KR101445005B1 - Patch kits for the treatment for infectious or noninfectious inflammatory disease and uses thereof - Google Patents

Patch kits for the treatment for infectious or noninfectious inflammatory disease and uses thereof Download PDF

Info

Publication number
KR101445005B1
KR101445005B1 KR1020120152103A KR20120152103A KR101445005B1 KR 101445005 B1 KR101445005 B1 KR 101445005B1 KR 1020120152103 A KR1020120152103 A KR 1020120152103A KR 20120152103 A KR20120152103 A KR 20120152103A KR 101445005 B1 KR101445005 B1 KR 101445005B1
Authority
KR
South Korea
Prior art keywords
patch
aluminum
copper
metal
present
Prior art date
Application number
KR1020120152103A
Other languages
Korean (ko)
Other versions
KR20140082306A (en
Inventor
김경원
Original Assignee
김경원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 김경원 filed Critical 김경원
Priority to KR1020120152103A priority Critical patent/KR101445005B1/en
Priority to PCT/KR2013/011385 priority patent/WO2014104617A1/en
Publication of KR20140082306A publication Critical patent/KR20140082306A/en
Application granted granted Critical
Publication of KR101445005B1 publication Critical patent/KR101445005B1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/70—Web, sheet or filament bases ; Films; Fibres of the matrix type containing drug
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61N—ELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N1/00—Electrotherapy; Circuits therefor
    • A61N1/02—Details
    • A61N1/04—Electrodes
    • A61N1/0404—Electrodes for external use
    • A61N1/0408—Use-related aspects
    • A61N1/0428—Specially adapted for iontophoresis, e.g. AC, DC or including drug reservoirs
    • A61N1/0432—Anode and cathode
    • A61N1/0436—Material of the electrode
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]

Abstract

본 발명은 염증성 질환을 치료하는 금속 패치 키트에 관한 것으로서, 더욱 구체적으로는 두 금속 간의 전기음성도 차이에 의해 생성되는 나노 전류를 이용해 염증성 반응과 관련된 단백질의 발현을 억제하는 방법에 관한 것이다. 본 발명의 감염 및 비감염성 염증질환 치료용 패치 키트는 염증성 반응과 관련된 단백질을 효과적으로 억제하면서도, 생체 내에서 세포독성을 나타내지 않아 안전한 장점이 있다.The present invention relates to a metal patch kit for treating an inflammatory disease, and more particularly, to a method for inhibiting the expression of a protein associated with an inflammatory reaction by using a nanocurrent generated by a difference in electronegativity between two metals. The patch kits for the treatment of infectious and noninfectious inflammatory diseases of the present invention have safety advantages because they do not show cytotoxicity in vivo while effectively inhibiting proteins involved in inflammatory reactions.

Description

감염성 및 비감염성 염증질환 치료용 패치 키트 및 이의 용도 {Patch kits for the treatment for infectious or noninfectious inflammatory disease and uses thereof}[0001] Patch kits for the treatment of infectious and noninfectious inflammatory diseases and their uses [0002] Patch kits for the treatment of infectious or noninfectious inflammatory diseases and uses thereof,

본 발명은 감염성 및 비감염성 염증질환 치료용 패치 키트에 관한 것으로, 본 발명의 패치 키트를 이용하면, 염증성 반응과 관련된 단백질의 발현을 억제하여, 감염 및 비감염성 염증질환의 치료가 가능하다.The present invention relates to a patch kit for treating infectious and non-infectious inflammatory diseases, and the patch kit of the present invention is capable of inhibiting the expression of proteins involved in an inflammatory reaction and treating infectious and non-infectious inflammatory diseases.

염증성질환은 감염 및 비감염을 포함한 인체 내의 반응이다. 염증의 증후로는 발열, 홍조, 부종, 통증 등이 있으며, 염증과정의 후반에는 염증부위로부터 백혈구의 이주 및 사이토카인(cytokine), 분해효소(degradative enzyme), 생활성지질 중간체(bioactive lipid intermediate), 일과성 반응적인 산화물질(transient reactive oxygen species), 림프구(sensitized lmphocyte)의 생성 등 세포내의 변화가 일어난다. 더불어 만성적인 염증 질환에서는 백혈구의 침윤에 의해 세포활성(cell activation) 및 세포사멸이 일어난다. 염증반응의 화학매개물 중 프로스타글란딘(prostaglandins)과 산화 질소(nitric oxide, NO)는 발암 및 염증의 진행과정에 중요한 매개물질이다.Inflammatory diseases are reactions within the body, including infections and non-infections. In the second half of the inflammation process, migraine leukocyte migration and cytokine, degradative enzyme, bioactive lipid intermediate, and inflammation are observed as symptoms of inflammation. , Transient reactive oxygen species, and the production of lymphocytes (sensitized lymphocytes). In chronic inflammatory diseases, leukocyte infiltration causes cell activation and cell death. Prostaglandins and nitric oxide (NO) are important mediators in the process of carcinogenesis and inflammation.

염증이나 통증을 조절하는 약물 중 하나인 비스테로이드계 염증질환제 (nonsteroidal antiinflammatory drugs)는 체내에 프로스타글란딘(prostaglandin)을 생성하는 COX를 저해함으로써 약리작용을 나타낸다. COX는 COX-1과 COX-2의 두 가지 이성체(isoform)으로 존재한다는 것이 밝혀졌는데, 이중 COX-1은 정상상태에서 위장관 점막과 혈소판, 신장에서 세포 보호 작용과 조절 작용에 관여하는 PG류 생성에 관여하는 효소인데 반해, COX-2는 정상세포에서는 그 농도가 매우 낮으나 염증관련세포에서 여러 자극(cytokine, endotoxin,mitogen)에 의해 유도 발현되어 통증이나 염증에 관여하는 PG류 생성에 관여한다. Nonsteroidal antiinflammatory drugs (NSAIDs), one of the drugs that control inflammation and pain, have pharmacological effects by inhibiting COX producing prostaglandins in the body. It has been shown that COX exists as two isoforms of COX-1 and COX-2. COX-1 is involved in cytoprotection and regulatory action in the gastrointestinal mucosa, platelet, and kidney, COX-2 is an enzyme that is involved in the production of PGs, which are involved in inflammation and inflammation, induced by various stimuli (cytokine, endotoxin, and mitogen) in inflammation-related cells.

또한 산화질소(nitric oxide, NO)는 혈관의 긴장도(vascular tone), 신경전달(neurotransmission), 세균 및 암세포의 사멸 조절에 관여한다. 또한 높은 농도의 NO는 순환기 쇼크(circulatory shock), 염증(inflammation), 발암(carcinogenesis) 등의 생리반응에서 나타난다. 신경성 NO(Neuronal NO)와 내피성 NO(endothelial NO)는 정상적인 상태에서도 존재하며, 반면 iNOS(NOS type2)는 LPS, 사이토카인(cytokine) 등에 의해 유도되어 발현된다. 염증이나 통증을 조절하는 약물 중 상기 비스테로이드계 염증질환제 는 인체 내에서 염증 반응에 관여하는 PG류 이외에 위점막 보호, 혈소판기능과 관련된 PG의 생성도 억제하여, 위장관 장해나 출혈 등의 부작용도 함께 나타나게 된다. 따라서 부작용이 없는 염증성 질환의 치료제의 개발이 요구되고 있는 실정이다.In addition, nitric oxide (NO) is involved in the regulation of vascular tone, neurotransmission, and the death of bacteria and cancer cells. High concentrations of NO also occur in physiological responses such as circulatory shock, inflammation, and carcinogenesis. Neuronal NO and endothelial NO are present in normal state, while iNOS (NOS type 2) is induced by LPS, cytokine, and the like. Among the drugs that control inflammation and pain, the non-steroidal inflammatory diseases agents inhibit the gastric mucosal protection and the PG production associated with the platelet function in addition to the PG involved in the inflammatory reaction in the human body, Together. Therefore, it is required to develop a therapeutic agent for inflammatory diseases without side effects.

한편, N. Shafer, and G. Kitay, "Transcutaneous electrical nerve stimulation and pain relief: an overview," Med Electron, vol. 19, no. 5, pp. 132-136, 1988., A. Khadilkar, S. Milne, L. Brosseau, et al., "Transcutaneous electrical nerve stimulation (TENS) for chronic low-back pain," Cochrane Database Syst Rev, vol., no. 3, pp. CD003008, 2005., P. Sarzi-Puttini, M. A. Cimmino, R. Scarpa, et al., "Osteoarthritis: an overview of the disease and its treatment strategies," Semin Arthritis Rheum, vol. 35, no. 1 Suppl 1, pp. 1-10, 2005에는 약한 전기적 반응이 만성적 통증 및 염증성 증상을 개선할 수 있다고 기재되어 있다.On the other hand, N. Shafer, and G. Kitay, "Transcutaneous electrical nerve stimulation and pain relief: an overview," Med Electron , vol. 19, no. 5, pp. Transcutaneous electrical nerve stimulation (TENS) for chronic low-back pain, " Cochrane Database System < RTI ID = 0.0 > Rev. , Vol. 3, pp. &Quot; Osteoarthritis: an overview of the disease < RTI ID = 0.0 > and its treatment strategies, Semin < / RTI > Arthritis Rheum , vol. 35, no. 1 Suppl 1, pp. 1-10, 2005, it is described that weak electrical responses can improve chronic pain and inflammatory symptoms.

이에 본 발명자들은 전기음성도 차이에 의해 발생하는 미세전류를 이용하여 염증성 반응과 관련된 단백질의 발현을 억제함으로써, 염증성 질환의 치료가 가능한 패치 키트를 개발함으로써 본 발명을 완성하였다.Accordingly, the present inventors have completed the present invention by developing a patch kit capable of treating an inflammatory disease by inhibiting the expression of a protein associated with an inflammatory reaction using a microcurrent generated by a difference in electronegativity.

따라서 본 발명의 목적은 양극 금속 패치 및 음극 금속 패치를 포함하는 염증질환 치료용 패치 키트를 제공하는 것이다.It is therefore an object of the present invention to provide a patch kit for treating an inflammatory disease comprising a positive metal patch and a negative metal patch.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

상기와 같은 본 발명의 목적을 달성하기 위해서, 본 발명은 양극 금속 패치 및 음극 금속 패치를 포함하는 감염 및 비감염성 염증질환 치료용 패치 키트를 제공한다.In order to achieve the above object, the present invention provides a patch kit for treating infectious and noninfectious inflammatory diseases including a positive electrode metal patch and a negative electrode metal patch.

본 발명의 일구현예에 있어서, 상기 양극 금속 패치 및 음극 금속 패치의 전기음성도 차이는 0.01 내지 1.75 인 것을 특징으로 한다.In one embodiment of the present invention, the difference in electronegativity between the positive metal patch and the negative metal patch is 0.01 to 1.75.

본 발명의 다른 구현예에 있어서, 상기 양극 금속 패치 및 음극 금속 패치의 전기음성도 차이에 의해 발생하는 전류는 1nA 내지 2μA 인 것을 특징으로 한다.In another embodiment of the present invention, the current generated by the electronegativity difference between the positive metal patch and the negative metal patch is 1 nA to 2 μA.

본 발명의 또 다른 구현예에 있어서, 상기 금속은 세포독성이 없는 금속인 것을 특징으로 한다.In another embodiment of the present invention, the metal is a metal that is not cytotoxic.

본 발명의 또 다른 구현예에 있어서, 상기 알루미늄 패치는 1μm 내지 100μm의 두께를 가지는 것을 특징으로 한다.In another embodiment of the present invention, the aluminum patch has a thickness of 1 to 100 m.

본 발명의 또 다른 구현예에 있어서, 상기 세포독성이 없는 금속은 리튬 마그네슘 알루미늄, 아연, 철, 구리, 게르마늄, 금, 은, 백금, 및 주석으로 이루어지는 군으로부터 2 종 이상 선택되는 것을 특징으로 한다.In another embodiment of the present invention, the metal having no cytotoxicity is selected from the group consisting of lithium magnesium aluminum, zinc, iron, copper, germanium, gold, silver, platinum, and tin .

본 발명의 또 다른 구현예에 있어서, 상기 패치의 형태는 직사각형, 다각형, 원형, 타원형, 격자형, 침형, 및 무정형으로 이루어지는 군으로부터 선택되는 것을 특징으로 한다.In another embodiment of the present invention, the shape of the patch is selected from the group consisting of a rectangle, a polygon, a circle, an ellipse, a lattice, an acute, and an amorphous.

본 발명의 또 다른 구현예에 있어서, 상기 패치는 1μm 내지 100μm의 두께를 가지는 것을 특징으로 한다.In another embodiment of the present invention, the patch is characterized by having a thickness of 1 m to 100 m.

본 발명의 또 다른 구현 예에 있어서, 상기 패치의 순도는 95% 내지 99.99% 인 것을 특징으로 한다. In another embodiment of the present invention, the purity of the patch is 95% to 99.99%.

본 발명의 또 다른 구현 예에 있어서, 상기 염증성 질환은 간염, 식도염, 위염, 피부염, 관절염, 장염, 질염, 폐렴, 담도염, 담낭염, 및 췌장염을 포함하여 감염 및 비감염으로 발생하는 염증으로 이루어지는 군으로부터 선택되는 것을 특징으로 한다.In another embodiment of the present invention, the inflammatory disease is selected from the group consisting of infections caused by infection and non-infectious diseases, including hepatitis, esophagitis, gastritis, dermatitis, arthritis, enteritis, vaginitis, pneumonia, cholangitis, Is selected.

또한, 본 발명은 개체에 본 발명의 키트를 부착하여 염증 유발 단백질의 발현을 억제하는 방법을 제공한다.The present invention also provides a method for inhibiting the expression of an inflammation-inducing protein by attaching the kit of the present invention to an individual.

본 발명의 일구현예에 있어서, 상기 개체는 포유동물인 것을 특징으로 한다.In one embodiment of the invention, the subject is a mammal.

본 발명의 다른 구현예에 있어서, 상기 염증 유발 단백질은 AP-1 또는 p38인 것을 특징으로 한다.In another embodiment of the present invention, the inflammation-inducing protein is AP-1 or p38.

본 발명의 염증질환 치료용 패치는, 양극 금속 패치와 음극 금속 패치의 전기 음성도 차이에 의해 전기적 자극을 발생시켜, 염증성 질환 관련 단백질의 발현을 억제하여, 사람에게 발생하는 감염성 및 비감염성의 모든 염증반응을 억제할 수 있으며, 이로 인해 염증성 질환을 치료할 수 있는 동시에 세포독성을 나타내지 않는 특징이 있으므로, 생체에 적용되더라도 부작용이 없는 장점이 있다.The patch for treating an inflammatory disease of the present invention generates electrical stimulation by a difference in electronegativity between a positive electrode metal patch and a negative electrode metal patch to inhibit the expression of an inflammatory disease related protein and to inhibit the infectious and non- It is possible to treat an inflammatory disease and to exhibit no cytotoxicity, so that it is advantageous in that it has no side effects even if it is applied to a living body.

도 1은 본 발명의 알루미늄 패치와 구리 패치가 부착된 스티커 시트의 사진이다.
도 2(A)는 본 발명의 알루미늄-구리 패치를 디쉬(dish)에 부착한 것을 보여주는 사진이고, 도 2(B)는 각각 식염수, RPMI1640 배지, 및 RAW264.7 세포를 배양한 RPMI1640 배지에서 본 발명의 패치 키트를 부착할 경우 전류가 발생함을 보여주는 도면이다.
도 3은 RAW264.7 세포 및 복막 대식세포에서의 NO의 생성량 비교 결과를 나타낸 것으로, 도 3(A)는 (a) 무처리, (b) LPS, (c) 알루미늄-구리 패치, (d) LPS와 알루미늄-구리 패치 처리할 때의 NO 생성량 값을 나타낸 것이고, 도 3(B)는 RAW264.7 세포에 pam3CSK를 처리할 경우(+)/처리하지 않을 경우(-)와 알루미늄-구리 패치를 처리할 경우(+)/처리하지 않을 경우(-)를 비교하여 나타낸 결과이며, 도 3(C)는 복막 대식세포에 (a) 무처리, (b) LPS, (c) 알루미늄-구리 패치, (d) LPS+알루미늄-구리 패치를 처리할 때의 NO생성량을 나타낸 도면이다.
도 4는 RAW264.7 세포에서의 PGE2의 생성량 비교 결과를 나타낸 것으로, 도 4(A)는 (a) LPS와 알루미늄-구리 패치 모두 처리하지 않을 경우, (b) LPS만 처리할 경우, (c) 알루미늄-구리 패치만 처리할 경우, (d) LPS와 알루미늄-구리 패치 모두 처리할 경우의 PGE2 생성량 값을 나타낸 것이고, 도 4(B)는 (a) pam3CSK와 알루미늄-구리 패치 모두 처리하지 않을 경우, (b) pam3CSK만 처리할 경우, (c) 알루미늄-구리 패치만 처리할 경우, (d) pam3CSK와 알루미늄-구리 패치 모두 처리할 경우의 PGE2 생성량 값을 나타낸 도면이다.
도 5는 RAW264.7 세포와 HEK293 세포를 알루미늄-구리 패치에 노출시켰을 때 세포의 생존활성을 나타낸 도면이다.
도 6은 염증 반응 관련 유전자(COX-2, iNOS, TNF-α, IL-1β, IL-6, IFN-β, 및 IL-12) 발현에 있어서 알루미늄-구리 패치 처리의 효과를 나타낸 도면이다.
도 7(A)는 (a) LPS와 알루미늄-구리 패치 모두 처리하지 않을 경우, (b) LPS만 처리할 경우, (c) 알루미늄-구리 패치만 처리할 경우, (d) LPS와 알루미늄-구리 패치 모두 처리할 경우의 COX-2 유전자 발현 정도를 나타낸 것이고, 도 7(B)는 (a) LPS와 알루미늄-구리 패치 모두 처리하지 않을 경우, (b) LPS만 처리할 경우, (c) 알루미늄-구리 패치만 처리할 경우, (d) LPS와 알루미늄-구리 패치 모두 처리할 경우의 iNOS 유전자 발현 정도를 나타낸 것이다.
도 8은 염증반응 전사인자(p65, c-Jun, 및 c-Fos)들의 활성화하는 세포핵 전위에 있어서의 알루미늄-구리 패치의 저해 효과를 보여주는 도면이다.
도 9는 알루미늄-구리 패치를 처리할 경우 ERK, JNK1/2, 및 p38 전사인자의 인산화가 저해되는 것을 보여주는 도면이다.
도 10(A)는 알루미늄-구리 패치를 처리할 경우, p38의 주요 인산화효소인 MKK3/6이 인산화되지 않는 것을 보여주는 결과이고, 도 10(B)는 알루미늄-구리 패치를 처리할 경우, p38의 탈인산화제인 MKP-1를 강화하지 않는 것을 보여주는 결과이며, 도 10(C)는 알루미늄-구리 패치의 처리가 p38의 인산화효소인 MKK3의 활성자체를 차단함을 보여주는 도면이다.1 is a photograph of an aluminum patch of the present invention and a sticky sheet to which a copper patch is attached.
FIG. 2 (A) is a photograph showing an aluminum-copper patch of the present invention adhered to a dish. FIG. 2 (B) is a photograph of the aluminum- FIG. 5 is a view showing that current is generated when the patch kit of the present invention is attached.
Fig. 3 (A) shows the results of a comparison between the amounts of NO production in RAW264.7 cells and peritoneal macrophages. Fig. 3 (A) FIG. 3 (B) shows the values of NO production when LPS and aluminum-copper patches are treated. FIG. 3 (B) shows the results of (-) treatment of pam3CSK with RAW264.7 cells (A) untreated, (b) LPS, (c) aluminum-copper patches, and (c) untreated peritoneal macrophages. (d) the amount of NO produced when treating an LPS + aluminum-copper patch.
FIG. 4 shows the results of comparing the amount of PGE 2 production in RAW264.7 cells. FIG. 4 (A) shows the results of (a) when LPS and aluminum- (b) shows the amount of PGE 2 produced when both the aluminum-copper patch and the aluminum-copper patch are treated; (c) if not, (b) if only handle pam3CSK, (c) an aluminum-copper patch only if the process, (d) pam3CSK and aluminum-diagram showing the PGE 2 production amount value in the case to handle both copper patch.
FIG. 5 is a graph showing the survival activity of cells when RAW 264.7 cells and HEK 293 cells were exposed to an aluminum-copper patch.
6 is a graph showing the effect of aluminum-copper patch treatment on the expression of inflammation-related genes (COX-2, iNOS, TNF- ?, IL-1 ?, IL-6, IFN- ?, and IL-12).
Figure 7 (A) shows the results of (a) LPS and aluminum-copper patches, (b) LPS only, (c) aluminum- FIG. 7 (B) shows the results of (a) when the LPS and the aluminum-copper patch are not treated, (b) when the LPS alone is treated, (D) iNOS gene expression when treated with both LPS and aluminum-copper patches.
Figure 8 is a plot showing the inhibitory effect of the aluminum-copper patch on the activating nuclear potential of inflammatory response transcription factors (p65, c-Jun, and c-Fos).
Figure 9 is a plot showing inhibition of ERK, JNK1 / 2, and p38 transcription factor phosphorylation upon treatment of an aluminum-copper patch.
10 (A) shows that when the aluminum-copper patch is treated, MKK3 / 6, the major phosphorylating enzyme of p38, is not phosphorylated. Fig. 10 (B) Fig. 10 (C) shows that the treatment of the aluminum-copper patch blocks the activity of MKK3, a phosphorylating enzyme of p38.

본 발명자들은 인체에 부작용이 없는 염증성 질환의 치료용 제재를 개발하기 위해 연구한 결과, 양극 금속 패치 및 음극 금속 패치를 개발하기에 이르렀다.The present inventors have studied to develop a medicament for the treatment of inflammatory diseases without adverse effects on the human body, and have developed a positive metal patch and a negative metal patch.

전기적으로 생성된 음 이온은 약한 전류를 발생시키고, 발생된 전류가 박테리아나 곰팡이의 성장을 억제할 수 있는 것이 알려져 있다(T. J. Berger, et al., "Antifungal properties of electrically generated metallic ions," Antimicrob Agents Chemother, vol. 10, no. 5, pp. 856-860, 1976 및 T. J. Berger, et al., "Electrically generated silver ions: quantitative effects on bacterial and mammalian cells," Antimicrob Agents Chemother, vol. 9, no. 2, pp. 357-358, 1976). It is known that electrically generated negative ions generate a weak current and that the generated current can inhibit the growth of bacteria or fungi (TJ Berger, et al., "Antifungal properties of electrically generated metallic ions," Antimicrob Agents Chemother, vol 10, no 5, pp 856-860, 1976 , and TJ Berger, et al,.. .. "Electrically generated silver ions: quantitative effects on bacterial and mammalian cells," Antimicrob Agents Chemother , vol. 9, no. 2, pp. 357-358, 1976).

이에, 본 발명자들은 전기음성도 차이가 나는 두 금속을 이용하여, 나노전류가 발생하는 것을 발견하여 연구한 결과, 두 금속 사이의 전기음성도 차이가 0.01 내지 1.75 일 때, 염증질환의 치료가 가능한 것을 확인하고 본 발명을 완성하였다.The inventors of the present invention have discovered that nanomagnetism is generated by using two metals having different electronegativity, and as a result, it is found that when the electronegativity difference between the two metals is 0.01 to 1.75, And completed the present invention.

따라서, 본 발명의 패치 키트는 양극과 음극의 두 금속의 전기 음성도 차이가 0.01 내지 1.75 범위이다. 그러므로, 본 발명의 패치 키트에 사용되는 금속은 양극 금속 패치와 음극 금속 패치의 전기 음성도 차이가 0.01 내지 1.75라면 이에 제한되지 않는다. 그 영역으로는 하기 도면의 금속이 모두 해당되나, 하기 금속 중에서 중금속이거나 순도가 낮아 세포독성이 있는 금속은 사용할 수 없다.Therefore, the patch kit of the present invention has a difference in electronegativity between the positive electrode and the negative electrode in the range of 0.01 to 1.75. Therefore, the metal used in the patch kit of the present invention is not limited thereto, as long as the difference in electronegativity between the positive metal patch and the negative metal patch is 0.01 to 1.75. The metal in all of the following diagrams is applicable as the region, but a heavy metal or a low purity metal having cytotoxicity can not be used in the following metals.

Figure 112012107131606-pat00001
Figure 112012107131606-pat00001

본 발명에서 쓰이는 금속은 세포독성이 없는 금속이어야 한다. 상기 세포독성이 없는 순도가 높은 금속 중 리튬, 마그네슘, 알루미늄, 아연, 철, 구리, 게르마늄, 금, 은, 백금 또는 주석으로부터 2 종(두 개) 이상 선택되어 사용될 수 있고, 가장 바람직하게는 알루미늄 및 구리를 선택할 수 있으나, 세포독성이 없는 금속이라면 종류에 제한은 없다.The metal used in the present invention should be a metal that is not cytotoxic. (Two or more) selected from among lithium, magnesium, aluminum, zinc, iron, copper, germanium, gold, silver, platinum or tin in the metal having high purity without cytotoxicity, And copper can be selected. However, there is no limitation in the kind of metal that is not cytotoxic.

또한, 상기 전기음성도 차이에 의해 발생하는 전류는 1nA 내지 2μA일 수 있고, 바람직하게는 본 발명의 실시예와 같이 50nA일 수 있으나, 상기 전기음성도차이에 의해 발생하는 전류라면 이에 제한되는 것은 아니다.In addition, the current generated by the electronegativity difference may be 1 nA to 2 μA, preferably 50 nA as in the embodiment of the present invention. However, the current generated by the electronegativity difference is limited to no.

본 발명의 패치의 형태는 정사각형, 직사각형, 다각형, 원형, 타원형, 격자형, 또는 침형일 수 있고, 바람직하게는 정사각형이나 직사각형일 수 있으나, 가장 바람직하게는 본 발명의 실시예와 같이 직사각형 형태로 사용되나, 이에 제한되는 것은 아니다. 특히, 직사각형으로 사용될 때 한 변의 길이는 1μm 내지 50cm일 수 있으나 역시 이에 제한되지 않는다.The shape of the patch of the present invention may be a square, a rectangle, a polygon, a circle, an ellipse, a lattice, or an acute, and preferably a square or a rectangle, but most preferably, But is not limited thereto. In particular, when used as a rectangle, the length of one side may be 1 μm to 50 cm, but is not limited thereto.

상기 패치는 바람직하게는 1μm 내지 200μm의 두께를 가질 수 있으며, 더욱 바람직하게는 15μm 내지 150μm의 두께일 수 있고, 가장 바람직하게는 본 발명의 일 실시예와 같이 17μm 내지 100μm 일 수 있으나, 전류를 잘 발생시킬 수 있는 두께라면 이에 한정되는 것은 아니다.The patch may have a thickness of preferably 1 to 200 탆, more preferably 15 to 150 탆, and most preferably 17 to 100 탆 as in an embodiment of the present invention, But the thickness is not limited thereto as long as it can be generated well.

또한, 상기 패치의 순도는 95% 내지 99.99% 일 수 있다. 만약 상기 금속들의 순도가 95% 미만일 경우, 금속 안에 포함되어 있을 수 있는 중금속의 독성으로 인해 세포가 죽을 수 있다.The purity of the patch may be 95% to 99.99%. If the purity of the metals is less than 95%, the cells may die due to the toxicity of heavy metals that may be contained in the metal.

본 발명의 알루미늄-구리 패치 키트를 이용하면 염증성 질환을 치료할 수 있다. 상기 염증성 질환은 간염, 식도염, 위염, 피부염, 관절염, 장염, 질염, 폐렴, 담도염, 담낭염, 또는 췌장염 중의 어느 하나일 수 있으나, 그 외 감염성 및/또는 비감염성의 모든 염증 질환일 수 있다.The aluminum-copper patch kit of the present invention can be used to treat inflammatory diseases. The inflammatory disease may be any one of hepatitis, esophagitis, gastritis, dermatitis, arthritis, enteritis, vaginitis, pneumonia, cholangitis, cholecystitis, or pancreatitis but all other infectious and / or noninfectious inflammatory diseases.

본 발명의 패치 키트는 한쪽 면에 접착제를 도포시켜 스티커 형태로 사용될 수 있다(도 1 참조).The patch kit of the present invention can be used in the form of a sticker by applying an adhesive on one side (see FIG. 1).

추가적으로, 본 발명의 패치 키트는 지지체를 통해 개체에 접착될 수 있다. 지지체는 앞면(사용시 피부에 노출되는 면)과 뒷면(사용시 환경에 노출되는 면)으로 구성된다. 지지체의 소재는 유리, 셀룰로오스 플라스틱(cellulose plastics; CA, CP), 폴리에틸렌(polyethylene, PE), 폴리에틸렌테레프탈레이트(polyethylene terephtalate, PET), 폴리비닐클로라이드(polyvinyl chlorides, PVCs), 폴리프로필렌(polypropylenes), 폴리스티렌(polystyrenes), 폴리카보네이트 (polycarbonates), 폴리아크릴릭 (polyacrylics), 폴리메틸메타크릴레이트(Poly (methyl methacrylate), PMMA), 또는 플로오로폴리머(fluoropolymers; 예를 들어, PTFE) 등 일 수 있으나 이에 제한되지 않으며, 개체에 접착되어 양극 금속 패치와 음극 금속 패치가 전류를 발생시킬 수 있는 것이라면 제한되지 않는다. Additionally, the patch kits of the present invention may be adhered to a subject via a support. The support is composed of the front surface (the surface exposed to the skin during use) and the back surface (the surface exposed to the environment during use). The support may be made of glass, cellulose plastics (CA), polyethylene (PE), polyethylene terephthalate (PET), polyvinyl chlorides (PVC), polypropylenes, But are not limited to, polystyrenes, polycarbonates, polyacrylics, poly (methyl methacrylate), PMMA, or fluoropolymers (e.g., PTFE) And is not limited as long as it is adhered to the object so that the anode metal patch and the cathode metal patch can generate electric current.

본 발명자들은 본 발명의 실시예에서, 양극 금속 패치로는 알루미늄을, 음극 금속 패치로는 구리를 선택하여 실험하였다. 본 발명의 양극-음극 금속 패치 키트가 세포배양배지에서 전류가 생성하는지를 알아보기 위해, 알루미늄-구리 패치가 있는 경우와 없는 경우와 알루미늄-구리 패치가 있는 경우를 비교하여, 전류가 생성됨을 확인하였다(실시예 1 참조).In the embodiment of the present invention, the present inventors selected aluminum as a positive metal patch and copper as a negative metal patch. To see if the positive electrode-negative electrode metal patch kit of the present invention produces current in the cell culture medium, it was confirmed that a current was generated by comparing the case with and without the aluminum-copper patch and the case with the aluminum-copper patch (See Example 1).

이에, 알루미늄-구리 패치가 전류를 생성시킨다면 세포 안에서 반응 환경을 변경시킬 수 있는 것이므로, 염증 반응을 조절할 수 있는지 실험한 결과, 알루미늄-구리 패치 키트를 부착할 경우, 염증과 관련 있는 것으로 알려진 NO, PGE2, 및 TNF-α의 생성량이 현저히 적으며, 알루미늄-구리 패치가 부착된 경우에도 세포의 생존활성이 유지되는 것을 확인하였다(실시예 3 참조).Therefore, it is possible to control the inflammatory reaction by changing the reaction environment inside the cell if the aluminum-copper patch generates electric current. As a result, when the aluminum-copper patch kit is attached, PGE 2 , and TNF-α was remarkably reduced, and the survival activity of the cells was maintained even when the aluminum-copper patch was attached (see Example 3).

또한, 염증반응과 관련된 전사 인자(NF-κB, AP-1, CREB, 및 STAT-1)들의 발현을 RT-PCT을 사용하여 정량한 결과, 상기 유전자의 발현이 알루미늄-구리 패치로 인해 억제되는 것을 확인하였다(실시예 4 참조).In addition, the expression of transcription factors (NF-κB, AP-1, CREB, and STAT-1) associated with the inflammatory response was quantified using RT-PCT and the expression of the gene was inhibited by the aluminum- (See Example 4).

아울러, 염증 반응에서 염증 유발 단백질들의 발현은 인산화 반응에 의해 일어나므로, 알루미늄-구리 패치가 염증성 반응 단백질의 인산화 자체를 방지하는지 확인하기 위해 면역블롯을 수행한 결과, p38가 인산화하지 못하게 한다는 것을 확인하였다(실시예 4-2 참조).In addition, since the expression of inflammatory proteins in the inflammatory reaction is caused by the phosphorylation reaction, immunoblotting is performed to confirm that the aluminum-copper patch prevents the phosphorylation of the inflammatory response protein. As a result, (See Example 4-2).

그러므로, 본 발명은 개체에 알루미늄-구리 패치 키트를 부착하여 AP-1 및 p38 단백질의 발현을 억제하는 방법을 제공할 수 있으며, 상기 개체는 포유동물인 것을 특징으로 한다.Therefore, the present invention can provide a method for inhibiting the expression of AP-1 and p38 proteins by attaching an aluminum-copper patch kit to an individual, characterized in that said individual is a mammal.

상기 포유동물은 사람, 개, 말, 양, 돼지, 또는 고양이 등일 수 있으나, 이에 제한되지는 않는다.
The mammal may be, but is not limited to, a person, a dog, a horse, a sheep, a pig, or a cat.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[[ 재료예Material example ]]

본 발명에서는 세포 독성이 없는 금속으로 알루미늄과 구리를 선정하였으며, 이때, 알루미늄-구리 패치(nanocurrent-generating aluminum-copper patch, NGACP)는 Human Nano Electrotech (Seoul, Korea, 상품명 : 팜디밴드)로부터 공급 받았고, Pam3CSK; 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, a tetrazole (MTT); 및 리포폴리사카라이드(lipopolysaccharide, E. coli 0111:B4; 이하 LPS로 통칭)는 Sigma Chemical Co.(St. Louis, MO)로부터 구입했다.In the present invention, aluminum and copper were selected as a metal having no cytotoxicity, and a nanocurrent-generating aluminum-copper patch (NGACP) was supplied from Human Nano Electrotech (Seoul, Korea, , Pam3CSK; 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide, a tetrazole (MTT); And lipopolysaccharide ( E. coli 0111: B4, hereinafter collectively referred to as LPS) were purchased from Sigma Chemical Co. (St. Louis, Mo.).

또한, 프로스타글란딘 E2(Prostaglandin E2, 이하 PGE2) 및 TNF-α 레벨의 결정을 위하여 사용되는 Enzyme immunoassay (EIA) 키트 및 enzyme-linked immunosorbent assay (ELISA) 키트는 Amersham (Little Chalfont, Buckinghamshire, UK)으로부터 구입했다.Enzyme immunoassay (EIA) kits and enzyme-linked immunosorbent assay (ELISA) kits used for the determination of prostaglandin E2 (PGE 2 ) and TNF-α levels were also purchased from Amersham (Little Chalfont, Buckinghamshire, UK) I bought.

배양 배지에 넣어주는 소태아혈청 (Fetal bovine serum, FBS) 및 RPMI 1640 배양 배지는 GIBCO (Grand Island, NY) 로부터 구입하였고, RAW264.7 및 HEK293 세포주는 ATCC (Rockville, MD)로부터 구입하였으며, 기타 다른 재료들은 분석용 등급인 것으로 Sigma로부터 공급받아 사용하였다. 여기서 RAW264.7 세포주는 염증관련 실험에서 주로 사용되는 세포주이고, HEK293 세포주는 형질 주입이 잘되는 세포주로, 유전자 치료에 있어서 치료용 단백질 및 바이러스를 제조하는 것에 널리 사용된다.Fetal bovine serum (FBS) and RPMI 1640 culture medium were purchased from GIBCO (Grand Island, NY), RAW264.7 and HEK293 cell lines were purchased from ATCC (Rockville, MD) Other materials were analytical grades supplied by Sigma. Here, the RAW264.7 cell line is a cell line mainly used in inflammation-related experiments, and the HEK293 cell line is a well-transfected cell line, and is widely used for producing therapeutic proteins and viruses in gene therapy.

또한, c-Fos, c-Jun, extracellular signal-related kinase (ERK), c-Jun N-terminal kinase (JNK), p38, mitogen-activated protein kinase kinase 3/6 (MKK3/6), MKP-1, lamin A/C, 및 β-actin에 대한 인산화 특이적 (Phospho-specific) 항체 또는 기타 다른 항체들은 Cell Signaling(Beverly, MA)으로부터 구입하여 사용하였다.
In addition, c-Jun, extracellular signal-related kinase (ERK), c-Jun N-terminal kinase (JNK), p38, mitogen-activated protein kinase kinase 3/6 (MKK3 / 6) , lamin A / C, and β-actin were purchased from Cell Signaling (Beverly, Mass.) and used.

알루미늄-구리 패치의 전류 생성 측정Current generation measurement of aluminum-copper patch

알루미늄-구리 패치의 제조는, 99.92%의 순도를 가진 구리를 이용하여, 100μm의 두께를 가지는 1cm2 넓이의 금속판이 되도록 연마하여 제조되는 구리 패치를 음극(cathode)으로 사용했고, 알루미늄 패치(순도 99.70%, 두께 17μm, 넓이 1cm2)도 같은 방법으로 제조하여 양극(anode)으로 사용했다.The aluminum-copper patch was prepared by using copper having a purity of 99.92%, a copper patch prepared by polishing so as to be a 1 cm 2 wide metal plate having a thickness of 100 탆, as a cathode, and an aluminum patch 99.70%, thickness 17 탆, width 1 cm 2 ) was manufactured in the same manner and used as an anode.

알루미늄-구리 패치가 세포배양배지에서 전류를 생성하는지 알아보기 위해, 알루미늄-구리 패치가 없는 경우와 있는 경우를 비교하여 전류 생성정도를 측정하였다. 두 전극(양극 및 음극)을 multimeter(DMM 4040, Tektronix, USA)에 양면테이프로 부착하여 식염수 또는 각 세포배양배지(식염수, RPMI1640, 및 RAW264.7가 배양된 RPMI1640)에 가라앉혀, 생성되는 전류를 관찰했다.To determine whether the aluminum-copper patch produced currents in the cell culture medium, the degree of current generation was measured by comparing the case with and without the aluminum-copper patch. The two electrodes (anode and cathode) were attached to a multimeter (DMM 4040, Tektronix, USA) with double-sided tape and immersed in saline or each cell culture medium (RPMI1640 with saline, RPMI1640, and RAW264.7) .

그 결과, 도 2A 오른쪽에 나타낸 바와 같이, 알루미늄-구리 패치가 있는 배지는 35 nA 내지 55 nA의 나노-레벨의 전류를 생성시켰고, 도 2A의 왼쪽에 나타낸 바와 같이, 알루미늄-구리 패치가 없는 배지는 전류 생성이 전혀 발견되지 않았다. 이 결과를 통해, 세포배양배지에서 구리와 알루미늄 패치가 나노전류를 생성시켜, 세포의 반응 환경을 변경할 수 있다는 것을 알 수 있었다. 이에, 본 발명자들은 알루미늄-구리 패치 처리가 대식세포의 염증 반응을 조절할 수 있는지 실험하였고, 알루미늄-구리 패치의 염증 반응 저해 메커니즘을 연구했다.
As a result, as shown on the right side of Fig. 2A, the medium with the aluminum-copper patch produced a nano-level current of 35 nA to 55 nA, and as shown on the left side of Fig. 2A, No current generation was found at all. These results show that the copper and aluminum patches in the cell culture medium can generate nanocrystals and change the reaction environment of the cells. Thus, the present inventors have examined whether the aluminum-copper patch treatment can control the inflammatory response of macrophages and studied the mechanism of inhibition of inflammation of aluminum-copper patches.

세포의 배양Cell culture

<2-1> 대식 세포의 준비<2-1> Preparation of macrophages

대식세포의 추출을 위해, C57BL/6 수컷 마우스 (6 내지 8주령, 17 내지 21 g)는 DAEHAN BIOLINK (Chungbuk, Korea) 로부터 구입하여 일반적인 환경에서 물과 먹이를 자율배식하여 사육했다. 실험은 Sungkyunkwan University Institutional Animal Care and Use Committee의 가이드라인에 따라 수행되었다.For the extraction of macrophages, C57BL / 6 male mice (6-8 weeks old, 17-21 g) were purchased from DAEHAN BIOLINK (Chungbuk, Korea) and fed with water and food in a normal environment. Experiments were performed according to the guidelines of the Sungkyunkwan University Institutional Animal Care and Use Committee.

복막 대식세포는 C57BL/6 수컷 마우스(7 내지 8주령, 무게 17 내지 21 g)로부터 1 ml의 4% 티오글리콜레이트 배지(Difco Laboratories, Detroit, MI)를 마우스의 복강 내에 주사하여 4일 후 적출한 뒤, 2% FBS를 포함한 RPMI 1640 배양액으로 세척하여 얻어냈다. 상기 복막 대식세포 (1×106 cells/ml)는 100-mm의 배양접시에 4시간 동안 37℃에서 5% CO2 습도 하에 놔두었다.
Peritoneal macrophages were extracted from the C57BL / 6 male mice (7-8 weeks old, weight 17-21 g) by intraperitoneal injection of 1 ml of 4% thioglycolate medium (Difco Laboratories, Detroit, MI) And then washed with RPMI 1640 medium containing 2% FBS. The peritoneal macrophages (1 × 10 6 cells / ml) were left in a 100-mm culture dish for 4 hours at 37 ° C. and 5% CO 2 humidity.

<2-2> 세포 배양 환경 조성<2-2> Preparation of cell culture environment

복막 대식세포 및 세포주(RAW264.7 및 HEK293 cells)는 10% 열비활성 소태아혈청(heat-inactivated fetal bovine serum; Gibco, Grand Island, NY), 글루타민(glutamine), 및 항생제(penicillin and streptomycin)를 첨가한 RPMI 1640 배지에서 37°C, 5% CO2 조건 하에서 배양되었다. 각각의 실험을 위해, 세포 스크래퍼를 이용하여 세포를 떼어냈다. 세포들은 Trypan blue dye exclusion을 통해 알아본 결과 실험을 위한 2×106 cells/ml의 밀도에서 죽은 세포의 비율이 1% 미만으로 측정되어 실험에 알맞음을 확인하였다.
Peritoneal macrophages and cell lines (RAW264.7 and HEK293 cells) were treated with 10% heat-inactivated fetal bovine serum (Gibco, Grand Island, NY), glutamine and antibiotics (penicillin and streptomycin) And cultured in RPMI 1640 medium supplemented at 37 ° C, 5% CO 2 . For each experiment, cells were removed using a cell scraper. Cells were examined by trypan blue dye exclusion and found that the ratio of dead cells at the density of 2 × 10 6 cells / ml for the experiment was less than 1%, which was appropriate for the experiment.

<2-3> <2-3> NONO , , PGEPGE 22 , 및 , And TNFTNF -α의 발현 촉진-α promoting expression

RAW264.7 세포 또는 복막 대식세포(1×106 cells/ml)를 18시간 동안 회복시킨 후, 상기 세포 배양액에 알루미늄-구리 패치를 부착하여 30분 동안 방치하고, LPS(1 μg/ml)에서 24시간 동안 배양하였다. 여기서 LPS는 염증 유발 인자, 즉 NO, PGE2, TNF-α의 발현을 촉진시키는 용도로 사용되는 것이다.
RAW264.7 cells or peritoneal macrophages (1 x 10 6 cells / ml) were allowed to recover for 18 hours. Then, the cell culture medium was allowed to stand for 30 minutes with an aluminum-copper patch attached thereto, And cultured for 24 hours. Here, LPS is used for promoting the expression of inflammatory factors such as NO, PGE 2 , and TNF- ?.

NONO 및  And PGEPGE 22 생성량 분석 및 독성 테스트 Quantity analysis and toxicity testing

<3-1> <3-1> NONO 생성량 분석 Yield analysis

알루미늄-구리 패치를 처리할 경우, NO, PGE2, 및 TNF-α의 생성을 저해하는지를 알아보기 위하여, the Griess 시약 및 ELISA 키트를 사용하여 분석했다.To investigate whether treatment of aluminum-copper patches inhibited the production of NO, PGE 2 , and TNF- ?, the Griess reagent and an ELISA kit were used.

LPS 또는 pam3CSK로 자극되어진 RAW264.7 세포와 복막 대식세포를 18시간에 걸쳐 전보온(preincubation)시킨 후, 알루미늄-구리 패치를 부착하여 24시간 동안 배양 시켰다. 세포독성(cytotoxic)은 전통적인 방법인 MTT assay를 사용하여 평가했다. 배양 종료를 3시간 앞두고, MTT 용액(10 mg/ml in phosphate buffered saline, pH 7.4) 10 μl를 각 well에 첨가해주고, 실험이 종료될 때까지 계속하여 배양했다. 이후 각 well에 15% sodium dodecyl sulfate를 각 well에 첨가하여 배양을 중단시키고, 포르마잔(formazan)을 용해시켜 생존세포를 보라색으로 환원시켰다. 이를 통해, 570 nm(O.D. 570-630)의 흡광도가 Spectramax 250 microplate reader를 사용하여 측정되었다.RAW264.7 cells stimulated with LPS or pam3CSK and peritoneal macrophages were preincubated for 18 hours and then incubated with an aluminum-copper patch for 24 hours. Cytotoxicity was assessed using the MTT assay, a traditional method. Three hours before the end of the culture, 10 μl of MTT solution (10 mg / ml in phosphate buffered saline, pH 7.4) was added to each well and cultured continuously until the end of the experiment. Then, 15% sodium dodecyl sulfate was added to each well to stop the culture, and formazan was dissolved to reduce viable cells to purple. The absorbance at 570 nm (OD 570-630) was measured using a Spectramax 250 microplate reader.

그 결과, NO 생성량의 경우 흥미롭게도 도 3(A)에 나타낸 바와 같이, RAW264.7 세포는 무처리(Normal)일 때(a), LPS를 처리할 때(b), 알루미늄-구리 패치를 처리했을 때(c), LPS와 알루미늄-구리 패치를 모두 처리할 때(d), LPS만 처리할 때보다 LPS와 알루미늄-구리 패치를 모두 처리할 때의 NO 생성량이 현저히 적은 것을 확인하였다. Interestingly, as shown in Fig. 3 (A), RAW264.7 cells were treated with (a) untreated (Normal), treated with LPS (b), treated with aluminum- (C), when both LPS and aluminum-copper patches were treated (d), the amount of NO produced when treating both LPS and aluminum-copper patches was significantly less than when LPS alone was treated.

또한, 도 3(B)에 나타낸 바와 같이, pam3CSK로 자극된 RAW264.7 세포는 알루미늄-구리 패치가 처리될 경우의 NO 생성량은 6μm 이하로, pam3CSK만 처리될 때와 비교하여 현저히 적었다.In addition, as shown in Fig. 3 (B), RAW264.7 cells stimulated with pam3CSK showed significantly less NO production when the aluminum-copper patch was treated than 6 μm, compared with when pam3CSK alone was treated.

아울러, 복막 대식세포의 경우를 도 3(C)에 나타내었는데, 복막 대식세포는 무처리(Normal)일 때(a), LPS를 처리할 때(b), 알루미늄-구리 패치를 처리했을 때(c), LPS와 알루미늄-구리 패치를 모두 처리할 때(d)를 비교한 결과, 알루미늄-구리 패치를 처리할 때 NO의 생성량이 줄어드는 것을 확인할 수 있었다.
Fig. 3 (C) shows the results of peritoneal macrophages. In the case of peritoneal macrophages (a), LPS treatment (b), and aluminum-copper patch treatment c), the comparison of (d) when treating both LPS and aluminum-copper patches showed that the amount of NO produced was reduced when the aluminum-copper patch was treated.

<3-2> <3-2> PGEPGE 22 생성량 분석 Yield analysis

PGE2의 생성량은 도 4(A)에 나타낸 바와 같이, RAW264.7 세포에서 또한 LPS만 처리할 때(b)와 비교하여 LPS와 알루미늄-구리 패치를 함께 처리한 경우(d)가 PGE2의 생성량이 현저히 낮은 것을 확인하였다.As shown in amount is 4 (A) also of PGE 2, in RAW264.7 cell also LPS and aluminum as compared to (b) in the handling only LPS - when treated with the copper patches (d) of PGE 2 It was confirmed that the production amount was remarkably low.

또한, 도 4(B)에 나타낸 바와 같이, pam3CSK로 자극된 RAW264.7 세포의 PGE2의 생성량은 알루미늄-구리 패치가 처리될 경우 60μm 이하로, pam3CSK만 처리될 때 PGE2의 생성량이 약 100μm인 것과 비교하여 현저히 적었다.
In addition, as shown in Fig. 4 (B), the amount of PGE 2 produced in RAW 264.7 cells stimulated with pam 3 CSK was 60 μm or less when the aluminum-copper patch was treated, and the amount of PGE 2 produced when pam 3 CSK alone was treated was about 100 μm As compared with that of the conventional method.

<3-3> 세포 생존활성 테스트(<3-3> Test for cell viability ( cellcell viabilityviability testtest ))

아울러, 도 5에 나타낸 바와 같이, RAW264.7 및 HEK293 세포에 알루미늄-구리 패치 처리하여도 생존활성을 그대로 유지함을 보여주므로, 알루미늄-구리 패치 처리는 생체 내에서 비독성이라는 것을 알 수 있다.In addition, as shown in FIG. 5, it was shown that even when the RAW 264.7 and HEK 293 cells were subjected to the aluminum-copper patch treatment, the survival activity remained unchanged. Thus, it can be seen that the aluminum-copper patch treatment is non-toxic in vivo.

상기 결과를 통해, 알루미늄-구리 패치 처리는 LPS나 pam3CSK에 의해 유도되는 염증성 반응을 억제 할 수 있을 뿐만 아니라, 생체 내에서 비독성이라는 결론을 얻을 수 있었다.
From the above results, it was concluded that the aluminum-copper patch treatment not only inhibited the inflammatory reaction induced by LPS or pam3CSK, but was also non-toxic in vivo.

알루미늄-구리 패치가 염증 관련 인자에 미치는 영향 분석Analysis of effect of aluminum-copper patch on inflammation related factors

<4-1> <4-1> RTRT -- PCRPCR (( realreal -- timetime reversereverse transcriptasetranscriptase polymerase중합체 chainchain reactionreaction )을 이용한 염증반응 관련 유전자들의 ) Of the inflammatory response-related genes mRNAmRNA 레벨 분석 Level analysis

사이토카인 mRNA 표현 레벨 결정을 위해, 전체 RNA가 LPS-처리 RAW264.7 세포로부터 TRIzol Reagent (Gibco BRL)를 사용하여 분리되었다. 전체 RNA는 사용 전까지 영하 70℃에서 보관되었으며, mRNA의 정량은 real-time RT-PCR (SYBR Premix Ex Taq, Takara, Japan)과 real-time thermal cycler (Bio-Rad, Hercules, CA)를 사용하여 수행되었다. For cytokine mRNA expression level determination, total RNA was isolated from LPS-treated RAW 264.7 cells using TRIzol Reagent (Gibco BRL). The total RNA was stored at minus 70 ° C until use and mRNA was quantified using real-time RT-PCR (SYBR Premix Ex Taq, Takara, Japan) and real-time thermal cycler (Bio-Rad, Hercules, CA) .

NO 및 PGE2 생성의 저해 효과를 확인하기 위하여, 전사 레벨에 있어서의 저해를 측정했다. 알루미늄-구리 패치 처리 하에서 COX-2, iNOS, TNF-α, IL-1β, IL-6, IFN-β, and IL-12 과 같은 염증반응과 관련된 유전자들의 mRNA 레벨을 측정하였다(대조군 GAPDH). 그 결과 도 6에 나타낸 바와 같이, IL-1β를 제외한 대부분의 염증반응 관련 유전자들의 발현은 알루미늄-구리 패치 처리에 의해 억제되었다.In order to confirm the inhibitory effect of NO and PGE 2 production, the inhibition at the transcription level was measured. MRNA levels of the genes involved in inflammatory reactions such as COX-2, iNOS, TNF-α, IL-1β, IL-6, IFN-β and IL-12 were measured (control GAPDH) under aluminum-copper patching. As a result, as shown in Fig. 6, expression of most of the inflammatory reaction-related genes except IL-1β was inhibited by aluminum-copper patch treatment.

결과는 GAPDH에 대한 광학밀도로 표현하였다. 또한, mRNA 표현 레벨의 양적 평가를 위해 semi-quantitative RT reactions을 수행하였으며, 사용된 프라이머(Bioneer, Daejeon, Korea)는 하기 표 1에 기재하였다.
The results are expressed as optical density for GAPDH. Semi-quantitative RT reactions were also performed for quantitative evaluation of mRNA expression levels. The primers used (Bioneer, Daejeon, Korea) are listed in Table 1 below.

Name Name SequenceSequence (5'  (5 ' toto 3')  3 ') Real-time PCR Real-time PCR iNOS iNOS FF GGA GCC TTT AGA CCT CAA CAG A GGA GCC TTT AGA CCT CAA CAGE RR TGA ACG AGG AGG GTG GTG TGA ACG AGG AGG GTG GTG COX-2 COX-2 FF GGGAGTCTGGAACATTGTGA GGGAGTCTGGAACATTGTGA RR GCACATTGTAAGTAGGTGGA GCACATTGTAAGTAGGTGGA TNF-αTNF-a FF TGC CTA TGT CTC AGC CTC TT TGC CTA TGT CTC AGC CTC TT RR GAG GCC ATT TGG GAA CTT CT GAG GCC ATT TGG GAA CTT CT GAPDH GAPDH FF CAA TGA ATA CGG CTA CAG CAA C CAA TGA ATA CGG CTA CAG CAA C RR AGG GAG ATG CTC AGT GTT GG AGG GAG ATG CTC AGT GTT GG Semiquantitative RT-PCR Semiquantitative RT-PCR TNF-αTNF-a FF TTGACCTCAGCGCTGAGTTG TTGACCTCAGCGCTGAGTTG RR CCTGTAGCCCACGTCGTAGC CCTGTAGCCCACGTCGTAGC IL-1βIL-1? FF CAGGATGAGGACATGAGCACC CAGGATGAGGACATGAGCACC RR CTCTGCAGACTCAAACTCCAC CTCTGCAGACTCAAACTCCAC IL-6 IL-6 FF GTACTCCAGAAGACCAGAGG GTACTCCAGAAGACCAGAGG RR TGCTGGTGACAACCACGGCC TGCTGGTGACAACCACGGCC COX-2 COX-2 FF CACTACATCCTGACCCACTT CACTACATCCTGACCCACTT RR ATGCTCCTGCTTGAGTATGT ATGCTCCTGCTTGAGTATGT iNOS iNOS FF CCCTTCCGAAGTTTCTGGCAGCAGC` CCCTTCCGAAGTTTCTGGCAGCAGC` RR GGCTGTCAGAGCCTCGTGGCTTTGG GGCTGTCAGAGCCTCGTGGCTTTGG IFN-βIFN-beta FF CCACCACAGCCCTCTCCATCAACTAT CCACCACAGCCCTCTCCATCAACTAT RR CAAGTGGAGAGCAGTTGAGGACATC CAAGTGGAGAGCAGTTGAGGACATC IL-12 IL-12 FF CAGAAGCTAACCATCTCCTGGTTTG CAGAAGCTAACCATCTCCTGGTTTG RR TCCGGAGTAATTTGGTGCTTCACAC TCCGGAGTAATTTGGTGCTTCACAC GAPDH GAPDH FF CACTCACGGCAAATTCAACGGCAC CACTCACGGCAAATTCAACGGCAC RR GACTCCACGACATACTCAGCA GACTCCACGACATACTCAGCA

이에 더하여, 염증 반응 관련 유전자들은 도 7에 나타낸 바와 같이, 모두 iNOS(도 7A 참조) 및 COX-2(도 7B 참조)와 비슷한 발현 패턴을 나타내었다.In addition, the inflammatory response-related genes showed an expression pattern similar to that of iNOS (see FIG. 7A) and COX-2 (see FIG. 7B), as shown in FIG.

상기 결과로부터 LPS에 의해 유도된 염증반응의 전사활성화는 알루미늄-구리 패치의 표적이 될 수 있다는 결론을 얻을 수 있다.
From the above results, it can be concluded that the transcription activation of the inflammatory response induced by LPS can be the target of the aluminum-copper patch.

<4-2> 총 <4-2> Total 용균액Fungus solution , 핵 추출물 제조 및 면역블롯(, Nuclear extract preparation and immunoblotting ( immunoblottingimmunoblotting ))

알루미늄-구리 패치를 미리 처리해둔 LPS-treated RAW264.7 세포로부터 용균액 및 핵추출물을 얻어내어 인산화 정도, 또는 전체 전사인자 (p65, c-Jun, 및 c-Fos), lamin A/C, MAPKs (ERK, p38, 및 JNK), MKK 3/6, MKP-1, 및 β-actin에 대한 면역블롯 분석을 수행하였다.(P65, c-Jun, and c-Fos), lamin A / C, and MAPKs were obtained from LPS-treated RAW264.7 cells pretreated with aluminum- (ERK, p38, and JNK), MKK 3/6, MKP-1, and p-actin.

그 결과, 도 8에 나타낸 바와 같이, 알루미늄-구리 패치 처리는 6시간 처리할 경우 c-Jun의 세포핵 전위를 대부분 차단하고, 다른 전사 인자들 또한 저해된다는 것을 알 수 있다. 따라서, c-Jun은 대표적인 ERK, p38 및 JNK 효소의 전사 인자이므로, 상기 효소들의 활성이 알루미늄-구리 패치 처리에 의해 차단됨을 확인하기 위하여 인산화반응 레벨 분석을 실시하였다.As a result, as shown in FIG. 8, it can be seen that aluminum-copper patch treatment mostly blocks the nuclear potential of c-Jun when treated for 6 hours, and other transcription factors are also inhibited. Thus, c-Jun is a transcription factor for typical ERK, p38, and JNK enzymes, so phosphorylation level analysis was performed to confirm that the activity of the enzymes was blocked by aluminum-copper patch treatment.

그 결과는 도 9에 나타낸 바와 같이, 반응 1시간 만에 ERK, JNK1/2, p38의 인산화는 알루미늄-구리 패치 처리에 의해 강하게 저해되었다.As shown in Fig. 9, the phosphorylation of ERK, JNK1 / 2, and p38 was strongly inhibited by the aluminum-copper patch treatment within 1 hour of the reaction.

특히, p38의 주요 인산화효소인 MKK3/6가 인산화되지 않으며(도 10(A) 참조), p38의 탈인산화제인 MKP-1을 강화하지 않았다(도 10(B) 참조). 이에 따라, 도 10(C)에 나타낸 바와 같이, 알루미늄-구리 패치 처리는 MKK3의 인산화 자체를 방지하여, p38 또한 인산화하지 못하게 하므로 p38 및 인산화된 p38 또한 발현되지 않는다는 것을 발견하였다(도 10(C) 참조).In particular, MKK3 / 6, the major phosphorylating enzyme of p38, was not phosphorylated (see Fig. 10 (A)) and did not enhance MKP-1, a phosphorylation oxidizing agent of p38 (see Fig. 10 (B)). Thus, as shown in Fig. 10 (C), it was found that the aluminum-copper patch treatment prevented the phosphorylation of MKK3 itself and prevented p38 also from phosphorylating, so that p38 and phosphorylated p38 were also not expressed ) Reference).

상기 발견은, MKK3/p38 경로가 염증 반응을 저해하는 알루미늄-구리 패치 처리의 주된 타겟이 될 수 있다는 것을 의미한다. 또한 LPS가 활성화된 RAW264.7 세포에 특이적인 저해제인 SB203580(이하 SB)를 사용하여, 염증 반응에 있어서 p38의 기능적 중요성을 확인하였다. SB는 또한 COX-2 및 TNF-α mRNA의 발현을 억제하고(도 10(A) 참조), TNF-α 및 PGE2 방출을 저해하였다(도 10(B) 참조).
This discovery implies that the MKK3 / p38 pathway may be a major target for aluminum-copper patch processing that inhibits the inflammatory response. In addition, SB203580 (hereinafter referred to as SB), an inhibitor specific to LPS-activated RAW264.7 cells, was used to confirm the functional significance of p38 in the inflammatory response. SB also inhibited the expression of COX-2 and TNF- alpha mRNA (see Fig. 10 (A)) and inhibited TNF- [alpha] and PGE 2 release (Fig. 10 (B)).

상기로부터, 본 발명의 알루미늄-구리 패치를 처리하면, p38의 인산화를 억제하는 것이 가능하고, 염증 반응을 일으키는 NO 및 PGE2의 생성을 저해할 수 있으며, 세포독성이 없음을 알 수 있다. 즉, 염증을 유발하는 p38/AP-1 경로에 본 발명에 따른 알루미늄-구리 패치를 처리할 경우, 염증 반응을 방지할 수 있는 효과가 있다.From the above, the aluminum of the present invention when processing a copper patch, it is possible to inhibit the phosphorylation of p38, and can inhibit the production of NO and PGE 2, causing an inflammatory response, it can be seen that there is no cytotoxicity. That is, when the aluminum-copper patch according to the present invention is applied to the p38 / AP-1 pathway leading to inflammation, an inflammatory reaction can be prevented.

따라서 상기 결과들은 알루미늄-구리 패치 처리가 관절염이나 대장염과 같은 여러 염증성 질환에 있어 부작용없이 적용될 수 있다는 것을 의미한다.
Thus, the above results indicate that the aluminum-copper patch treatment can be applied without side effects in various inflammatory diseases such as arthritis or colitis.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해되어야 한다.It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Claims (12)

양극 금속 패치 및 음극 금속 패치를 포함하는 감염 및 비감염성 염증질환 치료용 패치 키트로서,
상기 양극 금속 패치 및 음극 금속 패치의 전기음성도 차이는 0.01 내지 1.75 이고,
상기 전기음성도 차이에 의해 발생하는 전류는 1nA 내지 2μA 인 것을 특징으로 하는, 키트.
1. A patch kit for treating infectious and noninfectious inflammatory diseases, comprising a positive metal patch and a negative metal patch,
The difference in electronegativity of the positive metal patch and the negative metal patch is from 0.01 to 1.75,
Wherein the current generated by the electronegativity difference is between 1 nA and 2 uA.
삭제delete 삭제delete 제 1항에 있어서,
상기 금속은 세포독성이 없는 금속으로, 상기 세포독성이 없는 금속은 리튬, 마그네슘, 알루미늄, 아연, 철, 구리, 게르마늄, 금, 은, 백금, 및 주석으로 이루어지는 군으로부터 2종 이상 선택되는 것을 특징으로 하는, 패치 키트.
The method according to claim 1,
The metal is not cytotoxic and the metal that is not cytotoxic is selected from the group consisting of lithium, magnesium, aluminum, zinc, iron, copper, germanium, gold, silver, platinum and tin As a patch kit.
삭제delete 제 1항에 있어서,
상기 패치의 형태는 직사각형, 다각형, 원형, 타원형, 격자형, 침형, 및 무정형으로 이루어지는 군으로부터 선택되는 것을 특징으로 하는, 패치 키트.
The method according to claim 1,
Wherein the shape of the patch is selected from the group consisting of a rectangle, a polygon, a circle, an ellipse, a lattice, an acute, and an amorphous.
제 1 항에 있어서,
상기 패치는 1μm 내지 100μm의 두께를 가지는 것을 특징으로 하는, 패치 키트.
The method according to claim 1,
Characterized in that the patch has a thickness of 1 [mu] m to 100 [mu] m.
제 1항에 있어서,
상기 양극 금속 및 음극 금속의 순도는 95% 내지 99.99% 인 것을 특징으로 하는, 패치 키트.
The method according to claim 1,
Wherein the purity of the positive electrode metal and the negative electrode metal is 95% to 99.99%.
제 1항에 있어서,
상기 염증질환은 간염, 식도염, 위염, 피부염, 관절염, 장염, 질염, 폐렴, 담도염, 담낭염, 및 췌장염으로 이루어지는 군으로부터 선택되는 것을 특징으로 하는, 패치 키트.
The method according to claim 1,
Wherein the inflammatory disease is selected from the group consisting of hepatitis, esophagitis, gastritis, dermatitis, arthritis, enteritis, vaginitis, pneumonia, cholangitis, cholecystitis, and pancreatitis.
인간을 제외한 포유동물에 제 1항의 패치 키트를 부착하여 염증 유발 단백질의 발현을 억제하는 방법.
A method for inhibiting the expression of an inflammation-inducing protein by attaching the patch kit of claim 1 to a mammal other than a human.
삭제delete 제 10항에 있어서,
상기 염증 유발 단백질은 AP-1 또는 p38인 것을 특징으로 하는 방법.
11. The method of claim 10,
Wherein the inflammation inducing protein is AP-1 or p38.
KR1020120152103A 2012-12-24 2012-12-24 Patch kits for the treatment for infectious or noninfectious inflammatory disease and uses thereof KR101445005B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020120152103A KR101445005B1 (en) 2012-12-24 2012-12-24 Patch kits for the treatment for infectious or noninfectious inflammatory disease and uses thereof
PCT/KR2013/011385 WO2014104617A1 (en) 2012-12-24 2013-12-10 Patch kit for treating infectious and non-infectious inflammatory disease, and use therefor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120152103A KR101445005B1 (en) 2012-12-24 2012-12-24 Patch kits for the treatment for infectious or noninfectious inflammatory disease and uses thereof

Publications (2)

Publication Number Publication Date
KR20140082306A KR20140082306A (en) 2014-07-02
KR101445005B1 true KR101445005B1 (en) 2014-09-26

Family

ID=51021610

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120152103A KR101445005B1 (en) 2012-12-24 2012-12-24 Patch kits for the treatment for infectious or noninfectious inflammatory disease and uses thereof

Country Status (2)

Country Link
KR (1) KR101445005B1 (en)
WO (1) WO2014104617A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210109443A (en) 2020-02-27 2021-09-06 연세대학교 원주산학협력단 Acne improvement device using electric stimulation

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11896609B2 (en) * 2021-08-24 2024-02-13 Industry-Academic Cooperation Foundation Pharmaceutical composition for treating inflammatory diseases comprising germanium telluride nanosheets coated with polyvinylpyrrolidone

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040053184A (en) * 2001-10-24 2004-06-23 파워 페이퍼 리미티드 Dermal patch
KR20050121277A (en) * 2003-06-02 2005-12-26 파워 페이퍼 리미티드 Kit, device and method for controlled delivery of oxidizing agent into the skin
KR101203768B1 (en) * 2011-02-23 2012-11-21 신현우 Low-frequency stimulation electrode conductive hydrogel patch containing ingredients for alleviating pain and inflammation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040053184A (en) * 2001-10-24 2004-06-23 파워 페이퍼 리미티드 Dermal patch
KR20050121277A (en) * 2003-06-02 2005-12-26 파워 페이퍼 리미티드 Kit, device and method for controlled delivery of oxidizing agent into the skin
KR101203768B1 (en) * 2011-02-23 2012-11-21 신현우 Low-frequency stimulation electrode conductive hydrogel patch containing ingredients for alleviating pain and inflammation

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210109443A (en) 2020-02-27 2021-09-06 연세대학교 원주산학협력단 Acne improvement device using electric stimulation

Also Published As

Publication number Publication date
WO2014104617A1 (en) 2014-07-03
KR20140082306A (en) 2014-07-02

Similar Documents

Publication Publication Date Title
Broughton et al. Mechanisms of cardiac repair and regeneration
Zhang et al. Inhibition of histone deacetylases preserves myocardial performance and prevents cardiac remodeling through stimulation of endogenous angiomyogenesis
Almeida et al. Aging: molecular pathways and implications on the cardiovascular system
Huang et al. Genetic modification of mesenchymal stem cells overexpressing CCR1 increases cell viability, migration, engraftment, and capillary density in the injured myocardium
Ebeling et al. From a traditional medicinal plant to a rational drug: understanding the clinically proven wound healing efficacy of birch bark extract
Gould et al. Targeting glycogen synthase kinase-3 in the CNS: implications for the development of new treatments for mood disorders
Cho et al. Mesenchymal stem cells reciprocally regulate the M1/M2 balance in mouse bone marrow-derived macrophages
Jenkins et al. The expanding world of tissue‐resident macrophages
Katare et al. Transplantation of human pericyte progenitor cells improves the repair of infarcted heart through activation of an angiogenic program involving micro-RNA-132
Jing et al. Study of electrical stimulation with different electric-field intensities in the regulation of the differentiation of PC12 cells
Fu et al. Metformin attenuates pressure overload-induced cardiac hypertrophy via AMPK activation
Kim et al. Expression and functional significance of nicotinamide N-methyl transferase in skeletal muscles of patients with chronic obstructive pulmonary disease
Wang et al. Resolvin D1 protects against sepsis‐induced cardiac injury in mice
Kass Cardiac role of cyclic-GMP hydrolyzing phosphodiesterase type 5: from experimental models to clinical trials
Bocchi et al. Growth factor-induced mobilization of cardiac progenitor cells reduces the risk of arrhythmias, in a rat model of chronic myocardial infarction
JP2008536487A5 (en)
Jin et al. Puerarin protects against cardiac fibrosis associated with the inhibition of TGF-β1/Smad2-mediated endothelial-to-mesenchymal transition
Jeong et al. p38/AP-1 pathway in lipopolysaccharide-induced inflammatory responses is negatively modulated by electrical stimulation
KR101445005B1 (en) Patch kits for the treatment for infectious or noninfectious inflammatory disease and uses thereof
Liang et al. Migration of resident cardiac stem cells in myocardial infarction
Panda et al. Electrical stimulation waveform‐dependent osteogenesis on PVDF/BaTiO3 composite using a customized and programmable cell stimulator
Heger et al. JDP2 overexpression provokes cardiac dysfunction in mice
He et al. Blockade of RBP-J-mediated notch signaling pathway exacerbates cardiac remodeling after infarction by increasing apoptosis in mice
Thompson et al. How do cancer cells acquire the fuel needed to support cell growth?
Qin et al. Targeting anticancer immunity in oral cancer: Drugs, products, and nanoparticles

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20170718

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180919

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20190716

Year of fee payment: 6