asn Glu Thr Thr Arg 225 230 235 240 Asn Ala Ala Ser Gly Gly Met Leu Thr Leu Phe Glu His Pro Asp Gln                 245 250 255 Trp Asp Arg Leu Val Ala Asp Pro Ser Leu Ala Ala Thr Ala Ala Asp             260 265 270 Glu Ile Val Arg Trp Val Ser Pro Val Asn Leu Phe Arg Arg Thr Ala         275 280 285 Thr Ala Asp Leu Thr Leu Gly Gly Gln Gln Val Lys Ala Asp Asp Lys     290 295 300 Val Val Val Phe Tyr Ser Ser Ala Asn Arg Asp Ala Ser Val Phe Ser 305 310 315 320 Asp Pro Glu Val Phe Asp Ile Gly Arg Ser Pro Asn Pro His Ile Gly                 325 330 335 Phe Gly Gly Gly Gly Ala His Phe Cys Leu Gly Asn His Leu Ala Lys             340 345 350 Leu Glu Leu Arg Val Leu Phe Glu Gln Leu Ala Arg Arg Phe Pro Arg         355 360 365 Met Arg Gln Thr Gly Glu Ala Arg Arg Leu Arg Ser Asn Phe Ile Asn     370 375 380 Gly Ile Lys Thr Leu Pro Val Thr Leu Gly 385 390 <210> 2 <211> 1185 <212> DNA <213> CYP008 <400> 2 gtgaacatcg acctcgtcga tcaggaccac tacgcgacct tcggcccccc gcacgagcag 60 atgcgctggc tgagagagca cgctcccgtc tactggcacg agggcgagcc gggattctgg 120 gccgtcaccc gccacgagga cgtcgtccac gtctcccgcc actccgacct gttctcctcc 180 gcgcgcaggc tcgccctgtt caacgagatg ccggaggagc agcgggagct gcagcggatg 240 atgatgctca accaggaccc gcccgagcac accagaaggc gctccctggt caaccgcggt 300 ttcaccccgc gcaccatccg cgcgctggag cagcacatcc gcgacatctg cgacgacctg 360 ctcgaccagt gctcaggcga aggagacttc gtcaccgacc tcgccgcgcc cctcccgctc 420 tacgtgatct gtgagctgct cggcgcgccc gtcgccgacc gcgacaagat cttcgcctgg 480 tccaaccgca tgatcggcgc ccaggacccc gactacgccg cctcaccgga ggagggcggc 540 gccgcggcca tggaggtcta cgcctacgcc tccgaactgg ccgcccagcg tcgcgccgcc 600 ccgcgcgacg acatcgtcac caagctcctc cagtccgacg agaacggcga gagcctgacg 660 gagaacgagt tcgagctctt cgtgctgctc ctcgtggtcg cgggcaacga gaccacccgt 720 aacgccgcct ccggcggcat gctcaccctc ttcgagcatc cggaccagtg ggacaggctg 780 gtcgccgacc cctccctcgc cgccacggcc gccgacgaga tcgtccgctg ggtctcgccg 840 gtgaacctct tccgccgtac ggcgacagcc gacctcaccc tgggcggaca gcaggtcaag 900 gccgacgaca aggtcgtggt cttctactcc tctgccaaca gggacgcgtc ggtcttctcc 960 gatccggagg tcttcgacat cggacggtct cccaacccgc acatcgggtt cggaggcgga 1020 ggcgcgcact tctgcctggg caaccatctg gccaagctcg agctgcgcgt actcttcgag 1080 cagctggcca ggaggttccc gcggatgcgg cagaccggcg aggcccgccg gttgcgctcg 1140 aacttcatca acggcatcaa gaccctcccc gtcaccctcg gctga 1185 <210> 3 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 tacgtagaat tcactagtcc tcgcgctggt ttcata 36 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tctagaggtt cagccgaggg tgac 24 <210> 5 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 tacgtagaat tcactagtag cggaacgcgt aatatc 36 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tctagaatcc acttcgagtt ccat 24 <210> 7 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ttaattaaac tagtatcgat acacatggga gtgcgtgcta agtg 44 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tctagattca ggcactactc agttcagctt 30 <210> 9 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ttaattaaac tagtcatagc gtgtgaggat aaacagat 38 <210> 10 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tctagattta ccattgccta tcgggaaca 29 <210> 11 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gaattctacg taactagtat ggaactcgaa gtggat 36 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tctagatcat gaagggtccg caggcga 27 <210> 13 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gaattctacg taactagtga tctgtcaccg ctcgaa 36 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tctagatcag gcgccgctct cgcggag 27 <210> 15 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gaattctacg taactagttt caataagttt caagag 36 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 tctagatcag gcattgagaa tttcgtc 27 <210> 17 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 gaattctacg taactagtaa ggcaagtcaa tcaaaa 36 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 tctagattac cagtaatgct ccgctgt 27 <210> 19 <211> 2822 <212> DNA <213> Artificial Sequence <220> <223> probe 1 <400> 19 ggatcctcta gtcctcgcgc tggtttcata ccctggcacc taccaagcgc ttgaccaagc 60 ccgaggtgac ggctcgtgaa catcgacctc gtcgatcagg accactacgc gaccttcggc 120 cccccgcacg agcagatgcg ctggctgaga gagcacgctc ccgtctactg gcacgagggc 180 gagccgggat tctgggccgt cacccgccac gaggacgtcg tccacgtctc ccgccactcc 240 gacctgttct cctccgcgcg caggctcgcc ctgttcaacg agatgccgga ggagcagcgg 300 gagctgcagc ggatgatgat gctcaaccag gacccgcccg agcacaccag aaggcgctcc 360 ctggtcaacc gcggtttcac cccgcgcacc atccgcgcgc tggagcagca catccgcgac 420 atctgcgacg acctgctcga ccagtgctca ggcgaaggag acttcgtcac cgacctcgcc 480 gcgcccctcc cgctctacgt gatctgtgag ctgctcggcg cgcccgtcgc cgaccgcgac 540 cgccgcctca 600 ccggaggagg gcggcgccgc ggccatggag gtctacgcct acgcctccga actggccgcc 660 cagcgtcgcg ccgccccgcg cgacgacatc gtcaccaagc tcctccagtc cgacgagaac 720 ggcgagagcc tgacggagaa cgagttcgag ctcttcgtgc tgctcctcgt ggtcgcgggc 780 aacgagacca cccgtaacgc cgcctccggc ggcatgctca ccctcttcga gcatccggac 840 cagtgggaca ggctggtcgc cgacccctcc ctcgccgcca cggccgccga cgagatcgtc 900 cgctgggtct cgccggtgaa cctcttccgc cgtacggcga cagccgacct caccctgggc 960 ggacagcagg tcaaggccga cgacaaggtc gtggtcttct actcctctgc caacagggac 1020 gcgtcggtct tctccgatcc ggaggtcttc gacatcggac ggtctcccaa cccgcacatc 1080 gggttcggag gcggaggcgc gcacttctgc ctgggcaacc atctggccaa gctcgagctg 1140 cgcgtactct tcgagcagct ggccaggagg ttcccgcgga tgcggcagac cggcgaggcc 1200 cgccggttgc gctcgaactt catcaacggc atcaagaccc tccccgtcac cctcggctga 1260 acctctagta gcggaacgcg taatatcgcg actaaggagc tgacgtgacg gagcccccgt 1320 acaccgtgac cgcgctgccc accatgcgcc ctcccggctg cccgttcgac ccgcccgagg 1380 agttggcgca gctgcgcgag cagcacccac tcagcaggat ggtcttcccc gacgggcacg 1440 tcggctggct ggtgaccagt cacgccctgg ctcgcgcggt cgtggccgac ccccgcttca 1500 gctcgcggca cgagctcatg cactcgccgt tccctggggc catctcggcg gagaggccgc 1560 cgccggccgc gcccggcatg ttcatcggcg tcgatccgcc cgagcacacc cgctaccgca 1620 agctgctcac ggggaagttc accgtccgca ggatgcgcag tctcgccgcc cgcgtcgagg 1680 agatcaccgc cgagcacctg gacgccatgg agcggcaggg cccgcctgtg gacctggtgc 1740 aggcctacgc ccagcccgtc cccgcgctga tgatctgcga gctgctcggc gttccctacg 1800 ccgacaggga gttcttccag cgtcacgcgc tggcgctgaa caacttcgac gccgtccccg 1860 aggagcagta cgccgcctac gtcgcgctgc aggagtacct gcacgcgctg gtcctggcca 1920 aacgcgccac ccccaccgac gacctgctcg gcgatctcgc gcgcgaggag ctcaccgacg 1980 aggagctcac caacatcggg gttctgctgc tgggcgccgg gctcgacacc accgccaaca 2040 tgctcgcgct gggcaccttc gccctgctga gccaccccgg ccagctcgcc gccctgcgcg 2100 ccgacccggg cctcgccgac caggccgtcg aggagctgct gcgctacctg agcatcaccc 2160 acaccgggat acgggccgca ctggaggatg tcgagctgaa cggtcacgtg atcaaagcgg 2220 gggagagcgt cgccctctcg gcgcaggcgg ccaaccgcga ccctgagcgc ttcgccgacc 2280 ccgacactct cgacctgcac cgtcaggcca ccggacatct gagcttcggt cacggcgtcc 2340 accagtgcct cggccagcag ctggcccgcg tggagatgcg cgtcgccctt cccgcgctgg 2400 tcacccgttt cccgacgctg cggctggcca tatcctcagc agaggtgccg ctgcgcacca 2460 attccgacat ctacggcgtg caccggctcc cggtcgcgtg ggacaaggag tagccgatgg 2520 aactcgaagt ggattctagt gagctcggta ccagcccgac ccgagcacgc gccggcacgc 2580 ctggtcgatg tcggaccgga gttcgaggta cgcggcttgc aggtccagga aggggacgtc 2640 catgcgagtg tccgttcgag tggcggcttg cgcccgatgc tagtcgcggt tgatcggcga 2700 tcgcaggtgc acgcggtcga tcttgacggc tggcgagagg tgcggggagg atctgaccga 2760 cgcggtccac acgtggcacc gcgatgctgt tgtgggcaca atcgtgccgg ttggtaggat 2820 cc 2822 <210> 20 <211> 2460 <212> DNA <213> Artificial Sequence <220> <223> probe 2 <400> 20 ggcgcgcccg tcgccgaccg cgacaagatc ttcgcctggt ccaaccgcat gatcggcgcc 60 caggaccccg actacgccgc ctcaccggag gagggcggcg ccgcggccat ggaggtctac 120 gcctacgcct ccgaactggc cgcccagcgt cgcgccgccc cgcgcgacga catcgtcacc 180 aagctcctcc agtccgacga gaacggcgag agcctgacgg agaacgagtt cgagctcttc 240 gtgctgctcc tcgtggtcgc gggcaacgag accacccgta acgccgcctc cggcggcatg 300 ctcaccctct tcgagcatcc ggaccagtgg gacaggctgg tcgccgaccc ctccctcgcc 360 gccacggccg ccgacgagat cgtccgctgg gtctcgccgg tgaacctctt ccgccgtacg 420 gcgacagccg acctcaccct gggcggacag caggtcaagg ccgacgacaa ggtcgtggtc 480 ttctactcct ctgccaacag ggacgcgtcg gtcttctccg atccggaggt cttcgacatc 540 ggacggtctc ccaacccgca catcgggttc ggaggcggag gcgcgcactt ctgcctgggc 600 aaccatctgg ccaagctcga gctgcgcgta ctcttcgagc agctggccag gaggttcccg 660 cggatgcggc agaccggcga ggcccgccgg ttgcgctcga acttcatcaa cggcatcaag 720 accctccccg tcaccctcgg ctgaacctct agtagcggaa cgcgtaatat cgcgactaag 780 gagctgacgt gacggagccc ccgtacaccg tgaccgcgct gcccaccatg cgccctcccg 840 gctgcccgtt cgacccgccc gaggagttgg cgcagctgcg cgagcagcac ccactcagca 900 ggatggtctt ccccgacggg cacgtcggct ggctggtgac cagtcacgcc ctggctcgcg 960 cggtcgtggc cgacccccgc ttcagctcgc ggcacgagct catgcactcg ccgttccctg 1020 gggccatctc ggcggagagg ccgccgccgg ccgcgcccgg catgttcatc ggcgtcgatc 1080 cgcccgagca cacccgctac cgcaagctgc tcacggggaa gttcaccgtc cgcaggatgc 1140 gcagtctcgc cgcccgcgtc gaggagatca ccgccgagca cctggacgcc atggagcggc 1200 agggcccgcc tgtggacctg gtgcaggcct acgcccagcc cgtccccgcg ctgatgatct 1260 gcgagctgct cggcgttccc tacgccgaca gggagttctt ccagcgtcac gcgctggcgc 1320 tgaacaactt cgacgccgtc cccgaggagc agtacgccgc ctacgtcgcg ctgcaggagt 1380 acctgcacgc gctggtcctg gccaaacgcg ccacccccac cgacgacctg ctcggcgatc 1440 tcgcgcgcga ggagctcacc gacgaggagc tcaccaacat cggggttctg ctgctgggcg 1500 ccgggctcga caccaccgcc aacatgctcg cgctgggcac cttcgccctg ctgagccacc 1560 ccggccagct cgccgccctg cgcgccgacc cgggcctcgc cgaccaggcc gtcgaggagc 1620 tgctgcgcta cctgagcatc acccacaccg ggatacgggc cgcactggag gatgtcgagc 1680 tgaacggtca cgtgatcaaa gcgggggaga gcgtcgccct ctcggcgcag gcggccaacc 1740 gcgaccctga gcgcttcgcc gaccccgaca ctctcgacct gcaccgtcag gccaccggac 1800 atctgagctt cggtcacggc gtccaccagt gcctcggcca gcagctggcc cgcgtggaga 1860 tgcgcgtcgc ccttcccgcg ctggtcaccc gtttcccgac gctgcggctg gccatatcct 1920 cagcagaggt gccgctgcgc accaattccg acatctacgg cgtgcaccgg ctcccggtcg 1980 cgtgggacaa ggagtagccg atggaactcg aagtggattc tagtgagctc ggtaccagcc 2040 cgacccgagc acgcgccggc acgcctggtc gatgtcggac cggagttcga ggtacgcggc 2100 ttgcaggtcc aggaagggga cgtccatgcg agtgtccgtt cgagtggcgg cttgcgcccg 2160 atgctagtcg cggttgatcg gcgatcgcag gtgcacgcgg tcgatcttga cggctggcga 2220 gaggtgcggg gaggatctga ccgacgcggt ccacacgtgg caccgcgatg ctgttgtggg 2280 cacaatcgtg ccggttggta ggatcctcta gtatggaact cgaagtggat cgcgagcgct 2340 gcatcggggc gggcatgtgc gcgctgaccg cccccgaggt cttcgaccag gacctcgacg 2400 acggcagggt gatgctgctg gattcgtcgc cgccccccgg gcaccaggcg aaggcgcgcc 2460                                                                         2460 <210> 21 <211> 1865 <212> DNA <213> Artificial Sequence <220> <223> probe 3 <400> 21 tcgcgactaa ggagctgacg tgacggagcc cccgtacacc gtgaccgcgc tgcccaccat 60 gcgccctccc ggctgcccgt tcgacccgcc cgaggagttg gcgcagctgc gcgagcagca 120 cccactcagc aggatggtct tccccgacgg gcacgtcggc tggctggtga ccagtcacgc 180 cctggctcgc gcggtcgtgg ccgacccccg cttcagctcg cggcacgagc tcatgcactc 240 gccgttccct ggggccatct cggcggagag gccgccgccg gccgcgcccg gcatgttcat 300 cggcgtcgat ccgcccgagc acacccgcta ccgcaagctg ctcacgggga agttcaccgt 360 ccgcaggatg cgcagtctcg ccgcccgcgt cgaggagatc accgccgagc acctggacgc 420 catggagcgg cagggcccgc ctgtggacct ggtgcaggcc tacgcccagc ccgtccccgc 480 gctgatgatc tgcgagctgc tcggcgttcc ctacgccgac agggagttct tccagcgtca 540 cgcgctggcg ctgaacaact tcgacgccgt ccccgaggag cagtacgccg cctacgtcgc 600 gctgcaggag tacctgcacg cgctggtcct ggccaaacgc gccaccccca ccgacgacct 660 gctcggcgat ctcgcgcgcg aggagctcac cgacgaggag ctcaccaaca tcggggttct 720 gctgctgggc gccgggctcg acaccaccgc caacatgctc gcgctgggca ccttcgccct 780 gctgagccac cccggccagc tcgccgccct gcgcgccgac ccgggcctcg ccgaccaggc 840 cgtcgaggag ctgctgcgct acctgagcat cacccacacc gggatacggg ccgcactgga 900 ggatgtcgag ctgaacggtc acgtgatcaa agcgggggag agcgtcgccc tctcggcgca 960 ggcggccaac cgcgaccctg agcgcttcgc cgaccccgac actctcgacc tgcaccgtca 1020 ggccaccgga catctgagct tcggtcacgg cgtccaccag tgcctcggcc agcagctggc 1080 ccgcgtggag atgcgcgtcg cccttcccgc gctggtcacc cgtttcccga cgctgcggct 1140 ggccatatcc tcagcagagg tgccgctgcg caccaattcc gacatctacg gcgtgcaccg 1200 gctcccggtc gcgtgggaca aggagtagcc gatggaactc gaagtggatt ctagtgagct 1260 cggtaccagc ccgacccgag cacgcgccgg cacgcctggt cgatgtcgga ccggagttcg 1320 aggtacgcgg cttgcaggtc caggaagggg acgtccatgc gagtgtccgt tcgagtggcg 1380 gcttgcgccc gatgctagtc gcggttgatc ggcgatcgca ggtgcacgcg gtcgatcttg 1440 acggctggcg agaggtgcgg ggaggatctg accgacgcgg tccacacgtg gcaccgcgat 1500 gctgttgtgg gcacaatcgt gccggttggt aggatcctct agtttcaata agtttcaaga 1560 ggttatttca ctcatggcta tcactggcat ctttttcggc agcgacaccg gtaataccga 1620 aaatatcgca aaaatgattc aaaaacagct tggtaaagac gttgccgatg tccatgacat 1680 tgcaaaaagc agcaaagaag atctggaagc ttatgacatt ctgctgctgg gcatcccaac 1740 ctggtattac ggcgaagcgc agtgtgactg ggatgacttc ttcccgactc tcgaagagat 1800 tgatttcaac ggcaaactgg ttgcgctgtt tggttgtggt gaccaggaag attacgccga 1860 atatt 1865

Claims (17)

Cytochrome P450 hydroxylase (CYP) comprising the amino acid sequence of SEQ ID NO: 1 and mediating the hydroxylation of Cyclosporin A (CyA).
The method according to claim 1,
Cytochrome P450 hydroxylase derived from Sebekia benihana .
A polynucleotide encoding the cytochrome P450 hydroxylase of claim 1.
The method of claim 3,
A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2.
An expression vector comprising the polynucleotide of claim 3.
A transformant expressing a cytochrome P450 hydroxylase comprising the amino acid sequence of SEQ ID NO: 1 by introducing the expression vector of claim 5.
(I) culturing the transformant of claim 6 to obtain a culture; And
(Ii) recovering cytochrome P450 hydroxylase (CYP) from the culture.
(I) a polynucleotide encoding a cytochrome P450 hydroxylase (CYP) consisting of the amino acid sequence of SEQ ID NO: 1,
(Ii) a polynucleotide encoding CYP506, and
(Iii) a set of putidaredoxin and putidaredoxin reductase, a set of ferredoxin and ferredoxin reductase, a set of flavodoxin and flavonoxin reductase flavodoxin reductase) set, wherein the expression vector comprises a polynucleotide encoding at least one electronic transcription enzyme.
9. The method of claim 8,
1. An expression vector comprising CYP consisting of the amino acid sequence of SEQ ID NO: 1 as a CYP and a polynucleotide encoding a CYP506, and a polynucleotide encoding a porphyrinase and a porphyrinase reductase as electronic transcription enzymes.
9. The method of claim 8,
1. An expression vector comprising CYP consisting of the amino acid sequence of SEQ ID NO: 1 as the CYP and a polynucleotide encoding the CYP506, and comprising a polynucleotide encoding the ferredoxin and the ferredoxin reductase as the electron transfer enzyme.
9. The method of claim 8,
1. An expression vector comprising a polynucleotide encoding CYP and CYP506 consisting of the amino acid sequence of SEQ ID NO: 1 as a CYP, and a polynucleotide encoding a flavoboxin and a Flavobacterium reductase as an electronic transduction enzyme.
A transformant wherein the expression vector of claim 8 is introduced into a host cell to produce 4- (? -Hydroxy) -CyA.
13. The method of claim 12,
Wherein said host cell is capable of intrinsically hydrolyzing cyclosporin A (CyA).
14. The method of claim 13,
Wherein said host cell is Sebekia benihana .
(I) introducing the expression vector of claim 8 into a host cell to produce a transformant;
(Ii) culturing the transformant to obtain a culture; And
(Iii) recovering 4- (? -Hydroxy) -CyA from the culture.
16. The method of claim 15,
Wherein the host cell is capable of intrinsically hydrolyzing cyclosporin A (CyA).
16. The method of claim 15,
Wherein the culture is performed by solid culture or liquid culture.

Images