KR101443141B1 - Method for producing starter culture for traditional fermented food without harmful bacteria using bacteriophage - Google Patents

Abstract

The present invention relates to a method for producing starter cultures for traditional fermented foods from which harmful bacteria have been removed by using bacteriophages, and a method of producing starter cultures by using bacteriophages to specifically control harmful bacteria including Bacillus cereus , It can prevent the destruction of nutrients contained in food and the deterioration of food taste. It can also be used in the production of starter cultures for traditional fermented foods in which Bacillus cereus is removed from natural microflora.

Description

Method for producing starter culture for traditional fermented food without harmful bacteria using bacteriophage}

The present invention relates to a method for manufacturing a starter culture for traditional fermented foods from which harmful bacteria are removed using bacteriophage, and more particularly, to a starter culture for traditional fermented foods in which harmful bacteria are removed by treating rice straw with bacteriophage. culture), a starter culture for traditional fermented foods from which harmful bacteria are removed, and a traditional fermented food manufactured using the starter culture.

As the contents of food become more complex and diversified and the shelf life is extended, the possibility of spoilage or contamination by microorganisms such as bacteria, yeast and mold is increasing. In order to overcome this problem, microorganisms are sterilized by sterilizing under high temperature and high pressure, ultraviolet irradiation treatment, or radiation irradiation treatment.

However, when sterilization is performed using these methods, that is, due to treatment conditions such as high temperature and high pressure, nutrients contained in the food are destroyed or the taste of the food is deteriorated. In addition, there is a method of inhibiting the growth of microorganisms using synthetic preservatives, and this method also has many difficulties for use in food because it may contain toxic substances harmful to the human body due to the synthetic preservatives. Furthermore, many physical and chemical sterilization methods have disadvantages such as insolubilizing not only harmful microorganisms but also useful microorganisms together, and thus a technology for maintaining the continuous activity of useful microorganisms and controlling harmful bacteria is required.

Traditional domestic fermented products have unique flavor and functionality that mass-produced products do not have. This characteristic is due to the microorganisms used for fermentation. In the case of mass-produced products, single or several single strains are cultivated together, whereas traditional fermented products use microflora that exists in nature. The microflora of Korean traditional fermented products is mainly derived from rice straw, especially Bacillus subtilis ( Bacillus subtilis). A variety of fungi, including subtilis) and Aspergillus (Aspergillus) has been considered as beneficial microorganisms. However, the direct use of microflora of rice straw in food poses a big problem from the viewpoint of food safety. Representatively, Bacillus cereus , a soil harmful bacteria, is contaminated with all rice straw.

Bacillus cereus is a food-derived pathogenic bacteria that causes diarrhea or vomiting, and is known to account for 1-20% of food-derived infection-causing bacteria. Accordingly, in Europe, Bacillus cereus ^{is limited to 10 4-5} CFU (colony forming unit)/g in various foods, and a law has been passed to keep it below ^{10 4 CFU/g in traditional fermented foods in Korea.} It is being implemented. Nevertheless, Bacillus cereus is very widely distributed in nature, and it is difficult to control in food because it forms spores that are resistant to various antibacterial agents.

Bacteriophage is a bacterial virus that infects only bacteria. The increase of resistant bacteria and the difficulty of developing antibiotics with a new mode of action require antibacterial agents of a different paradigm, and accordingly, much attention is focused on the control of harmful bacteria using bacteriophage and phage genetic resources. Has become. In particular, the U.S. FDA recently designated certain bacteriophages (including P100) as GRAS (generally regarded as safe) and approved them for use in foods, although this is limited to certain bacteriophages, but this increases the usefulness and safety of phages as antibacterial agents. It is considered that it provided a very important electricity for research on the application of bacteriophage to food in that it was acknowledged.

The present invention aims to specifically control only the harmful bacteria Bacillus cereus using bacteriophage in traditional fermented foods requiring continuous cultivation of useful microflora. To this end, bacteriophages that kill Bacillus cereus were isolated from various traditional fermented foods, and they were classified through morphological characterization and restriction enzyme digestion. In addition, host range analysis, genomic analysis, and proliferation inhibitory ability of Bacillus cereus in liquid medium were confirmed to confirm the possibility of the isolated bacteriophages as antimicrobial agents. Furthermore, two approaches were attempted to apply bacteriophage to food. First, in an experiment using Cheonggukjang as a model for fermented food, a method of effectively controlling Bacillus cereus by directly treating bacteriophage on food and second, treating bacteriophage on rice straw. This is a method of developing B. cereus- free starter culture, which specifically removed only Bacillus cereus, and using it to develop B. cereus-free traditional fermented food.

Korean Patent No. 0781669 discloses a bacteriophage having a specific killing ability of Staphylococcus aureus, but it is different from the method of manufacturing a starter culture for a traditional fermented food from which harmful bacteria of the present invention are removed.

The present invention was derived from the above requirements, and when treated with bacteriophage on rice straw, it was confirmed that harmful bacteria including Bacillus cereus , which are food harmful microorganisms, are removed, and harmful bacteria using bacteriophage By developing a method for producing a starter culture for traditional fermented food from which bacteria have been removed, the present invention was completed.

In order to solve the above problems, the present invention provides a method for producing a starter culture for traditional fermented foods from which harmful bacteria have been removed, including the step of treating bacteriophage on rice straw.

In addition, the present invention provides a starter culture for traditional fermented food from which harmful bacteria prepared by the above method are removed.

In addition, the present invention provides a traditional fermented food manufactured using the starter culture.

The composition of the present invention can specifically control harmful bacteria including Bacillus cereus , which are harmful bacteria of food, by containing bacteriophage as an active ingredient, and destroy nutrients contained in food or deteriorate taste of food. Can be prevented. In addition, it can be used in the manufacture of starter cultures for traditional fermented foods from which Bacillus cereus has been removed from natural microflora.

1 shows a TEM (transmission electron microscopy) photograph of a bacteriophage prepared through mass production and pure separation (size bar, 100 nm).
Figure 2 shows the analysis of the genome of the bacteriophage (BCP8-2).
3 is a graph showing the inhibitory effect of Bacillus cereus according to the bacteriophage treatment and the presence or absence of ions during the preparation of Cheonggukjang. PW; peptone water, BCP 1-1; Bacteriophage
4 is a graph showing the role of ions in adsorption of bacteriophage. TA; Nutrient broth 8 g, NaCl 5 g [86 mM], MgSO ₄ ·7H ₂ O 0.2 g [0.8mM], MnSO ₄ 0.05g [0.3mM] and CaCl ₂ 0.15g [1.0mM] per 1L, pH 5.9-6.0, NB; Nutrient broth
Figure 5 shows the development process of B. cereus- free starter culture in traditional fermented food.
6 is a graph comparing the number of total bacteria, Bacillus cereus, and bacteriophage according to the passage of B. cereus- free starter culture according to the bacteriophage-treated and non-treated groups, and the change in microflora was analyzed.

In order to achieve the object of the present invention, the present invention provides a method for producing a starter culture for traditional fermented foods from which harmful bacteria are removed, including the step of treating bacteriophage on rice straw.

In one embodiment of the present invention, the harmful bacteria are microorganisms that degrade the quality of fermented food, Bacillus cereus ( Bacillus cereus ) and the like, but are not limited thereto.

In the method for producing a starter culture for traditional fermented foods of the present invention, when the bacteriophage is treated on rice straw, a divalent cation can be further treated, the divalent cation is Mg ^{2 +} , Mn ^{2 +} or Ca ^{2 +} may be, but is not limited thereto.

The bacteriophage treatment of the present invention does not affect the proliferation of useful bacteria (B. subtilis ), and specifically inhibits only the proliferation of Bacillus cereus. Most of the rice straw samples are contaminated with harmful bacteria including Bacillus cereus, and by treating the rice straw with the bacterial phage of the present invention, harmful bacteria can be effectively removed without affecting the total number of bacteria. Therefore, it is possible to manufacture a starter culture for traditional fermented foods from which harmful bacteria including Bacillus cereus have been removed.

In one embodiment of the present invention, the fermented food may be miso, cheonggukjang, red pepper paste, pickles, or meju, but is not limited thereto.

In one embodiment of the present invention, the bacteriophage is preferably a bacteriophage belonging to Myoviridae, more preferably a bacteriophage belonging to the SPO1 group of Myoviridae, but is not limited thereto. .

In addition, the present invention provides a starter culture for traditional fermented food from which harmful bacteria prepared by the above method are removed.

In addition, the present invention provides a traditional fermented food manufactured using the starter culture. The traditional fermented food may be soybean paste, cheonggukjang, red pepper paste, pickles, or meju, but is not limited thereto. Traditional fermented foods manufactured using the starter culture for traditional fermented foods of the present invention retain the unique flavor and functionality of fermented foods, and can be produced with uniform quality by removing harmful bacteria having pathogenicity.

Hereinafter, an embodiment of the present invention will be described in detail. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

1. Materials and methods

(1) Separation of bacteriophage from traditional paste

Bacteriophages were isolated from traditional pastes such as soybean paste, red pepper paste, and cheonggukjang, pickles, and mezzanine powder using six Bacillus cereus standard fungi. The separated bacteriophage was purely separated through two to three single plaque isolation processes.

(2) Characterization of bacteriophage

The bacteriophage separated by the above method was subjected to polyethylene glycol precipitation (PEG-precipitation) and ultracentrifuge to be mass-purified in a laboratory, and using this, transmission electron microscopy (TEM), DNA restriction enzyme cleavage pattern analysis (DNA restriction) Enzyme digestion pattern analysis), structural protein analysis using SDS-PAGE, and determination of burst size using one step growth curve were performed. In addition, host range analysis was performed using Bacillus cereus isolated from food and diarrhea patients.

(3) Genomic analysis of bacteriophage

The purely isolated phage DNA was sequenced using pyrosequencing, and the presence of toxic genes, allergens, and antibiotic resistance genes was analyzed using various analysis programs.

(4) Bacteriophage application test of Cheonggukjang

Bacillus cereus (10 ⁶ CFU / g) artificially added to Bacillus cereus (10 ³ CFU / g) in Soybean manufacturing process using a seed (starter), and the fermentation 48 hours after the addition of a separate bacteriophage here, and the total The number of bacteria and the number of Bacillus cereus were measured.

(5) Derived from rice straw using bacteriophage B. cereus - free starter culture Development of

In various rice straw samples, natural microflora was cultivated using various mediums (ground water, rice straw extract, TA, etc.) and used in the preparation of cheonggukjang. At this time, B. cereus -free starter culture was developed by adding the separated bacteriophage.

Example 1: In traditional fermented food Bacillus Cereus Isolation and characterization of specific bacteriophages

Bacteriophages that kill Bacillus cereus were isolated from various traditional sauces (doenjang, cheonggukjang, red pepper paste, and pickles) and meju powder (Table 1). Bacteriophages were isolated from all types of food (32-100%) except meju powder.These results indicate that traditional fermented foods are excellent sources of bacteriophages that kill Bacillus cereus, and paradoxically, contamination of Bacillus cereus in traditional foods. Represents very frequent.

Distribution of Bacillus cereus bacteriophage in traditional sauces Type of food Number of samples Number of detection Probability of detection (%) Miso (D) 11 7 63.6 Cheonggukjang(C) 3 3 100.0 Meju (M) 6 0 0.0 Gochujang (G) 5 2 40.0 Pickles (J) 22 7 31.8 Total 47 19 40.4

Example 2: Analysis of the characteristics of the isolated bacteriophage

The bacteriophage prepared through mass production (>10 ¹¹ PFU [plaque forming unit]/ml) and pure separation (CsCl-gradient ultracentrifugation) was subjected to transmission electron microscopy (TEM) (Fig. 1) and restriction enzyme digestion analysis. It was classified as Myoviridae. Furthermore, through genome sequencing and bioinformatic analysis, it was confirmed that the isolated bacteriophage does not have genes that are genetically related to harmful genes such as allergy-causing genes or toxin-component genes. I did it (Fig. 2). In addition, it was confirmed that the isolated bacteriophage belonged to the SPO1 group among Myoviridae through analysis of the phage coding (primase), exonuclease, and polymerase. Bacteriophages belonging to the SPO1 group are known to have "strictly virulent" properties that do not have a lysogenic lifecycle, and are good research targets as bacteriophages that can be used in food.

Example 3: Using bacteriophage in traditional fermented food Bacillus Cereus Control

(One) Bacillus Subtilis In the manufacturing of used cheonggukjang Bacillus Cereus' Control

Before the experiment of applying bacteriophage to food, the experiment to inhibit the proliferation of Bacillus cereus using bacteriophage in liquid medium confirmed that bacteriophage can inhibit very effectively in a MOI (multiplicity of infection) dependent.

I checked the growth inhibition of Bacillus subtilis (B. subtilis) and Bacillus cereus (B. cereus) the harmful bacteria (B. cereus) in soybean inoculated with to ensure the efficiency of the food, yuyonggyun (B. subtilis ) Did not affect the proliferation, but Bacillus cereus was not detected at the detection level <10 ¹ CFU/g. Interestingly, the effective inhibition of proliferation of Bacillus cereus is possible in the presence of a ^{divalent cation (Mg 2 +} , Mn ^{2 +} or Ca ^{2 + ).} Even in the presence of a monovalent cation (Na ⁺ ), there was a control effect of Bacillus cereus ( p <0.05), but it was less than that of a divalent cation (FIG. 3).

(2) Bacteriophage adsorption investigation

An adsorption study was conducted to determine where divalent cation was needed in the infection cycle of phage. In the results, monovalent cation was not affected. It was confirmed that the divalent cation had a great effect (FIG. 4).

Example 4: using bacteriophage B. cereus free starter culture Development of research

An attempt was made to develop a B. cereus- free starter culture for traditional fermented food from rice straw using the separated bacteriophage (BCP8-2 or BCP901) (FIG. 5). All of the rice straw samples tested were contaminated with B. cereus , and the number increased to a very high concentration during the growth process (10 ^5-6 CFU/ml). When bacteriophage treatment in a sample contaminated with Bacillus cereus in nature did not affect the total number of bacteria, but no harmful bacteria Bacillus cereus was found (<10 ¹ CFU/ml), these results are traditional fermented foods. It demonstrates the possibility of developing a B. cereus-free starter culture for

Specifically, 5% ground soy water was added to rice straw, and bacteriophage (BCP8-2) was added thereto, followed by incubation at 37° C. for 12 hours, to develop a B. cereus- free starter culture (P1, Passage 1). ). It was confirmed that Bacillus cereus was not present in the P3 sample. In P1, it was confirmed that there was no difference in total bacterial counts from the phage treatment group. It was confirmed by the DGGE method that there was no change in microflora between the phage-treated group and the non-treated group in P1, and the specific DGGE analysis method is as follows.

Total genomic DNA was purely isolated using Beadbeater and Ultraclean Soil DNA Isolation kit. PCR conditions for amplification of the 16s rDNA sequence were primers (338f-CGCCCGCCGCGCCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGGAGGCAGCAG; SEQ ID NO: 1 and 518r-ATTCCGCGGCTGCTGG; SEQ ID NO: 2) at 94° C. for 5 minutes, 30 cycles (94° C. 1 minute, 52° C. 1 minute, 72 ℃ 1 minute) after the reaction, and finally stretched at 72 ℃ 10 minutes. Microflora was analyzed through DGGE (denatured gradient gel electrophoresis) analysis of microorganisms grown in various media (20-60% gradient, 8 hours or 16 hours protocol use, ethidium bromide staining).

P2 ~ P6 samples were produced by subculturing 8 to 10 hours after inoculation using a 10-fold dilution (10% inoculum) or 100-fold dilution (1% inoculum) from the P1 sample. It was confirmed that Bacillus cereus was not present in the samples after P3. In addition, it was confirmed that there was no difference in total bacterial counts from the phage treatment group in each sample. And it was confirmed by the DGGE method that there was no change in microflora between the phage-treated group and the non-treated group in each of the samples.

Cheonggukjang was prepared (1% inoculum) using P1 and P6 samples from the phage-treated group and the non-treated group, and the characteristics of Cheonggukjang were analyzed (sensory test, exopolysaccharide analysis, etc.).

In the no phage group, Bacillus cereus ^{proliferated to 10 7} CFU/ml. Bacillus cereus was not detected from P3 of the phage treatment group. There was no difference in total bacterial counts in the phage-treated group and the non-treated group at a ^{level of 10 9} CFU/ml, and there was no change in the number of microorganisms in the sample after P3 (Fig. 6A and B).

As a result of confirming the number of bacteriophages according to the increase in passage, the number of bacteriophages was proportionally decreased according to Inoculum, and in particular, in the case of 1% inoculum, bacteriophages were not detected in P6 (FIG. 6C).

As a result of analyzing the change of microflora according to the increase of passage, there was no difference in microflora between the phage-treated group and the non-treated group, and even with the increase of passage, the microflora remained stable. It was confirmed that it was maintained (D and E in Fig. 6).

<110> SUNCH'ANG Sunchang Research Center for Fermentation Microbes (SRCM) <120> Method for producing starter culture for traditional fermented food without harmful bacteria using bacteriophage <130> PN13058 <160> 2 <170> KopatentIn 2.0 <210> 1 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> 338f primer <400> 1 cgcccgccgc gccggcgggc ggggcggggg cacgggggga ctcctacggg gaggcagcag 60 60 <210> 2 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> 518r primer <400> 2 attccgcggc tgctgg 16

Claims (7)

A process for the preparation of starter cultures for traditional fermented foods from which harmful bacteria have been removed, comprising the step of treating bacteriophages and divalent cations belonging to Myoviridae in rice straw. The method for producing a starter culture according to claim 1, wherein the harmful bacterium is Bacillus cereus . delete The method according to claim 1, wherein the fermented food is soybean paste, chungkukjang, kochujang, pickled or meju. delete A starter culture for traditional fermented foods from which noxious bacteria have been removed by the method of any one of claims 1, 2 and 4. A traditional fermented food prepared using the starter culture of claim 6.

Images