KR101423696B1 - A use of mammalian vector including T7 promoter and N-terminal HA tag for the over-expression of human genes in E. coli - Google Patents

Abstract

The present invention relates to a technique for expressing an exogenous protein, preferably a human protein, under the control of the T7 promoter in Escherichia coli without T7 RNA polymerase. More specifically, the present invention relates to the use of a vector containing a T7 promoter and an N-terminal HA tag sequence to enhance the expression of an exogenous protein in E. coli that does not contain T7 RNA polymerase, The present invention relates to a method for expressing or producing an exogenous protein using the Escherichia coli, and a method for analyzing the function of an exogenous protein. The present invention also relates to a method for easily and rapidly diagnosing intracellular expression and toxicity of a human gene in Escherichia coli using the vector.

Description

The use of mammalian cell expression vectors containing the T7 promoter and the N-terminal HA tag sequence capable of mass-expressing human genes in Escherichia coli {e.g., mammalian vector including T7 promoter and N-terminal HA tag for the over expression human genes in E. coli}

The present invention relates to a technique for expressing an exogenous protein, preferably a human protein, under the control of the T7 promoter in Escherichia coli without T7 RNA polymerase. More specifically, the present invention relates to the use of a vector containing a T7 promoter and an N-terminal HA tag sequence to enhance the expression of an exogenous protein in E. coli that does not contain T7 RNA polymerase, The present invention relates to a method for expressing or producing an exogenous protein using the Escherichia coli, and a method for analyzing the function of an exogenous protein. The present invention also relates to a method for easily and rapidly diagnosing intracellular expression and toxicity of a human gene in Escherichia coli using the vector.

Escherichia Coli is the most prevalent bacterial species in physiological, biochemical, and genetic studies, and is a useful bacterial strain for producing recombinant proteins or studying their function in biotechnology. Production of recombinant proteins using E. coli has many advantages such as high production efficiency, shortened time and cost, and the like. However, when a vector containing a heterologous gene expression promoter is introduced into Escherichia coli and the components necessary for expressing the vector are not present in a gene expression system endogenously present in Escherichia coli, recombinant proteins are produced in Escherichia coli It does not.

Representative examples thereof include pcDNA and pCS2 + mammalian expression vectors widely used for molecular cloning. These vectors contain the cytomegalovirus (CMV) promoter for transcription in mammalian cells and the bacteriophage T7 and / or SP6 promoter for in vitro transcription. Since the T7 promoter derived from the bacteriophage is known to be a much stronger promoter than the promoter derived from Escherichia coli, the T7 promoter has strict specificity to each unique RNA polymerase (RNAP). Therefore, the expression vector using the T7 promoter When transformed into Escherichia coli, protein expression becomes poor. In particular, E. coli DH5? And TOP10 strains, which are widely used for molecular cloning, are known to lack T7 RNAP, resulting in almost no transcription of the target gene under the control of the T7 promoter (Melton, DA, et al., 1984). Chamberlin, M., J. McGrath, and L. Waskell, Nature (1986) 189 (1): p. 7035-56; Studier, FW and BA Moffatt, J Mol Biol, , 1970. 228 (5268): p. 227-31; McAllister, WT, Cell Mol Biol Res, 1993. 39 (4): 385-91).

Therefore, it was conventionally used for the purpose of obtaining plasmid DNA of high copy number through replication of this vector plasmid DNA, not for the purpose of expression of the gene cloned in Escherichia coli. Alternatively, in order to express the gene cloned under the control of the T7 promoter in the above vectors, the T7 RNAP gene may be introduced into E. coli to use the T7 promoter in Escherichia coli, or the Escherichia coli lac promoter We had to change the traits.

Korean Patent Registration No. 0262867 discloses a method for expressing recombinant human granulocyte colony stimulating factor under the control of T7 promoter in Escherichia coli using E. coli BL21 (DE3) transformed to express T7 RNAP as a host And the lac operator inserted into the lower part of the T7 promoter. Korean Patent Registration No. 0389378 discloses a method for producing a cytokine-suppressing anti-inflammatory drug-binding protein (CSBP-2) in Escherichia coli under the control of the T7 promoter 2) a technique for culturing the Escherichia coli at a low temperature while using Escherichia coli BL21 (DE3) transformed to express T7 RNAP as a host for expressing the protein. Thus, conventionally, Escherichia coli has to have T7 RNAP in order to express an exogenous protein by the T7 promoter in E. coli.

Therefore, even if T7 RNAP is not present, if a recombinant protein can be expressed through a mammalian cell expression vector pcDNA or the like using a gene expression system endogenously present in E. coli, human gene expression in mammalian cells, It is expected that the range of usable Escherichia coli strains will be widened and it will be a great help to study the function of proteins by using Escherichia coli or mass production of industrially useful proteins.

It is an object of the present invention to provide a technique for enhancing expression of foreign proteins in E. coli that does not contain T7 RNA polymerase using a vector comprising a T7 promoter and an N-terminal HA tag sequence. According to the present invention, it is possible to provide a method for expressing and producing an exogenous protein in Escherichia coli, which overcomes the existing cell-specific promoter-induced expression using the vector.

More specifically, one object of the present invention is to provide a T7 RNA polymerase, which comprises a T7 promoter, a base sequence encoding an HA tag, and a vector that sequentially encodes a foreign protein in a 5 'to 3' The present invention provides a composition for promoting expression of an exogenous protein in Escherichia coli.

It is another object of the present invention to provide a method for producing a recombinant vector comprising a T7 promoter, an N-terminal HA tag, and a vector comprising a gene encoding an exogenous protein, which does not contain T7 RNA polymerase, .

It is still another object of the present invention to provide a method for expressing and producing an exogenous protein by culturing the Escherichia coli.

It is another object of the present invention to provide a method for analyzing the function of an exogenous protein by culturing the Escherichia coli.

Another object of the present invention is a composition and a screening method for screening cytotoxic substances using the vector system.

The present invention relates to a technique for expressing an exogenous protein, preferably a human protein, under the control of the T7 promoter in Escherichia coli without T7 RNA polymerase.

HtrA1 (High temperature requirement A1) is a highly conserved serine protease from bacteria to humans. HtrA1 is present in the zymogen state and matured into an active form having proteolytic activity through processing of the N-terminal region. It is known that HtrA1 overexpression induces apoptosis dependent on serine protease in mammalian cells have.

In order to study the function of HtrA1 in the cytoplasm, the HtrA1-encoding gene was cloned into a pcDNA3 plasmid and introduced into Escherichia coli, and surprisingly, the expression of HtrA1 was induced in Escherichia coli by the plasmid, Dependent growth of E. coli was inhibited.

In order to examine which constituents of the plasmid acted as cis-acting elements for expression of HtrA1 in Escherichia coli without T7 RNAP, various combinations of promoter, target gene and tag were tested As a result, it was first found that a nucleotide sequence encoding a T7 promoter and an N-terminal HA tag induces expression of a target gene in E. coli in a mammalian vector system (FIG. 1). Furthermore, the inventors of the present invention found that this phenomenon is not specific to HtrA1 but that the target gene is successfully expressed in E. coli even when a different target gene is applied instead of HtrA1 in a vector system containing a T7 promoter and an N-terminal HA tag (Fig. 2).

Based on the above results, it can be seen that the base sequence including the T7 promoter and the N-terminal HA tag is a cis-acting element that expresses a downstream foreign gene. Particularly, the present invention is characterized in that HA tag sequence, which has been conventionally used as a purification and separation means for recombinant proteins, surprisingly can function to induce and enhance foreign protein expression. Accordingly, the present inventors have found that, by introducing a vector containing a T7 promoter, an N-terminal HA tag, and a gene encoding a foreign protein into Escherichia coli without T7 RNAP, foreign proteins can be expressed under the control of the T7 promoter Thereby completing the present invention which provides a novel vector system.

The vector system of the present invention enables the expression and production of a recombinant protein under the control of the T7 promoter by using a gene expression system endogenously present in E. coli even in the absence of T7 RNAP in E. coli, And can be useful for mass production of industrially useful proteins.

Furthermore, the vector system of the present invention can be utilized for easily pre-testing the expression of a target gene in E. coli before it is applied to mammalian cells. In general, it takes at least one week or more to identify the expression and function of a target gene by introducing a vector into a mammalian cell. Therefore, the vector system of the present invention is used to perform a preliminary test in E. coli to minimize the experiment time (Preferably within 24 hours), the expression of the target gene and its function can be evaluated more efficiently.

In fact, the present inventors have found that the HtrA1 protein, which has been conventionally known to induce apoptosis of mammalian cells as a result of expression of the HtrA1 protein by applying the vector system of the present invention to E. coli and mammalian cells, (Fig. 3 and Fig. 4). Thus, by confirming that the expression and function of the target gene are equally expressed in the mammalian cells and the Escherichia coli strain, the applicability of the present invention as a preliminary evaluation system in Escherichia coli was verified.

Furthermore, the vector system of the present invention can be utilized for screening a target gene having a desired function. In a preferred embodiment, the vector of the present invention is applied to a pre-test step for selecting genes that are toxic to mammalian cells or induce apoptosis, It can also be used as a screening system.

Hereinafter, the present invention will be described in more detail.

In one embodiment, the present invention relates to a composition for promoting expression of an exogenous protein in Escherichia coli, which comprises a vector comprising a T7 promoter, an HA tag, and a gene encoding an exogenous protein in the 5 'to 3' direction .

In another embodiment, the present invention relates to a vector comprising the T7 promoter, the HA tag, and a gene encoding an exogenous protein, as described above, in the 5 'to 3' direction, and comprises a T7 RNA polymerase And expresses an exogenous protein from the vector.

Preferably, the Escherichia coli used as a host to which the vector is to be introduced in the present invention is not capable of expressing an exogenous protein under the control of the T7 promoter in an endogenously existing gene expression system due to the absence of T7 RNA polymerase, It can be very low E. coli. Examples of such E. coli include, but are not limited to, E. coli DH5? Strain, E. coli TOP10 strain, E. coli JM109 strain, and E. coli XL1-Blue strain.

As used herein, the term "vector" refers to a gene construct comprising an essential regulatory element operatively linked to the expression of an exogenous protein, as a recombinant vector capable of expressing the exogenous protein in a suitable host cell, preferably E. coli. The vector may be a plasmid, a phage particle, or simply a potential genome insert, etc., but "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention, since the plasmid is the most commonly used form of the current vector. For the purpose of the present invention, it is preferable to use a plasmid vector.

As used herein, the term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a desired foreign protein to perform a general function. For example, in the present invention, the T7 promoter and the HA tag are operably linked to an exogenous protein coding nucleic acid sequence as a site that induces and regulates the expression of a foreign protein coding nucleic acid located downstream thereof. Recombinant vectors can be prepared using genetic recombinant techniques well known in the art.

The vector of the present invention is characterized by including a T7 promoter and an N-terminal HA tag as an exogenous protein expression inducing site. In the present invention, the HA tag sequence is located downstream of the T7 promoter and at the 5 'site of the foreign protein coding sequence, And can induce and promote exogenous protein expression.

As used herein, the term "promoter " refers to a nucleic acid sequence that is located upstream of the coding region, which contains a binding site for a polymerase and has a transcription initiation activity of mRNA of the promoter downstream gene. The promoter used in the present invention is characterized by being a T7 promoter.

The T7 promoter refers to a promoter derived from the bacteriophage T7. Preferably, the T7 promoter may have the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the HA tag refers to a fragment derived from human influenza hemagglutinin. In the present invention, it has been conventionally used as a tag for inclusion in an expression vector and for facilitating purification and separation. In the present invention, however, Is located at the 5'-adjacent region of the coding region and is used for inducing and promoting the expression of the exogenous protein. The HA tag may be one having the amino acid sequence of SEQ ID NO: 2 (YPYDVPDYA), preferably the one encoded by the nucleotide sequence of SEQ ID NO: 3 (TAC CCT TAC GAT GTA CCG GAT TAC GCA).

In addition, the promoter and the HA tag sequence of the present invention may include a sequence variant having substantially equivalent activity in inducing expression of an exogenous protein even if the sequence is slightly different from the above sequence. For example, such a sequence variant may have a sequence having a homology of 70% or more, preferably 80% or more, more preferably 90% or more, and more preferably 95% or more homology with the sequence of SEQ ID NO: 1, 2 or 3 Lt; / RTI >

A nucleic acid sequence encoding an exogenous protein in the vector of the present invention is inserted and expressed downstream of the promoter and the HA tag. The exogenous protein that can be expressed by the vector of the present invention is not particularly limited and can be applied to all proteins desired by a person skilled in the art. Specifically, a peptide, polypeptide, binding protein, binding domain, attached protein, structural protein, regulatory protein, toxin protein, enzyme, enzyme inhibitor, hormone, hormone analogue, antibody, signal transduction protein, Regulatory factors or portions thereof, and the like.

In a specific embodiment of the present invention, HtrA1 (high temperature requirement protein A1; Genbank Accession No. NM_002775), XIAP (X-linked inhibitor of apoptosis protein; Genbank Accession No. BC032729) MIF (macrophage migration inhibitory factor; Genbank Accession No. AF469046) and Parkin (Genbank Accession No. AB009973) proteins, respectively. However, this is only a representative example, and the scope of the present invention is not limited thereto.

The vector of the present invention may further comprise a cloning start point for allowing efficient replication of several hundred plasmid vectors per host cell, a selection marker for selecting a host cell into which the vector has been introduced (e.g., an antibiotic resistance gene, A structural marker, etc.), a polyadenylation sequence, a signal sequence, an enhancer, a signal sequence for membrane targeting or secretion, and a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Alternatively, the vector and the foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or a linker according to a conventional method, even if an appropriate restriction enzyme cleavage site is not present.

There is no particular limitation on the method for producing the vector system of the present invention, but in one embodiment, the vector system of the present invention can be more easily prepared by using a commercially available vector containing the T7 promoter as a basic vector . For example, pcDNA or pRSET series vectors can be used. Since the vectors include the T7 promoter, the vector system of the present invention can be constructed by inserting the HA tag sequence in the adjacent region and inserting the target protein coding sequence into the downstream region.

The thus constructed vector system of the present invention can be used for expressing or producing an exogenous protein in Escherichia coli and can be used for analyzing the function of an exogenous protein whose function for cell proliferation and death is unknown. It can also be used for pre-testing the expression of a target gene in E. coli before application to mammalian cells, and further, for screening a target gene having a desired function.

Thus, in one embodiment using the vector system of the present invention, the present invention relates to a method for expressing or producing an exogenous protein, comprising culturing E. coli into which said vector is introduced.

In the present invention, "introducing" a vector into E. coli means transferring an external DNA into E. coli, and includes transformation, transfection, transfection, and the like. The method of introducing the vector of the present invention into E. coli involves any method of introducing a nucleic acid into a cell and can be carried out by selecting a suitable standard technique as known in the art. Electroporation, calcium phosphate precipitation, calcium chloride precipitation, retroviral infection, microinjection, cationic liposome method, dextran sulfate, lipofectamine, and drying / But is not limited thereto.

The cultivation of Escherichia coli into which the vector system of the present invention is introduced can be cultured through a culturing method commonly used in the art and includes, but is not limited to, batch, continuous, and fed-batch cultivation. The medium used for culturing can be easily adjusted according to the strain selected by a person skilled in the art, and commercialized medium can be used. The medium comprises various carbon sources, nitrogen sources and trace element components. Examples of carbon sources that can be used include carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose, fats such as soybean oil, sunflower oil, castor oil, coconut oil, fatty acids such as palmitic acid, stearic acid, linoleic acid, Alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These carbon sources may be used alone or in combination. Examples of nitrogen sources that may be used include organic nitrogen sources such as peptone, yeast extract, gravy, malt extract, corn steep liquor, and soybean wheat, and inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, . These nitrogen sources may be used alone or in combination. The medium may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and the corresponding sodium-containing salts as a source. It may also include metal salts such as magnesium sulfate or iron sulfate. In addition, amino acids, vitamins, and suitable precursors and the like may be included.

During the culture, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. During the culture, foaming can be suppressed by using a defoaming agent such as fatty acid polyglycol ester.

The exogenous protein expressed in E. coli can be present in various forms or secreted outside the cell. When the foreign protein is present in the cells of the microorganism, the primary antibody is bound to the protein expressed after the cell crushing process, the secondary antibody labeled with the compound exhibiting fluorescence is reacted and stained, and then the expression can be observed by color development And can be determined by measuring the activity of the protein or by quantifying each protein. When the expressed exogenous protein flows out of the cell, the cell and the solid can be separated by centrifugation and then observed in the same manner as described above.

Separation of the exogenous protein from the culture can also be carried out by a conventional method known in the art. Such separation methods include, but are not limited to, centrifugation, filtration, chromatography, and crystallization.

The vector of the present invention may further include other sequences as needed in order to facilitate the purification of the recovered foreign protein. The additional sequence may be a tag sequence for protein purification, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His ; Quiagen, USA). However, the types of sequences required for purifying the target protein are not limited by the above examples. Purification of proteins can be purified using a variety of chromatographic methods known in the art. For example, when glutathione-S-transferase is fused, affinity chromatography using glutathione, which is a substrate of the enzyme, can be used. When 6x His is used, Ni-NTA His-conjugated resin column (Novagen, USA ) Can be used to easily recover a desired protein of interest.

As another embodiment of the vector system of the present invention, the present invention relates to a method for analyzing the function of an exogenous protein whose function has not been confirmed.

In a preferred embodiment,

(a) culturing Escherichia coli into which a vector containing a T7 promoter, an HA tag, and a gene encoding an exogenous protein are sequentially introduced in the 5 'to 3' direction; And

(b) analyzing the transformation and growth inhibition of the E. coli.

And a method for analyzing the function of foreign proteins.

The method for analyzing the function of foreign proteins in the present invention can be used for the purpose of pre-evaluating the expression and function of a target gene in Escherichia coli before it is applied to mammalian cells. For example, mutation genes showing differences in expression levels in normal tissues and diseased tissues through microarray techniques in mammalian animals including humans, or when expressing and functionally studying newly discovered genes presumed to be apoptosis-related genes, When screened, the vector system of the present invention overexpresses these genes in Escherichia coli to confirm the change in the trait of the strain and the degree of inhibition of the growth of the strain, and to compare the expression and function of these genes with those of the normal strain, Can be used for pre-validation

In addition, when the protein expressed in E. coli is not a human-derived protein, it may further include a step of confirming the functional complementarity between the human protein and the protein expressed in E. coli. Can be utilized.

As another embodiment of the vector system of the present invention, the present invention relates to a method for screening a target gene having a desired function.

As a preferred embodiment, the vector of the present invention can be applied to a screening system for screening genes that are cytotoxic or induce apoptosis.

In order to verify this, in a specific example of the present invention, when the HtrA1 protein was expressed in Escherichia coli using the vector system of the present invention, it was confirmed that colony was hardly formed and cell growth was suppressed, and when expressed in mammalian cells Similarly, it has been confirmed that apoptosis is induced (FIGS. 3 and 4). Thus, when the vector system of the present invention is utilized, it is possible to quickly select whether the induction of cell death or cytotoxicity of a target gene occurs in mammalian cells in 10 to 24 hours in E. coli.

Accordingly, the present invention provides a composition for screening cytotoxic substances in Escherichia coli, comprising a vector comprising a T7 promoter, an HA tag, and a gene encoding an exogenous protein sequentially from the 5 'to 3' direction.

The present invention also provides a method for screening cytotoxic substances in Escherichia coli using a vector comprising a T7 promoter, an HA tag, and a gene coding for an exogenous protein sequentially in the 5 'to 3' direction.

In a preferred embodiment,

(a) introducing into E. coli a vector comprising a gene encoding a T7 promoter, an HA tag, and an exogenous protein, sequentially in the 5 'to 3' direction;

(b) comparing the degree of growth of the E. coli into which the vector is introduced, with a control strain into which the vector is not introduced; And

(c) determining that the foreign gene contained in the vector is a cytotoxic gene when E. coli into which the vector is introduced has decreased growth as compared with a control strain into which the vector is not introduced.

To a method for screening cytotoxic substances in Escherichia coli.

In the above, the control strain refers to a strain into which the vector is not introduced, and a wild type strain or Escherichia coli having only a vector not containing a foreign gene may be used.

In the above step (a), the description of the vector and Escherichia coli is as described above.

In the step (b), the degree of growth inhibition of the strain may be measured by methods known in the art. For example, in the case of liquid culture, the absorbance is measured using a culture medium containing cells, or the density of grown cells is visually observed or the number of colonies is counted during solid culture, have.

In order to compare the degree of growth of the strain to the growth of the wild-type strain, for example, the measured absorbance at the time of liquid culture was analyzed by a computer program, and the degree of influence of the control strain on the drug was set as a reference point 0, (20% or more), or when the density of the cells in the solid culture is lower than that of the wild type strain It is possible to select strains which are sharply reduced compared to the cell density.

By this method, a protein having cytotoxicity or promoting apoptosis can be excavated, and the screened protein can be used for the treatment of a disease associated with apoptosis, for example, various cancers or infectious diseases caused by pathogenic microorganisms Can be used.

When the vector system of the present invention is used, it is possible to easily obtain an exogenous protein under the control of the T7 promoter by using a gene expression system endogenously present in E. coli even in the absence of T7 RNAP, It is useful for mass production of useful proteins and further useful for screening the desired functional gene.

1A is a schematic diagram of various mammalian expression vectors comprising the mature-HtrA1 (M-HtrA1) gene prepared in the present invention. S328A represents a mutation in which the serine of 328 amino acid residues in HtrA1 is replaced with an alanine, h is human, s is simian, p is a promoter, GST is glutathione S- transferase.
Figure 1b is a control vector (pcDNA3.0), pHA-M- HtrA1, pHA-M-S328A and each of the E. coli pCS-M-HtrA1 And E. coli growth by measuring the absorbance at 600 nm when cultured in the presence of E. coli .
Figure 1c is pHA-M-HtrA1, pHA- M-S328A, the pCS-M-HtrA1 and pCS-HA-M-HtrA1 each E. coli , The expression of M-HtrA1 was confirmed by immunoblot analysis.
Figure 1d is by measuring the number of colonies formed after transformation of 1 ng of each of the plasmid in E. coli DH5α E. coli And the degree of growth was compared.
2a is pHA-M-HtrA1 case where the target gene in the plasmid XIAP, replaced with MIF (pHA-XIAP and pHA-MIF) replaced with, SOD1 the target gene and, if removal of the HA tag (pM-SOD1), E in. coli is the result confirming the expression status of each protein by an immune blotting. White arrows indicate non-specific bands, and + and - indicate the presence or absence of the tag or T7 promoter.
FIG. 2B shows the results of the case of the Parkin expression vector (pHA-Parkin-HA) containing the HA tag at the N-terminus and the Parkin expression vector (pMYC-Parkin-HA) containing the MYC tag at the N-terminus in the pcDNA3.0 vector backbone , And the expression of each protein in E. coli was confirmed by immunoblot.
Figure 3A shows a schematic diagram of the plasmids pHA-M-HtrA1 and pM-HtrA1.
Fig. 3b shows the results of the measurement of pHA-M-HtrA1 and pM-HtrA1 in E. coli , The expression of M-HtrA1 was confirmed by immunoblot analysis.
Fig. 3c shows that pHA-M-HtrA1 and pM-HtrA1 were transformed into E. coli The number of colonies formed after the introduction into E. coli And the degree of growth was compared.
FIG. 4A shows the results of immunoblot analysis of the expression of M-HtrA1 when the control vector (pcDNA3.0), pHA-M-HtrA1, pM-HtrA1 and pCS-M-HtrA1 were respectively introduced into HEK293T cells .
FIG. 4B shows the results of DAPI staining for cell death when the control vector (pcDNA3.0), pHA-M-HtrA1, pM-HtrA1 and pCS-M-HtrA1 were respectively introduced into HEK293T cells. scale bar = 10 [mu] m, and the white arrows indicate apoptotic cells induced by HtrA1.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Preparation of plasmid

A schematic diagram of various mammalian expression vectors comprising the mature-HtrA1 (M-HtrA1) gene prepared in the present invention is shown in Fig. M-HtrA1 has an amino acid sequence from 150 to 480 in the HtrA1 amino acid (Genbank Accession No. NP_002766) (Kim, GY, et al., Biotechnol Lett, 2011. 33 (7): 1319-26) Substitution of alanine for serine in the 328 amino acid residue, a catalytic active site of serine protease in HtrA1, inactivates the proteolytic activity of HtraA1, which is represented by S328A. PcDNA3.0 (Invitrogen (Carlsbad, CA) and pCS2 + (University of Michigan, Ann Arbor, MI) were used as the basic vectors.

Table 1 summarizes the plasmids used in the present invention.

Plasmid Basic vector ^a Promoter N-terminal C-terminus Promoters for expression in mammalian cells pHA-M-HtrA1 pcDNA3.0 (1) T7 HA FLAG CMV pHA-M-S328A pcDNA3.0 (1) T7 HA FLAG CMV pM-HtrA1 pcDNA3.0 (1) T7 - FLAG CMV pCS-HA-M-HtrA1 pCS2 + (2) SP6 HA FLAG sCMV pCS-M-HtrA1 pCS2 + (2) SP6 - FLAG sCMV pHA-XIAP pcDNA3.0 (1) T7 HA FLAG CMV pHA-MIF pcDNA3.0 (1) T7 HA FLAG CMV pSOD1 pcDNA3.0 (1) T7 - FLAG CMV pHA-Parkin-HA pcDNA3.0 (1) T7 HA HA CMV pMYC-Parkin-HA pcDNA3.0 (1) T7 MYC HA CMV ^a Numbers in parentheses indicate where to buy the vector (1) Invitrogen (Carlsbad, CA); (2) Drs. David Turner and Ralph Rupp (University of Michigan, Ann Arbor, MI)

First, pcDNA3-HA (see Biochemical and Biophysical Research Communications 387 (2009) 537-542) was prepared by inserting the Ha tag sequence (SEQ ID NO: 3) into the pcDNA3.0 vector. The pcDNA-HtrA1 plasmid from Alfonso Baldi (Second University of Naples, Italy) was inserted into pBS vector after treatment with pst I, Xho I restriction enzyme to prepare pBS-M-HtrA1. The pcDNA3-HA and pBS-M-HtrA1 were digested with restriction enzymes EcoR I and EcoR I, Xho I to prepare pHA-M-HtrA1 and pHA-M-S328A.

To prepare the pM-HtrA1 plasmid, PCR amplification was performed using pHA-M-HtrA 1 as a template (95 ° C for 3 minutes; 45 seconds at 95 ° C, 45 seconds at 60 ° C, 1 minute at 72 ° C 32 cycles, using pfu DNA polymerase; 72 캜 for 1 minute), the following primers were used. The amplified M-HtrA1 cDNA fragment was treated with restriction enzymes EcoR I and Xho I and inserted into a pcDNA3.0 plasmid (Invitrogen, CA).

primer order SEQ ID NO: Forward
primer AAGCTT ATG CTGCAGCGCGGAGCCTGC
(The bolded portion represents the Hind III restriction enzyme site and the underlined portion represents the initiation codon) 6 Reverse
primer CTCGAG CTA CTTGTCATCGTCGTCCTTGTA
(The bolded part represents the Xho I restriction site, the underlined part represents the stop codon, and the italicized part represents the FLAG tag site) 7

PCR was performed using the pHA-M-HtrA1 plasmid and the following primers (3 min at 95 ° C: 45 sec at 95 ° C, 45 sec at 60 ° C, 72 min at 72 ° C to generate pCS-HA-M-HtrA1 plasmid C for 1 minute, 32 cycles using pfu DNA polymerase; 72 ° C for 1 minute). The amplified HA-M-HtrA1 cDNA fragment was inserted into the pCS2 + vector after being treated with Cla I and Xho I restriction enzymes and named pCS-HA-M-HtrA1.

primer order SEQ ID NO: Forward
primer ATCGAT ATGTACCCTTACGATGTACCG
(The bolded part represents the Cla I restriction enzyme site) 8 Reverse
primer CTCGAG CTA CTTGTCATCGTCGTCCTTGTA
(The bolded part represents the Xho I restriction site, the underlined part represents the stop codon, and the italicized part represents the FLAG tag site) 9

In addition, the pHA-M-HtrA1 plasmid was treated with restriction enzymes Pst I and Xba I, and the resulting fragment was inserted into pCS-M-HtrA1 GFP and named pCS-M-HtrA1.

To prepare the pHA-MIF plasmid, PCR was performed using the human brain cDNA library as a template using the following primers (Kim, SS, et al., Journal of Life Science, 2005. 15 (6): 961 -7) for 3 minutes at 95 ° C, 45 seconds at 95 ° C, 45 seconds at 60 ° C and 1 minute at 72 ° C using pfu DNA polymerase at 72 ° C for 1 minute). The amplified MIF fragment was digested with EcoR I and Kpn I restriction enzyme, inserted into pcDNA-HA vector, and named pHA-MIF.

primer order SEQ ID NO: Forward
primer GCGC GAATTC GCCATGCCGATGTTCATCGTA
(Bold indicates the EcoR I restriction site) 10 Reverse
primer GCGCAGATCT GGTACCG GGCGAAGGTGGAGTT
(Bold indicates the Kpn I restriction site) 11

To prepare the pHA-XIAP plasmid, PCR was performed using the human brain cDNA library as a template with the following primers (95 ° C for 3 minutes; 45 seconds at 95 ° C, 45 seconds at 60 ° C, 1 Min for 32 cycles, using pfu DNA polymerase; 72 ° C for 1 min). The amplified MIF fragment was digested with EcoR I and Kpn I restriction enzymes and inserted into the pcDNA-HA vector and named pHA-XIAP.

primer order SEQ ID NO: Forward
primer GCGC GAATTC ATGACTTTTAACAGTTTTGAA
(Bold indicates the EcoR I restriction site) 12 Reverse
primer GCGCAGATCT GGTACCG AGACATAAAAATTTTTTGCTT
(Bold indicates the Kpn I restriction site) 13

To prepare the pSOD1 plasmid, PCR was performed using the human brain cDNA library as a template and the following primers (Yoon, JY, et al., EMM, 2009. 41 (9): p. 611-7) 3 minutes at 95 ° C, 45 seconds at 95 ° C, 45 seconds at 60 ° C, and 1 minute at 72 ° C, using pfu DNA polymerase at 72 ° C for 1 minute). The amplified fragment SOD1 (Genbank Accession No. EF151142) is EcoR I and Kpn I restriction enzyme, inserted into pcDNA3.0 vector, and named pSOD1.

primer order SEQ ID NO: Forward
primer GCGC GAATTC ATGGCGACGAAGGCCGTGTGC
(Bold indicates the EcoR I restriction site) 14 Reverse
primer GCGC GGTACCGTTGGGCGATCCCAATTACACCA
(Bold indicates the Kpn I restriction site) 15

pHA-Parkin-HA and pMYC-Parkin-HA To prepare the plasmid, a Parkin-HA fragment from pBS-Parkin-HA (cut into Xho I and Xba I) was cloned into a pcDNA-Myc vector in which Parkin-FLAG was deleted by cleaving with XhoI and XbaI in pMyc-Parkin-FLAG Respectively. HA-HA was constructed by cloning Parkin-HA fragments into pcDNA-HA ( BamH I and Xba I cleavage) expression vectors. (Nam, MK, et al., Journal of Life Science, 2005. 15 (6): p. 916-22).

Example  2. E. coli Growth analysis

The plasmid prepared in Example 1 was transformed into E. coli After introduction into TOP10 (Invitrogen) And seeded in LB (LB-amp broth) containing ampicillin and cultured at 37 [deg.] C. Growth of E. coli was monitored by measuring absorbance (OD ₆₀₀ ) at 600 nm using a spectrophotometer (Pharmacia Biotech, UK). The growth curve was shown by Sigma Plot program version 9.0. The error bar represents the mean standard error (SEM) for three independent experiments. Statistical significance was assessed by one-way ANOVA and Tukey post-hoc comparison of means tests.

One ng of the plasmid was transformed into DH5? And TOP10 competent cells and cultured in LB-amp agar plates at 37 占 폚 for 9 to 12 hours, respectively. Colonies were imaged using a CCD camera imaging system (Bio-Rad), and Image Tool software (UTHSCSA image tool, version 2.0, http://ddsdx.uthscsa.edu/dig/ provided in the public domain by the University of Texas Health Sciences Center, San Antonio, TX).

Example  3. Cell culture and Transfection

HEK293T cells were cultured in DMEM medium containing 8.5% (v / v) heat-inactivated fetal bovine serum (Invitrogen). 1 μg plasmid DNA (0.9 μg target plasmid and 0.1 μg pCS-EGFP plasmid) was transfected into HEK293T cells (2 × 10 ⁵ cells / well) in a 6-well plate using 3 μl Fugene HD (Promega) transfection reagent . After 18 hours, cells were stained with 4 ', 6-diamidino-2-phenylindole (DAPI). GFP-positive cells were analyzed by fluorescence microscopy (Carl Zeiss) to monitor the nuclei of condensed or fragmented apoptotic cells.

Example  4. Immune Blot  ( Immunoblot , IB ) analysis

E. coli For immunoblot analysis of cultures, cultured E. coli (OD ₆₀₀ = 0.6 or 1 x 10 ⁸ cells per ml) was centrifuged at 16,100 xg for 1 minute to collect cells. Cells were lysed in 80 μl of 1 × SDS loading buffer 58.3 mM Tris-HCl pH 6.8, 2% SDS, 5% glycerol, 0.004% bromophenol blue, 0.05 mM EDTA, 144 mM β-mercaptoethanol and heated for 3 minutes .

For immunoblot analysis on HEK293T cells, the transfected cells were treated with radioimmunoprecipitation buffer (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1% SDS, 1% Triton X-100 , 1% sodium deoxycholate), 10 μg / ml aprotinin, 10 μg / ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride for 30 minutes with ice. E. coli (1.8 x 10 ⁷ cells, 14 μg) and HEK293T cell lysate (20 μg) were dissolved in 13% SDS-PAGE and transferred to a nitrocellulose membrane. Anti-FLAG monoclonal antibody (Sigma, CA), anti-HA polyclonal antibody (Santa Cruz Biotech., CA) and anti-HtrA1 polyclonal antibody (Ab Frontier, Korea) were used for immunoblot analysis. Secondary anti-mouse or anti-rabbit immunoglobulin G (IgG) conjugated with HRP (Horseradish peroxidase) was purchased from Santa Cruz Biotechnology. Protein was detected using ECL (enhanced chemiluminescence) immunoblotting system SUPEX kit (Neuronex, Korea). The density of the target protein bands was measured using Multi Gauge V3.1 software (Fuji film).

Experiment result

One. pHA -M- HtrA1  By mammalian expression vector E. coli in HtrA1 Lt; / RTI > HtrA1  By serine protease E. coli of  Growth was inhibited.

Overexpression of the target gene in mammalian cells is a necessary process for studying human target genes in mammalian cell systems. In the present invention, human HtrA1 was selected as a target gene, and various HtrA1 constructs were constructed using pcDNA3.0 and pCS2 + vectors (FIG. 1A).

Target gene expression in mammalian cells is derived from the human CMV promoter (hCMV p) for the pcDNA3.0 vector and from the corresponding sCMV promoter in the monkey for the hCMV promoter in the case of the pCS2 + vector. This vector contains the T7 and SP6 promoters originated from bacteriophages T7 and SP6 and these promoters are located in opposite directions in the vector and can be used to synthesize a sense or antisense probe through in vitro transcription . In molecular and cellular biology studies, target protein-specific antibodies (Ab) are essential for identifying target proteins over-expressed in mammalian cells. However, there is still a limit to the specificity of commercially available Ab or directly produced Ab. (YPYDVPDYA, SEQ ID NO: 2), FLAG (DYKDDDDK, SEQ ID NO: 4), and MYC (EQKLISEEDL, SEQ ID NO: 5) at the N- and / or C-terminus of the target protein A technique of tagging a sequence encoding a small peptide having properties is used.

In the present invention, FLAG was tagged at the C-terminal of HtrA1 as an in-frame to more specifically and efficiently detect the expression of mature-HtrA1 (M-HtrA1). In addition, the HtrA1 serine protease has a HA tag at the N-terminal region of M-HtrA1, since mature form is formed through processing but the exact cleavage site is not yet known 1a).

For transfection into mammalian cells, a large amount of plasmid DNA is required. For this purpose, the target plasmid DNA is introduced into E. coli After transformation and replication in the system, the target plasmid DNA must be obtained. Of the culture was the E. coli containing the respective plasmids for this purpose, which contains pHA-M HtrA1-plasmid in LB-amp broth E. coli Gt; E. coli < / RTI > containing different plasmids Which is almost not grown. To confirm this phenomenon and to analyze it more accurately, we used E. coli And the degree of growth was compared and analyzed. First, 1 ng of each plasmid was introduced into E. coli The number of colonies formed after transformation into DH5α was measured, and E. coli The degree of growth was compared. As a result, a control E. coli containing pcDNA3.0 , More than 100 colonies could be identified, whereas E. coli containing the pHA-M-HtrA1 plasmid showed almost no colonies (Fig. 1d)

In addition, E. coli , another strain commonly used for gene cloning, TOP10 transformed with the plasmid to the cells and to analyze the cell growth according to the time interval, the absorbance at 600 nm every 2 hours (OD _600, optical density at 600 nm) E. coli by measuring the (Fig. 1B). E. coli Maintains a relatively constant number of cells in the lag phase, which is the initial growth stage, and reaches an exponential or log phase with rapid growth and rapid growth. In the larval stage, cell numbers multiply every 20-30 minutes and cell division occurs at a constant rate. In this experiment, the control E. coli containing pcDNA3.0 stays in the induction stage (preparation stage before cell proliferation) for about 4 hours (OD ₆₀₀ = 0.1) and gradually enters the logarithmic growth phase (OD ₆₀₀ = 1.8 at 10 hr incubation). However, E. coli containing pHA-M-HtrA1 (OD ₆₀₀ = 0.1 at 12 hr incubation) but did not grow at all until 10 hours incubation time. Comparing the results of incubation for 6 hours, E. coli containing pHA-M-HtrA1 Cell numbers were determined using a control E. coli 0.02% of the cell number. Lt; RTI ID = 0.0 > E. coli < / RTI > HtrA1 is expressed in the cell and suppressed cell growth.

On the other hand, pHA-M encoding the same pcDNA3.0 plasmid backbone as pHA-M-HtrA1 but encoding a mutation in which HtrA1 proteolytic activity is inactivated (serine in the 328 amino acid residue of catalytic domain of serine protease replaced with alanine) For E. coli containing the-S328A plasmid, Control E. coli . In addition, pCS-M-HtrA1 was observed to grow at the level of control E. coli, even though it had wild-type HtrA1. This phenomenon is caused by E. coli Because of the similarity to the results in DH5α case, specific E. coli It can be seen that this is not a limiting phenomenon that occurs only in the strain.

These results suggest that the M-HtrA1 protein is expressed from the pHA-M-HtrA1 plasmid and that the proteolytic activity of HtrA1 plays an important role in the survival of E. coli . To investigate this, the expression of HtrA1 was examined by immunoblot analysis (Fig. 1C). Immunoblotting with a FLAG antibody that specifically reacted with the FLAG tag fused to the C-terminus of M-HtrA1 resulted in the detection of a 39-kDa protein band from pHA-M-HtrA1 and pHA-M-S328A, Lt; RTI ID = 0.0 > 39-kDa < / RTI > band was M-HtrA1. However, it was confirmed that no M-HtrA1 was expressed from the pCS-M-HtrA1 plasmid.

In this experiment with the E. coli and expressed in M-HtrA1 protein is E. coli from a mammalian expression vector pHA-M HtrA1-plasmid can not be expected for the target protein expression, the expressed HtrA1 E is a serine protease-dependent manner and that it affects the survival of E. coli .

2. E. coli in target  For gene expression, T7  Promoter and 5'-contiguous sequence coding HA  I need a tag.

Expression vectors used in mammalian model systems include the bacteriophage T7, SP6 promoter used in in vitro transcription with the CMV promoter or the sCMV promoter. Endogenous E. coli RNA polymerase itself has a very low selectivity for the T7 / SP6 promoter, and E. coli lacking the T7 / SP6 RNA polymerase TOP10 and E. coli DH5α is known to induce almost no expression of the target gene from the T7 / SP6 promoter. Nevertheless, in the present invention, it was unexpectedly confirmed that HtrA1 is expressed clearly from the pHA-M-HtrA1 mammalian vector system in E. coli . This suggests that certain elements present in the pHA-M-HtrA1 mammalian expression vector may play an important role in the expression of human target genes.

To investigate whether this phenomenon is HtrA1-specific, the present inventors prepared a plasmid having a different target gene in place of HtrA1 in the pHA-M-HtrA1 plasmid and determined the expression of the target gene in E. coli by immunoblot analysis (Fig. 2a). As a result, it was confirmed that the X-linked inhibitor of apoptosis protein (XIAP) and the macrophage migration inhibitory factor (MIF) using HA tag are expressed in E. coli as in the case of HtrA1, In the case of SOD1 (superoxide dismutase 1), expression was not confirmed even though T7 promoter was present. In addition, in the case of pCS-HA-M-HtrA1 in which the N-terminal HA tag was present, M-HtrA1 was not expressed at all from the pCS-M-HtrA1 containing the SP6 promoter at the 5 ' It was observed that M-HtrA1 was expressed in an amount of about 20 times as much as that expressed from the plasmid (Fig. 1C).

Next, in order to investigate whether the expression of the target gene is specific to the nucleotide sequence encoding the HA tag, the expression of Parkin tagged with HA and MYC at the N-terminal was amplified in the pcDNA3.0 vector backbone (Fig. 2B). As a result, the expression of HA-tagged Parkin could be confirmed, but the expression of Myc-tagged Parkin could not be confirmed at all.

These results indicate that the nucleotide sequence encoding the T7 promoter and the HA tag used to detect protein expression used for in vitro transcription in mammalian vector systems can also direct expression of the target gene in E. coli Suggesting that it can act as a cis-acting element. In addition, this phenomenon is not a phenomenon that occurs only specifically in HtrA1, but it is a general phenomenon that occurs in many target genes.

Although the precise mechanism is not yet known, it is presumed that the HA coding nucleotide sequence present downstream of the T7 promoter is E. coli Enhances the ability of RNAP to recognize the T7 promoter, or increases the processivity, thereby increasing target gene expression.

3. pHA -M- HtrA1  Mammalian expression vectors E. coli in  human target  Can be used as a system for evaluating gene expression and function.

Generally, it takes at least one week to elucidate the expression and function of a target gene in a mammalian cell after cloning a target gene into a mammalian expression vector. In addition, when the target gene is cloned into an expression vector system and then transfected into mammalian cells, the expression of the target protein often fails to be confirmed. Therefore, a system that can minimize the experiment time and evaluate the expression of the cloned vector more efficiently is needed.

The results discovered in the present invention can be utilized not only in the mammalian cells of the pHA-M-HtrA1 mammalian expression vector, but also in the E. coli target gene expression and its function Toxicity) in a system that can be evaluated in advance.

In order to verify this, the present inventors have found that E. coli (FIG. 3) and mammalian cells (FIG. 4). First, the presence of the N- terminal HA tag with the T7 promoter present in plasmid pcDNA3.0 of HtrA1 expressed in E. coli and E. coli To further confirm whether or not it affected the growth, a pM-HtrA1 plasmid was constructed from which the nucleotide sequence encoding the HA tag was removed from the pHA-M-HtrA1 plasmid (Fig. 3a). As a result, unlike the case of the pHA-M-HtrA1 plasmid, no expression of HtrA1 was observed from E. coli containing the pM-HtrA1 plasmid (Fig. 3b). In addition, since HtrA1 expression does not occur, E. coli Without affecting growth, E. coli containing the control vector (Fig. 3C). ≪ tb >< TABLE >

In order to confirm whether the above pHA-M-HtrA1 and pM-HtrA1 plasmids also work in mammalian cells, HEK293T cells were transfected with these plasmids and examined for HtrA1 expression and cytotoxicity according to expression by DAPI staining . As a result, both plasmids showed that 37-kDa M-HtrA1 was expressed in HEK293T cells (Fig. 4A) and that cell death was similar (Fig. 4B).

In conclusion, our data demonstrated for the first time that human target genes are expressed in E. coli due to the presence of the N-terminal HA tag coding sequence with the T7 promoter. Based on the results of this study, the pHA-M-HtrA1 mammalian vector system can be used to measure the expression of the target protein within 24 hours in E. coli . Therefore, And can be utilized as a vector system for the above. In addition, it can be applied as a whole-step system for rapid diagnosis of the induction of cell death or cytotoxicity of target genes in mammalian cells within 10 to 24 hours in E. coli . Furthermore, E. coli , which may occur in molecular biological studies such as mammalian expression cloning, Provide new insights into the solution of growth problems.

<110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> A use of mammalian vector including T7 promoter and N-terminal HA          tag for the over-expression of human genes in E. coli <130> DPP20122395 <160> 15 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Bacteriophage T7 <220> <221> promoter <222> (1) <223> T7 promoter <400> 1 taatacgact cactataggg 20 <210> 2 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of HA tag <400> 2 Tyr Pro Tyr Asp Val Pro Asp Tyr Ala   1 5 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of HA tag <400> 3 tacccttacg atgtaccgga ttacgca 27 <210> 4 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> FLAG tag <400> 4 Asp Tyr Lys Asp Asp Asp Asp Lys   1 5 <210> 5 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> MYC tag <400> 5 Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu   1 5 10 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 6 aagcttatgc tgcagcgcgg agcctgc 27 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 7 ctcgagctac ttgtcatcgt cgtccttgta 30 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 8 atcgatatgt acccttacga tgtaccg 27 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 9 ctcgagctac ttgtcatcgt cgtccttgta 30 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 10 gcgcgaattc gccatgccga tgttcatcgt a 31 <210> 11 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 11 gcgcagatct ggtaccgggc gaaggtggag tt 32 <210> 12 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 12 gcgcgaattc atgactttta acagttttga a 31 <210> 13 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 13 gcgcagatct ggtaccgaga cataaaaatt ttttgctt 38 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 14 gcgcgaattc atggcgacga aggccgtgtg c 31 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 15 gcgcggtacc gttgggcgat cccaattaca cca 33

Claims (10)

A T7 RNA polymerase comprising a T7 promoter consisting of the nucleotide sequence of SEQ ID NO: 1, a nucleotide sequence encoding an HA tag, and a vector comprising a gene encoding an exogenous protein in the 5 'to 3' direction in sequence ( Escherichia coli ). &Lt; / RTI &gt;
The composition of claim 1, wherein the E. coli is an E. coli DH5? Strain or an E. coli TOP10 strain.
delete 2. The composition of claim 1, wherein the base sequence encoding the HA tag is comprised of the nucleotide sequence of SEQ ID NO: 3.
The composition of claim 1, wherein the exogenous protein is a human-derived protein.
6. The method of claim 5, wherein the human-derived protein is selected from the group consisting of a peptide, a polypeptide, a binding protein, a binding domain, an attachment protein, a structural protein, a regulatory protein, a toxin protein, an enzyme, an enzyme inhibitor, a hormone, An antigen, a cytokine, and a modulator.
7. The composition of claim 6, wherein the human-derived protein is HtrA1 (high temperature requirement protein A1), X-linked inhibitor of apoptosis protein (XIAP), macrophage migration inhibitory factor (MIF)
7. Escherichia coli comprising a vector of the composition of any one of claims 1, 2 and 4 to 7, which does not contain T7 RNA polymerase and which expresses a foreign protein from said vector.
9. A method for producing an Escherichia coli strain comprising the steps of:
A method for expressing or producing an exogenous protein.
Culturing the Escherichia coli of claim 8, and
And a step of analyzing the transformation of the Escherichia coli and the degree of growth inhibition.
Methods for functional analysis of exogenous proteins.

Images