KR101444216B1 - Probiotic Lactobacillus brevis JSB22 Having Extracellular Polysaccharide Producing Actibity - Google Patents

Abstract

The present invention relates to a Lactobacillus brevis JSB22 strain (KACC91760P) showing extracellular polysaccharide production and a probiotic effect. The strains according to the present invention are excellent in extracellular drospigmogenic activity and are excellent in viability of artificial gastric juice, bile juice and pancreatic juice, and thus can be used as material development and functional starter utilizing useful strains derived from the genus.

Description

Probiotic Lactobacillus brevis JSB22 strain showing extracellular polysaccharide producing activity {Probiotic Lactobacillus brevis JSB22 Having Extracellular Polysaccharide Producing Actibity}

The present invention relates to a Lactobacillus brevis JSB22 strain excellent in extracellular polysaccharide production and probiotic effect, which is classified in a traditional delicacy field.

Lactobacillus brevis is a fungus belonging to lactic acid bacteria. Lactic acid bacteria are the final metabolites, also called lactic acid bacteria, which are bacteria that produce a considerable amount of lactic acid. Lactic acid bacteria are a type of microorganism that humans have been using for a long time, and they are widely used in kimchi in Korea and in milk fermentation in western countries.

Recently, studies on lactic acid bacteria have been actively carried out and are very important industrial strains widely used for fermented milk production, health and functional food, dressing agent, medicines, and live bacteria products. Examples of bacteria belonging to the genus Streptococcus sp. Pediococcus sp., Leuconostoc sp., Lactobacillus sp., Sporolactobacillus sp. And Bifidobacterium, and the like.

The lactic acid bacteria are Gram positive bacteria, which are anaerobic or anaerobic. They are concentrated in the intestinal wall of the intestines of the animals to decompose the nutrients and fibrin of the animals and produce lactic acid and antibiotics It is known that it plays an important role in maintaining intestinal health by inhibiting the development of enteric bacteria in the intestines.

Young animals are required to have lactic acid bacteria, which are useful for normal intestinal microflora formation because the intestinal microflora is not formed completely, and intestinal microflora is destroyed by stress, absorption of harmful substances, traveling and drinking, Lactic acid bacteria are also required to suppress the occurrence of diseases. In addition, lactic acid bacteria have been reported to be beneficial in resistance to infection, anticancer effect, lowering of cholesterol content in the blood, and suicidal effect, as one of the dominant microflora among human intestinal microorganisms (Hentges D. Hosono A. et al , Agr. Biol. Chem., 1990, 54, 7, 1639-1643).

In addition, lactic acid bacteria are used for the promotion of animal growth, improving feed utilization, increasing resistance to diseases, inhibiting the growth of harmful bacteria, decreasing the mortality rate, inhibiting the production of toxic substances and various vitamins.

Lactic acid bacteria use the live bacteria themselves, so when consumed orally, the harsh environment in the human body, that is, the acidic environment in which the pH is lowered to 3, and the digestive enzymes and bile acids secreted from the stomach and small intestine, In addition, it has been pointed out that the intestinal fixation rate is lowered. In addition, reported on the efficacy of the lactic acid bacteria according to the number of viable cells, it has been reported that when the lactic acid fermented milk which is commercially available is consumed, the number of the live bacteria of the lactic acid bacteria which reach and reach the large intestine is not sufficient enough to give a beneficial effect to the host et al., J. Dairy Sci., 1990, 73, 1478-1484). In addition, in the production of bifidus fermented beverages, it is urgent to select a strain having excellent acid resistance (Berrada et al., J. Dairy Sci., 1991, 14, 409-413).

As can be seen from the above, lactic acid bacteria from outside need to reach the intestinal tract without any obstruction and attach to the intestinal mucosa and show its function in order for the lactic acid bacteria to have a useful effect in human or animal. For this purpose, it should be a strain that can be attached directly to the intestine, and it should be less destroyed by oral administration of gastric acid, strong resistance to bile acid, and strong sterilizing ability of pathogenic bacteria.

Biogenic amines are derived from biologically active amine biomes. It is a substance that mediates or regulates physiological function in living body, and it is one kind of odacoid. Catecholamines such as adrenaline, noradrenaline, and dopamine, histamine, serotonin, sub-stance p, and GABA. In a broad sense, acetylcholine may also be included. Both are widely involved in biological functions, such as mediators of the central or peripheral nerves, or chemical mediators. Histamine can cause rash, local dermatitis, vomiting, nausea, diarrhea, abdominal pain, hypotension, headache, and tyramine can cause hypertension, heart attack and the like.

Korean Patent Laid-Open Publication No. 2002-0049220 discloses Lactobacillus plantarum isolated from kimchi and is disclosed in Korean Patent Publication No. 2009-0043142 (hereinafter referred to as " Lactobacillus plantarum Lactobacillus plantarum having resistance to acid-fast bacilli and antibiotics) Although lactobacillus laminosus isolated from oysters has been disclosed, the lactobacillus strains having excellent ability to produce extracellular polysaccharides as in the present invention are not disclosed in the present invention. to be.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The inventors of the present invention have conducted intensive researches to develop a material that can be used as a material and a functional starter utilizing the useful strains derived from the genus, because of its excellent extracellular polysaccharide producing activity and excellent survival rate against artificial gastric juice, bile juice and pancreatic juice Respectively. As a result, it was confirmed that Lactobacillus brevis JSB22, which is a lactic acid bacterium isolated from a starchy pot, has the above-mentioned advantages, and thus the present invention has been completed.

Accordingly, an object of the present invention is to provide a novel strain, Lactobacillus brevis JSB22, which is excellent in extracellular activity of producing a diabetes.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

The present invention provides a novel Lactobacillus brevis strain.

The inventors of the present invention have conducted intensive researches to develop a material that can be used as a material and a functional starter utilizing the useful strains derived from the genus, because of its excellent extracellular activity of producing an extracellular saccharide and excellent survival rate against artificial gastric juice, bile fluid and pancreatic juice Respectively. As a result, it was confirmed that Lactobacillus brevis JSB22, which is a lactic acid bacterium isolated from a starchy pot, exhibits the above-mentioned advantages.

As demonstrated in the following examples, the Lactobacillus brevis JSB22 strain has excellent extracellular drospigmogenic activity and is excellent in survival against artificial gastric juice, bile juice and pancreatic juice. In addition, it does not produce biogenic amines, has excellent antimicrobial effect against various food poisoning bacteria, and has resistance to various kinds of antibiotics. Therefore, the strain of the present invention can be used as a material development and functional starter utilizing a useful strain derived from a genus.

According to one aspect of the present invention, there is provided a Lactobacillus brevis JSB22 strain (KACC91760P) showing extracellular polysaccharide production and a probiotic effect.

According to a preferred embodiment of the present invention, the strain may preferably exhibit Gram positive and bacillary characteristics, and may be a mesophilic strain which grows at a temperature of 30-40 ° C.

According to a preferred embodiment of the present invention, the strain is preferably resistant to a digestive juice selected from the group comprising gastric juice, bile juice and pancreatic juice.

According to a preferred embodiment of the present invention, the survival rate for the gastric juice may be preferably 130.0-150.0%, more preferably 135.0-145.0%, and most preferably 139.0-142.0%.

According to a preferred embodiment of the present invention, the survival rate for the bile liquid may be preferably 50.0-100.0%, more preferably 60.0-90.0%, and most preferably 65.0-75.0%.

According to a preferred embodiment of the present invention, the survival rate for the pancreatic juice may be preferably 130.0-170.0%, more preferably 135.0-150.0%, and most preferably 140.0-150.0%.

According to a preferred embodiment of the present invention, the strain preferably does not produce a biogenic amine.

According to a preferred embodiment of the present invention, the strain may exhibit antibiotic resistance.

According to a preferred embodiment of the present invention, the antibiotic is selected from the group consisting of Amikacin, Ampicillin, Bacitracin, Cephalothin, Chloramphenicol, Erythomycin, The present invention relates to a pharmaceutical composition comprising Gentamicin, Kanamycin, Nalidixic acid, Nitrofurantoin, Ofloxacin, Penicillin, Polymyxin B, Rifampin ), Streptomycin, Tetracycline, and Vancomycin C, but are not limited thereto.

According to a preferred embodiment of the present invention, the clear zone diameter of the strain may be preferably 0.01-30.0 mm.

According to a preferred embodiment of the present invention, the strain of the present invention can be used in a cosmetic composition.

The cosmetic composition of the present invention may contain other components than the above-mentioned strains. According to an embodiment of the present invention, the cosmetic composition of the present invention is obtained from the group comprising glycerin, butylene glycol, polyoxyethylene hydrogenated castor oil, tocopheryl acetate, citric acid, panthenol, squalane, sodium citrate and allantoin Further comprising at least one auxiliary component selected from the group consisting of glycerin, polyoxyethylene hydrogenated castor oil, tocopheryl acetate, squalane and sodium citrate, and at least one auxiliary ingredient selected from the group consisting of butylene glycol, citric acid, panthenol and allantoin And most preferably at least one component selected from the group consisting of glycerin, butylene glycol, polyoxyethylene hydrogenated castor oil, tocopheryl acetate, citric acid, panthenol, squalane, sodium citrate and allantoin .

Since the cosmetic composition of the present invention is basically applied to the skin, it can be provided with reference to the cosmetic composition of the related art, for example, as a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, But are not limited to, surfactant-containing cleansing, oils, powder foundations, emulsion foundations, wax foundations and sprays. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder.

When the formulation of the present invention is a paste, cream or gel, an animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier component .

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In the case of a spray, in particular, / Propane or dimethyl ether.

When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.

When the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspension such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Crystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used.

When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, or ethoxylated glycerol fatty acid esters.

According to a preferred embodiment of the present invention, the present invention may be a pharmaceutical composition comprising the aforementioned strains.

When the composition of the present invention is manufactured from a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the formulation and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered to mammals such as rats, mice, livestock, and humans in various routes such as oral or parenteral routes such as oral, rectal or intravenous, muscular, subcutaneous, intra-uterine, Can be administered by injection. Preferably, it is applied by transdermal administration during parenteral administration, more preferably by topical application by application.

The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . The dose of the pharmaceutical composition of the present invention can be administered in an amount of 0.1-100 mg / kg on an adult basis once or several times a day in the case of an oral formulation, and in the case of an external preparation, It is preferable to apply it once to 5 times a day in an amount of 3.0 ml and continue for 1 month or longer. However, the dosage is not intended to limit the scope of the present invention.

The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in any form suitable for pharmaceutical preparations including oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, external preparations such as ointments and creams, suppositories and sterile injectable solutions, , Dispersants, or stabilizers.

According to a preferred embodiment of the present invention, the present invention may be a food composition comprising the above-mentioned strain.

When the composition of the present invention is prepared with a food composition, it includes not only the active ingredient, but also ingredients normally added during the manufacture of the food, including, for example, proteins, carbohydrates, fats, nutrients, flavoring agents and flavoring agents . Examples of the above-mentioned carbohydrates are monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, oligosaccharides and the like; And polysaccharides such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavorings such as tau martin and stevia extract (e.g., rebaudioside A and glycyrrhizin) and synthetic flavorings (saccharine, aspartame, etc.) can be used as flavorings.

For example, when the food composition of the present invention is prepared as a drink, it may further contain citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, juice, mulberry extract, jujube extract, licorice extract, have.

As a result of analyzing cell viability with respect to the active ingredient of the composition of the present invention in the concrete examples of the present invention, it was found that the active ingredient of the composition of the present invention is a harmless substance as a natural substance. Accordingly, since the active ingredient of the present invention has little toxicity and side effects, it can be safely used even in long-term use, and can be used particularly in the cosmetic, pharmaceutical and food compositions as described above.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides Lactobacillus brevis JSB22 strain (KACC91760P), which exhibits extracellular polysaccharide production and a probiotic effect.

(b) The strain according to the present invention is excellent in extracellular drospigmogenic activity and is excellent in viability against artificial gastric juice, bile fluid and pancreatic juice, and thus can be used as a material development and functional starter utilizing a useful strain derived from a genus have.

Figure 1 shows the results of culturing the JSB22 strain at 35 ° C and 45 ° C.
2 shows a micrograph of a strain JSB22 of the present invention.
Fig. 3 shows the result of PCR of an extracellular polysaccharide biosynthetic gene.
FIG. 4 shows the result of confirming the strain producing excellent extracellular polysaccharide through TLC analysis.
FIG. 5 shows experimental results on the production of a biogenic amine.
Figs. 6 and 7 show experimental results on the antimicrobial effect on food poisoning bacteria.
Figures 8 to 10 show the antibiotic-related growth characteristics of JSB22.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not to be construed as limiting the scope of the present invention. It will be self-evident.

Example

Throughout this specification, "%" used to denote the concentration of a particular substance is intended to include solids / solids (wt / wt), solid / liquid (wt / The liquid / liquid is (vol / vol)%.

Example  : Method and Characterization of Strain

Isolation of strain

R ₂ A medium (LAB, UK), a low-nutrient medium used for isolating strains, contained yeast extract (0.05%), meat peptone (0.5%), casamino acid (0.05%), starch 0.03%), magnesium sulphate (0.005%), sodium pyruvate (0.03%) and agar (1.5%). 90 mL of 0.85% NaCl solution was added to 10 g of the sample, and the mixture was shaken with a homogenizer (Bag mixer 400, Interscience, France), diluted 10 ⁵ -10 ⁷ times, and spread on R ₂ Aagar. After incubation at 28 ° C for 24 hr, morphological characteristics such as colony color, size and shape in the culture medium were separated and separated.

Characterization of isolated strains and 16S rDNA  Gene sequencing

The chromosomal DNA of the isolate was isolated using GenEX genomic Sx DNA kit (GeneAll Biotechnology Co., Ltd., Seoul, Korea), and then the 27S (5'-AGAGTTTGATCATGGCTCAG-3 ') and 1492R (SolGent co., LTD, Daejeon, Korea) after PCR amplification of the 16S rDNA gene fragment of the isolate using primers (5'-GGATACCTTGTTACGACTT-3 '). The results were compared with the nucleotide sequences of the NCBI GenBank database (http://ncbi.nlm.nih.gov), and the systematic taxonomic relationships were analyzed. Based on the neighbor-joining algorithm using Clustal W and MEGA 4.0 A phylogenetic consensus tree was constructed to confirm the relationship. Lactobacillus brevis JSB22 strain was deposited with KACC as a patented microorganism (KACC91760P).

Catalase test

3% (v / v) hydrogen peroxide (H2O2) was added to the slide glass to dissolve the cells. Generally, lactic acid bacteria have catalase negative characteristics (see Table 1 below).

Oxidase test

The cells were transferred to a filter paper (Whatman No. 1) after 1% N, N, N ', N-tetramethyl-phenylenediamine (Sigma Co.) Generally, lactic acid bacteria have oxidase negative characteristics (see Table 1 below).

Catalase test and Oxidase test result of JSB22 Catalase test Oxidase test voice voice

35 ° C and 45 ° C culture

The cells were scraped into MRS (agar 1.5%) and incubated at 35 ° C and 45 ° C for 2 days, respectively. It grew normally at 35 ° C, and did not grow at 45 ° C, indicating that it was a typical mesophile (see FIG. 1).

Experimental Method

Isolated  Verification of polysaccharide production

TLC Physicochemical analysis using

458 strains showing the characteristics of lactic acid bacterium were isolated and analyzed by TLC. In order to produce homo-EPS, a medium containing 2% (maltose, sucrose) was added to a MRS filtrate (Minimate ^™ TFFCapsule5KMembrane, PallCo.USA). Hetero-EPS was prepared by adding galactose, lactose, Was used.

Analysis by molecular biological method

The isolated strain 92 screened for producing the polysaccharide on TLC among the isolated strains was performed. Amfieco PCR premix (GenDEPOT, Barker TX, USA) was used according to the manual and amplified using a Bio-Rad C1000 thermal cycler (Bio-Rad, CA, USA). Glucansucrase gene screening was performed at 94 ° C for 5 min, followed by final elongation at 72 ° C for 7 min, followed by 35 cycles at 94 ° C for 30 sec, 55 ° C for 45 sec and 72 ° C for 1 min and 20 sec. I followed the conditions. Amplification and electrophoresis (see Tables 2 and 3 below).

Homo-EPS primers gene name sequence prediction you glucansucrase Dsr 1F 5`-GAYGCNGTNGACYAAYGTNRAYGC-3` 1580bp Dsr 1R 5`-TAHAWTTGRTCNGGNACMMARTC-3` fructansucrase Ftf 1F 5`-CARSARTGGTCWGGNTCHGC-3` 600b Ftf 2r 5`-ADDCCRATNGMDSCRTTNG-3`

Hetero-EPS primers primer name sequences (5 '- 3') targeted gene fragment size (bp) PCR condtions 정적 제어 references epsD / EF
epsD / ER F: TCATTTTATTCGTAAAACCTCAATTGAYGARYTNCC
R: AATATTATTACGACCTSWNAYYTGCCA Priming glycosyltransferase 200 5 cycles of 94 ° C (30 s), 62 ° C
(30s), 72 [deg.] C (30s); 40
cyclesof 94 [deg.] C. (30 s), 52 [
(30s), 72 [deg.] C. (30s) S. thermophilus ST111  and LY03 Provencher meat get . (2003)

Isolated strain  Identification of antibacterial and safety characteristics

Antibacterial

Antimicrobial activity of Listeria monocytogenes, Escherichia coli, Staphylococcus aureus subsp., And Salmonella enteric subsp. Was screened by agar diffusion test.

Biogenic amine

Decarboxylase media were used to screen for colonies that did not form a clear or purple circle. The composition of the medium is shown in Table 4 below. Multiplex PCR was performed to confirm the presence of the biogenic amine-producing gene. The sequence of the biogenic amine primer is shown in Table 5 below.

decarboxylase medium composition (%) Component Improved medium Tryptone 0.5 Yeast extract 0.5 Meat extract 0.5 Sodium chloride 0.25 Glucose 0.05 Tween  80 0.1 MgSO4 ₄ 0.02 MnSO ₄ 0.005 FeSO ₄ 0.004 Ammonium citrate 0.2 Thiamine 0.001 K ₂ PO ₄ 0.2 CaCO ₃ 0.01 Pyridoxal -5- phosphate 0.005 Amino acid 1.0 Bromcresol purple 0.006 Cresol red 2 Agar 5.3

Sara Bover - Cida  ,, Wilhelm Heinrich Holzapfel . 1999. Improved screening  procedure for biogenic amine production by lactic acid bacteria . International Journal of Food Microbiology  53 (1999) 3341.

Biogenic amine primer sequence primer name sequences  (5'-3 ') targeted gene fragment  size ( bp ) PCR condition references HDC3 GATGGTATTGTTTCKTATGA hdc 435 multiplex (hdc, tyrdc, odc, agdi) Coton, 2005 HDC4 CCAAACACCAGCATCTTC hdc 95 / 5m, TD2 ACATAGTCAACCATRTTGAA tyrdc 1133 final 72 / 5m Coton et al., 2004 TD5 CAAATGGAAGAAGAAGTAGG tyrdc ODC1 NCAYAARCAACAAGYNGG odc 900 Coton, 2010 ODC2 GRTANGGNTNNGCACCTTC AgD1 CAYGTNGAYGGHSAAGG agdi 600 Coton, 2010 AgD2 TGTTGNGTRATRCAGTGAAT TDC-F TGGYTNGTNCCNCARACNAARCAYTA tyrdc 875 multiplex (tyrdc, hdc) Delas Rivas et al. 2006, 2007 TDC-R ACRTARTCNACCATRTTRAARTCNGG 95 / 15m, Hdc1-F TTGACCGTATCTCAGTGAGTCCAT hdc 174 final 72 / 5m Fernandez, 2006 Hdc1-R ACGGTCATACGAAACAATACCATC

Probiotics  Character analysis

Resistance to artificial gastric juice

Artificial gastric juice was prepared by adding 1% pepsin 0.22 μm membrane filter to MRS broth adjusted to pH 2.5 using 1 N HCL. MRS broth (0.05% L-cystein) was inoculated and cultured at 37 ° C for 24 hours. One mL of each culture was added to 30 mL of artificial gastric juice, and cultured in a shaking incubator at 37 ° C for 2 hours. The culture was serially diluted with 0.85% NaCl, 100 μl was plated on MRS agar medium, and cultured at 37 ° C for 48 hours. In the control group, MRS broth without added pepsin and pH not adjusted was used.

art In bile  Resistance to

Artificial bile juice was prepared by adding 1% of sterilized 10% oxgall to MRS broth. MRS broth (0.05% L-cystein) was inoculated and cultured at 37 ° C for 24 hours. One mL of each culture was added to 30 mL of artificial bile solution and cultured in a shaking incubator at 37 ° C for 2 hours. The culture was serially diluted with 0.85% NaCl, 100 μl was plated on MRS agar medium, and cultured at 37 ° C for 48 hours. In the control group, MRS broth without 10% oxgall was used.

art In pancreatic juice  Resistance to

Artificial pancreatic juice was prepared by adding 0.5% of pancreatin dissolved in 0.85% NaCl (pH 8) to MRS broth. MRS broth (0.05% L-cystein) was inoculated and cultured at 37 ° C for 24 hours. One mL of each culture was added to 30 mL of artificial bile solution and cultured in a shaking incubator at 37 ° C for 2 hours. The culture was serially diluted with 0.85% NaCl, 100 μl was plated on MRS agar medium, and cultured at 37 ° C for 48 hours. MRS broth without pancreatin was used as a control.

Antibiotic resistance test

Bottom agar was prepared by mixing 15 mL of MRS agar (1.5% agar) and 4 mL of top agar mixed with 20 mL of MRS agar (agar 0.7%) and 1 mL of culture (OD: 1.0) on bottom agar. Seventeen discs containing antibiotics (Oxoid, England) were placed on a flat plate and anaerobically cultured at 37 ° C for 24 hours. After completion of cultivation, the diameter of the zona pellucida formed around the antibiotic disc was measured.

Antibiotic resistance test results Antibiotic agents Disc    conc. (μg) Interpretative zone diameter  ( mm ) R ^One I ² S ³ Amikacin  ( AK ) 30 ≤15 16-17 ≥18 Ampicillin  ( AMP ) 10 ≤12 13-15 ≥ 16 Bacitracin  (B) 10 ≤15 16-17 ≥18 Cephalothin  ( KF ) 30 ≤ 14 15-17 ≥18 Chloramphenicol  (C) 30 13 14-17 ≥18 Erythomycin  (E) 15 13 14-17 ≥18 Gentamicin  ( CN ) 10 ≤12 - ≥13 Kanamycin  (K) 30 13 14-17 ≥18 Nalidixic acid  ( NA ) 30 13 14-17 ≥18 Nitrofurantoin  (F) 300 ≤ 14 15-16 ≥ 17 Ofloxacin  ( OFX ) 5 13 14-18 ≥ 19 Penicillin  (P) 10 ≤ 19 20-27 ≥28 Polymyxin  B ( PB ) 300 ≤8 9-11 ≥12 Rifampin  ( RP ) 5 ≤ 14 15-17 ≥18 Strptomycin  (S) 10 ≤11 12-14 ≥15 Tetracycline  ( TE ) 30 ≤ 14 15-18 ≥ 19 Vancomycin  ( VA ) 30 ≤ 14 15-17 ≥18

1 Resistant, 2 Intermediate, 3 Sensitive.

Lee, SH, Yang, EH, Kwon, HS, Kang, JH and Kang, BH 2008. Potential probiotic properties of Lactobacillus johnsonii IDCC 9203 isolated from infant feses. Kor. J. Microbiol. Biotechnol. 36 (2): 121-127.

Experiment result

JSB22 Characteristics of strains

It was isolated from the starchy field and identified as Lactobacillus brevis. Gram-positive, and bacillus.

Extracellular  Polysaccharide Exopolysaccharide ) produce

As a result of TLC analysis, the isolate was selected as an excellent polysaccharide-producing strain (see Table 7, FIG. 3 and FIG. 4).

Results of extracellular polysaccharide biosynthetic PCR Name Identification TLC
( isolate EPS / control ) PCR One glucan fructan JSB22 Lactobacillus brevis 227.03 + +

JSB of Probiotics  effect

For artificial gastric juice Survival rate  Great

Table 8 below shows the survival rate of the JSB22 strain of the present invention against artificial gastric juice. 140.0%, respectively.

Survival rate for artificial gastric juice Name Strain Contorl
( CFU / ml ) Pepsin  ( pH  2.5) 1%
( CFU / ml ) Survival  (%) JSB  22 Lactobacillus brevis 9.25x10 ⁷ 1.30x10 ⁸ 140.00

art To the dime solution  About Survival rate  Great

Table 9 below shows the survival rate of the JSB22 strain of the present invention against artificial dermatitis. And 77.84% survival rate.

Survival rate for artificial bile fluid Name Strain Contorl
( CFU / ml ) Oxgall  One%
( CFU / ml ) Survival  (%) JSB  22 Lactobacillus brevis 9.25x10 ⁷ 7.20x10 ⁷ 77.84

art In pancreatic juice  About Survival rate  Great

Table 10 below shows the survival rate of the JSB22 strain of the present invention against artificial pancreatic juice. 146.20% survival rate was excellent.

Survival rate for artificial pancreas Name Strain Contorl
( CFU / ml ) Pancreatin  0.5%
( CFU / ml ) Survival  (%) JSB  22 Lactobacillus brevis 5.78x10 ⁷ 8.45x10 ⁸ 146.20

Biogenic amine No generation

Experimental results on the production of biogenic amines did not produce biogenic amines (see FIG. 5 below).

Antibacterial effect against food poisoning bacteria

Experiments on the antimicrobial effect against food poisoning bacteria showed that the antimicrobial effect against food poisoning bacteria was excellent (see FIGS. 6 and 7).

Antibiotic-Related Growth Characteristics

Various antibiotics showed the following growth characteristics and showed susceptibility to ampicillin (see Table 11 and Figures 8-10).

Antibiotic-Related Growth Characteristics of JSB22 Antimicrobial agents Disc    conc. (μg) Clear Zone
Diameter    ( mm ) Interpretative zone  diameter ( mm ) Result R ^One I ² S ³ Amikacin  ( AK ) 30 4.86 ≤15 16-17 ≥18 R Ampicillin  ( AMP ) 10 20.46 ≤12 13-15 ≥ 16 S Bacitracin  (B) 10 5.85 ≤15 16-17 ≥18 R Cephalothin  ( KF ) 30 - ≤ 14 15-17 ≥18 R Chloramphenicol  (C) 30 15.34 13 14-17 ≥18 I Erythomycin  (E) 15 14.63 13 14-17 ≥18 I Gentamicin  ( CN ) 10 7.99 ≤12 - ≥13 R Kanamycin  (K) 30 - 13 14-17 ≥18 R Nalidixic acid  ( NA ) 30 - 13 14-17 ≥18 R Nitrofurantoin  (F) 300 13.79 ≤ 14 15-16 ≥ 17 R Ofloxacin  ( OFX ) 5 - 13 14-18 ≥ 19 R Penicillin  (P) 10 12.05 ≤ 19 20-27 ≥28 R Polymyxin  B ( PB ) 300 - ≤8 9-11 ≥12 R Rifampin  ( RP ) 5 12.41 ≤ 14 15-17 ≥18 R Strptomycin  (S) 10  0.70 ≤11 12-14 ≥15 R Tetracycline  ( TE ) 30 14.69 ≤ 14 15-18 ≥ 19 I Vancomycin  ( VA ) 30 - ≤ 14 15-17 ≥18 R

Agricultural Biotechnology Research Institute KACC91760P 20121114

Claims (13)

Exhibiting an extracellular polysaccharide producing effect,
Lactobacillus brevis JSB22 strain (KACC91760P), which shows resistance to digestive fluids selected from the group consisting of gastric juice, bile juice and pancreatic juice.
The method according to claim 1,
Wherein the strain is gram-positive and bacillus.
delete The method according to claim 1,
Wherein the survival rate of the gastric juice is 130.0-150.0%.
The method according to claim 1,
Wherein the survival rate of the bile solution is 60.0-90.0%.
The method according to claim 1,
Wherein the survival rate for the pancreatic juice is 130.0-160.0%.
The method according to claim 1,
Wherein the strain does not produce a biogenic amine.
delete delete delete A food composition which exhibits an extracellular polysaccharide-producing effect comprising the strain of any one of claims 1, 2, and 4 to 7.
A cosmetic composition exhibiting an extracellular polysaccharide-producing effect comprising the strain of any one of claims 1, 2, and 4 to 7. delete

Images