KR101422248B1 - Issatchenkia orientalis ms-1 and its use - Google Patents

Abstract

The present invention relates to a process for the preparation of isatin cyanide ( Issatchenkia < RTI ID = 0.0 > orientalis ) KCTC 12141BP (Korean Collection for Type Culture, entitled: Feb. 21, 2012) and a fermented food using the same. Ischeliaquia orientalis MS-1, which is excellent in acid resistance, sparing resistance and alcohol resistance and excellent in flavor during fermentation according to the present invention, as evidenced by the examples of the present invention, can be used even in an acidic condition of pH 2 It is possible to grow at a growth rate of 88% or more as compared with the optimal growth pH of pH 5.3, and grow at a concentration of 0.4% oxalic acid and 0.4% acetic acid. When the citric acid and malic acid are treated with more than 1% Lt; RTI ID = 0.0 > fermentation < / RTI > In addition, it is possible to ferment under high osmotic conditions such as honey because it can grow even under high concentration of sugar content of 40% or more. Unlike a variety of commercially available saccharomyces cerevisiae in fermentation, it can grow in 10% alcohol treatment, It is useful for fermentation under conditions requiring high alcohol tolerance. In addition, it is an extremely useful invention in the fermented food industry because it has an excellent effect that can be used for producing a honey-fermented beverage and a traditional food having excellent flavor during fermentation and thus improving sensuality.

Description

&Quot; ISSATCHENKIA ORIENTALIS MS-1 AND ITS USE "

The present invention relates to a process for the preparation of isatin cyanide ( Issatchenkia < RTI ID = 0.0 > orientalis ) KCTC 12141BP (Korean Collection for Type Culture, entitled: Feb. 21, 2012) and a fermented food using the same.

As interest in health has increased in modern society, interest in slow foods and fermented foods is increasing. Fermented food refers to food produced through the process of microbial growth by naturally or artificially adding microorganisms (GRAS: gnentically recognized as safe) to the raw materials of food. The fermented food is fermented in terms of nutrition and physiology Compared with the raw materials of fermented food, digestion and absorption are facilitated, and the sensuality such as flavor and taste is enhanced. During the fermentation process, various new beneficial substances such as bithimine and amino acid are produced and toxic substances are destroyed, (Probiotics) that are beneficial to the body. In terms of food processing and storage, it also has effects of increasing storage of food and food ingredients, shortening cooking time, and reducing energy use.

The microorganisms used for fermentation can be largely classified into bacteria and fungi. Representative examples of bacteria include lactic acid bacteria used for the production of kimchi or yogurt, and Bacillus subtilis used for the production of chongkukjang or doenjang etc., and representative examples of fungi include alcohol Fermented yeast used in the fermentation or bakery industry, and various germs such as Hwanggukyun, black germ, and Honggookyun which are used in the starch decomposition industry. For the dual alcohol fermentation, saccharomyces cerevisiae S. cerevisiae yeasts have been widely used.

However, when alcohol fermentation is carried out using saccharomyces cerevisiae, the fermentation does not progress due to low osmotic pressure resistance at high concentration sugar conditions such as honey, despite excellent alcohol efficacy. In case of containing a large amount of organic acid, the fermentation is delayed due to low acid resistance, and the growth of alcohol produced by alcohol fermentation is decreased, so that efficient alcohol fermentation can not proceed.

Therefore, studies on the development of yeast strains having excellent acid resistance, resistance to alcohol, and alcohol resistance have been continuously carried out (for example, Korean Patent No. 10-0770607). Yeast strains which are excellent in acid resistance and resistance to sugar and can provide flavor can be used not only for alcohol fermentation but also for traditional fermentation such as sikhye fermentation and lactic acid fermentation, and proper yeast growth and yeast fermentation , It produces alcohol around 1% and produces a variety of flavor substances, so that it can be usefully used for the production of high quality fermented food that is aged properly.

Accordingly, the present inventors have developed a yeast strain excellent in acid resistance, resistance to sugar and alcohol resistance, which can be used for fermented food production under high and low pH conditions, The yeast was isolated, and the present invention was completed by isolating yeast strain Chenkiah Orientalis MS-1, which is excellent in acid resistance, sparing resistance and alcohol resistance, and excellent in flavor.

Korean Patent No. 10-0770607

SUMMARY OF THE INVENTION The present invention has been made in order to solve the problems of the prior art, and it is an object of the present invention to provide a novel yeast strain having excellent acid resistance, resistance to sugar and alcohol resistance.

Another object of the present invention is to provide a fermented food using the novel yeast strain of the present invention.

In order to solve the above-mentioned problems, the present invention relates to a novel yeast strain excellent in acid resistance, resistance to wasting and alcohol resistance, which is Accession No. KCTC 12141BP, Issatchenkia orientalis ) MS-1.

It is preferred that the strain has the following mycological properties:

(1) Bacterial form: white to cream-colored round colony, 2x5 μm elliptic, post-culture membrane formation;

(2) Emergence: multiparous germination, simple hyphae form, but over 30% sugar concentration, development of gastric hypha;

(3) spore formation: conidia formation;

(4) Growth temperature: 20 to 40 캜 (optimum temperature 30 to 37 캜);

(5) Growth pH: pH 2-9 (optimum pH 3-8);

(6) Efficacy: glucose, fructose, sugar fermentation;

(7) Magnetizing ability: Lactic acid, citric acid, ethanol, succinic acid, malic acid, acetic acid, ethylamine, lysine, cardabelinization;

(8) Production enzymes: alkaline phosphatase, esterase, leucine arylamidase, chymotrypsin, acid phosphatase, alpha-galactosidase, beta-galactosidase, alpha-glucosidase, Shidaje production;

(9) Acid resistance: Growth of over 88% at pH 2 compared to pH 5.3, the optimum growth condition. Growth same as untreated at 0.4% oxalic acid, 1% citric acid and 1% Over 65% of the growth;

(10) Growth inhibition: 109%, 85%, 42% and 10.7%, respectively, compared to 1% glucose medium in 10%, 20%, 30% and 40% glucose media;

(11) Alcohol tolerance: 89% and 17.3% growth respectively in 5% and 10% alcohol-supplemented media compared to 0% alcohol medium;

(12) Efficacy: 46.5% efficacy (alcohol production 6% (v / v)) in 120% fermentation in 20% glucose medium;

(13) Flavor when fermenting: production of isobutanol, 1-butanol, isoamyl alcohol, phenethyl alcohol (ethyl caprylate, linalool, non-methanol production).

The present invention also relates to the novel yeast strain of the present invention, Issatchenkia < RTI ID = 0.0 > orientalis MS-1 as a fermentation strain.

As the fermentation substrate of the fermented food, it is preferable to use fruits or vegetables.

Ischeliaquia orientalis MS-1, which is excellent in acid resistance, sparing resistance and alcohol resistance and excellent in flavor during fermentation according to the present invention, as evidenced by the examples of the present invention, can be used even in an acidic condition of pH 2 It is possible to grow at a growth rate of 88% or more as compared with the optimal growth pH of pH 5.3, and grow at a concentration of 0.4% oxalic acid and 0.4% acetic acid. When the citric acid and malic acid are treated with more than 1% Lt; RTI ID = 0.0 > fermentation < / RTI > In addition, it is possible to ferment under high osmotic conditions such as honey because it can grow even under high concentration of sugar content of 40% or more. Unlike a variety of commercially available saccharomyces cerevisiae in fermentation, it can grow in 10% alcohol treatment, It is useful for fermentation under conditions requiring high alcohol tolerance. In addition, it is an extremely useful invention in the fermented food industry because it has an excellent effect that can be used for producing a honey-fermented beverage and a traditional food having excellent flavor during fermentation and thus improving sensuality.

Figure 1 shows a micrograph of Ischienki Orientalis MS-1. The left side is the photograph of the strain in the 2% glucose medium and the right side shows the strain photograph in the 30% glucose medium.

Hereinafter, the present invention will be described in detail.

The present invention relates to Isocyanicia orientalis MS-1, which is excellent in acid resistance, resistance to alcohol and alcohol, and which has excellent flavor during fermentation, and its use.

The inventors of the present invention have isolated 20 kinds of yeast from the Andong sikhye, the potato, the leaven, the private honey honey and the plant fermented product in Gyeongbuk province and evaluated the acid resistance, the sugar resistance, the alcohol resistance, the efficacy and the flavor upon fermentation among them Finally, Ischchenia Orientalis MS-1 was isolated.

Accordingly, the present invention is directed to the use of a compound of formula < RTI ID = 0.0 > orientalis ) KCTC 12141BP.

The Isischenkia orientalis strain MS-1 was deposited at the Life Resource Center of the Korea Biotechnology Research Institute on February 21, 2012, and the deposit number is KCTC 12141BP.

Hereinafter, the isolation method, bacteriological properties, and uses of Isczkyria orientalis MS-1 of the present invention will be described in detail.

[Isolation and Identification of Isocyanic acid Orientalis MS-1]

(1) The Andong sikhye, the potato, the yeast and the private honey honey and the plant fermented product produced in the private area in Kyungbuk province were recovered and 1 ml of each of these supernatants was dissolved in YPD (yeast extract 0.5 %, polypeptone 0.5%, dextrose 2%, ampicillin 100 μg / ml), and then cultured in a 37 ° C shaking incubator for 24 hours. Then, 0.1 ml of the culture solution was spread on a YPD agar medium to separate growth colonies.

(2) isolates were cultured again in YPD medium (pH 2), and acid-resistant strains were secondly selected.

(3) The selected strain was fermented in 10% glucose medium (yeast extract 0.5%, polypeptone 0.5%, glucose 10%) for 48 hours and the flavor was evaluated to finally select the best flavor MS-1 strain.

(4) The superiority of the MS-1 strain was confirmed by comparing the acid-fast, salt-tolerant and alcohol-resistant properties of six strains of alcoholic fermentation commercial Saccharomyces cerevisiae, which are known to have excellent resistance to endurance and alcohol resistance, The isolate was identified as a new strain of Ischchenia orientalis.

[Characteristics of strain]

(1) Form of bacteria: White to cream-colored round colony, 2x5 μm elliptic,

(2) Sprouting: multiple sprouting, simple hyphae, but the hyphae were developed at a sugar concentration of 30% or more (see FIG. 1)

(3) spore formation: adenocyst formation,

(4) Physiological properties

Growth temperature: 20 ~ 40 ℃ (optimum growth 30 ~ 37 ℃),

Growth pH: pH 2 to 9 (optimum pH 3 to 8),

Efficacy: glucose, fructose, sugar fermentation,

Magnetizing ability: Lactic acid, citric acid, ethanol, succinic acid, malic acid, acetic acid, ethylamine, lysine,

Production enzymes: production of alkaline phosphatase, esterase, leucine arylamidase, chymotrypsin, acid phosphatase, alpha-galactosidase, beta-galactosidase, alpha-glucosidase, beta-glucosidase ,

Acid resistance: Growth of more than 88% of the growth at optimum growth pH (5.3) at pH 2, same growth as untreated at 0.4% oxalic acid, 1% citric acid and 1% 65% or more of non-treated,

The tolerance was increased by 109%, 85%, 42% and 10.7%, respectively, compared with 1% glucose medium in 10%, 20%, 30%

Alcohol tolerance: increased by 89% and 17.3%, respectively, compared to 0% alcohol medium in 5% and 10%

(5) Fermentation characteristics

Efficiency: 46.5% efficacy (alcohol production 6% (v / v)) when fermented for 120 hours in 20% glucose medium,

Flavor on fermentation: Isobutanol, 1-butanol, isoamyl alcohol, phenethyl alcohol production (ethyl caprylate, linalool, non-methanol production).

The present invention also relates to the novel yeast strain of the present invention, Issatchenkia < RTI ID = 0.0 > orientalis MS-1 as a fermentation strain.

The fermentation substrate of the fermented food may be honey of high sugar content, fruits or vegetables rich in organic acids, and the like.

In one preferred embodiment, the fermented food comprises: (1) a honeycomb which is prepared by mixing appropriate nutrients to honey and 1 to 20% of Isocyanichia orientalis MS-1, and fermenting at room temperature for at least one week (2) Growth factors such as vitamins and amino acids are added to the Chinese cabbage, radish, or various crustaceans or extracts of various wild plants, and 0.5-20% of Isocyanicia orientalis MS-1 is inoculated. (3) Growth factors such as vitamins and amino acids were added to fruits, such as apples, pears, grapes, and peaches, or extracts, and then Isocyanic acid orientalis MS- Fermented beverages manufactured by fermenting at 30 to 37 ° C for about one week after 20% inoculation.

Hereinafter, the specific method of the present invention will be described in more detail by way of examples. The following examples are only a preferred embodiment of the present invention, and the scope of the present invention is not limited to the scope of the following examples.

[Example]

Example  One: Ischchenia Oriental lease MS -1 Isolation and Identification

From May to September 2011, about 20 kinds of Andong sikhe, private pickled honey, and Sanayasen fermented products were collected from Andong, Gyeongbuk province and tried to isolate yeast strains with excellent acid resistance, endurance and alcohol resistance. 1 ml of each supernatant of the collection sample was added to 50 ml of a liquid medium of YPD (yeast extract 0.5%, polypeptone 0.5%, dextrose 2%, ampicillin 100 μg / ml) adjusted to pH 2, , And 0.1 ml of the culture was spread on a YPD agar medium to separate 10 growth colonies first. The addition of the anti - bacterial agent, epicylin, prevented the proliferation of acidophilic bacteria at the early stage of the screening. (MS-1, MS-2, and MS-3) were selected for the first time in the YPD medium (pH 2) After fermentation for 48 hours in each medium (yeast extract 0.5%, polypeptone 0.5%, glucose 10%), the flavor was evaluated and finally the MS-1 strain with the best flavor was finally selected. The isolated strain was identified as Issatchenkia orientalis as a result of 26S rDNA sequencing analysis and deposited as a new KCTC 12141BP in the Korean Collection for Type Culture at the Korea Research Institute of Bioscience and Biotechnology One).

The final isolate, Isserchenkia orientalis ) 26S rDNA sequence (553 bp) of MS-1, TCAGTAGCGGCGAGTGAGCGGCAAGAGCTCAGATTTGAAATCGTGCTTTGCGGCACGAGTTGTAGATTGCAGGTTGGAGTCTGTGTGGAAGGCGGTGTCCAAGTCCCTTGGAACAGGGCGCCCAGGAGGGTGAGAGCCCCGTGGGATGCCGGCGGAAGCAGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAGCGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGCGCCCGACATGGGGATTGCGCACCGCTGCCTCTCGTGGGCGGCGCTCTGGGCTTTCCCTGGGCCAGCATCGGTTCTTGCTGCAGGAGAAGGGGTTCTGGAACGTGGCTCTTCGGAGTGTTATAGCCAGGGCCAGATGCTGCGTGCGGGGACCGAGGACTGCGGCCGTGTAGGTCACGGATGCTGGCAGAACGGCGCAACACCGCCCGTCTTG

Example  2: Ischchenia Oriental lease MS -1 of Acid resistance

To confirm the acid resistance of Isocyanic acid MS-1, YPD liquid medium (yeast extract 0.5%, polypeptone 0.5%, dextrose 1%), which was variously adjusted with 1N hydrochloric acid (HCl) and 1N sodium hydroxide The cultured MS-1 strain was inoculated so that the initial absorbance (600 nm) was 0.04, and then the degree of growth was evaluated after culturing for 24 hours. The pH ranged from 0.78 to 13.02 and six commercial fermentation strains (Saccharomyces cerevisiae) known to have excellent acid resistance were used as control. IFO 0233 strain was purchased from the Institute of Fermentation, Osaka, Japan, and the remaining five commercially available fermentation strains were purchased from Ilsan. Commercial strains were also inoculated with the initial absorbance (600 nm) of 0.04 as described above, and then cultured at 30 ° C for 24 hours. The results are shown in Table 2.

Comparison of the growth of MS-1 and commercial fermentation yeasts at various pH conditions (unit: absorbance, 600 nm) pH MS -One IFO KCCM M-07 S- O7 I-84 0233 1223 50549 0.78 0.000 0.000 0.000 0.000 0.000 0.000 0.000 1.10 0.000 0.002 0.002 0.002 0.001 0.002 0.004 2.09 0.830 0.011 0.004 0.005 0.004 0.022 0.031 3.10 0.897 0.761 0.791 0.644 0.991 0.810 0.775 4.11 0.897 0.739 0.791 0.664 0.795 0.803 0.664 5.29 0.944 0.742 0.809 0.724 0.746 0.757 0.696 6.10 0.908 0.677 0.816 0.707 0.742 0.703 0.686 7.08 0.977 0.689 0.718 0.722 0.798 0.762 0.682 8.18 0.946 0.598 0.692 0.719 0.807 0.723 0.697 9.13 0.337 0.604 0.009 0.606 0.044 0.008 0.001 10.05 0.008 0.001 0.001 0.001 0.001 0.001 0.001 11.26 0.001 0.001 0.001 0.001 0.000 0.001 0.000 12.01 0.001 0.001 0.001 0.000 0.001 0.001 0.001 13.02 0.001 0.001 0.001 0.001 0.001 0.001 0.001

IFO: Institute of Fermentation, Osaka, Japan

KCCM: Korean Center for Microorganism Conservation, Korean Culture Center of Microorganism, Seoul, Korea

As shown above, the MS-1 strain only grew at pH 2.09 and was able to grow similar to IFO M-07 and IFO I-84 at pH 9.13. Thus, the strain MS-1 is able to grow in a wide range of pH 2 to 9 and has excellent acid resistance.

On the other hand, organic acids, unlike inorganic acids, were more effective in inhibiting yeast growth even at low concentrations. Therefore, acid resistance to oxalic acid, acetic acid, malic acid and citric acid was evaluated. As a result, as shown in Tables 3, 4, 5 and 6, strain MS-1 was grown in the same manner as untreated at 0.4% oxalic acid, 1% citric acid and 1% And 65% or more, respectively. Thus, it was confirmed that the fermented yeast showed excellent acid resistance than any commercially available fermented yeast.

Comparison of the growth of MS-1 and commercial fermenting yeasts under various oxalic acid treatment conditions (unit: absorbance, 600 nm) Oxalic acid (%) MS -One IFO KCCM M-07 S- O7 I-84 0233 1223 50549 0.0 1.002 0.729 0.892 0.802 0.382 1.026 0.947 0.2 1.077 0.687 0.825 0.706 0.021 0.669 0.915 0.4 0.986 0.080 0.004 0.020 0.002 0.046 0.117 0.6 0.124 0.002 0.000 0.004 0.000 0.002 0.002 0.8 0.013 0.003 0.000 0.004 0.003 0.004 0.002 1.0 0.003 0.000 0.000 0.003 0.000 0.000 0.004

IFO: Institute of Fermentation, Osaka, Japan

KCCM: Korean Center for Microorganism Conservation, Korean Culture Center of Microorganism, Seoul, Korea

Comparison of the growth of MS-1 and commercial fermentation yeast under various acetic acid treatment conditions (unit: absorbance, 600 nm) Acetic acid (%) MS -One IFO KCCM M-07 S- O7 I-84 0233 1223 50549 0.0 1.048 0.860 1.118 0.935 0.980 1.087 0.922 0.2 0.827 0.832 0.954 0.609 0.698 0.779 0.589 0.4 0.680 0.015 0.497 0.029 0.002 0.024 0.004 0.6 0.058 0.005 -0.002 0.004 0.005 0.004 0.004 0.8 -0.003 0.005 -0.001 0.005 0.005 0.003 0.004 1.0 0.002 0.001 -0.003 0.004 0.003 0.002 -0.001

IFO: Institute of Fermentation, Osaka, Japan

KCCM: Korean Center for Microorganism Conservation, Korean Culture Center of Microorganism, Seoul, Korea

Comparison of the growth of MS-1 and commercial fermentation yeasts under various conditions of malic acid treatment (unit: absorbance, 600 nm) Malic acid
(%) MS -One IFO KCCM M-07 S- O7 I-84 0233 1223 50549 0.0 1.071 0.997 1.093 1.035 1.023 1.281 1.078 0.2 1.107 0.927 1.096 1.063 1.071 1.292 1.072 0.4 1.128 0.885 1,000 1.044 1.136 1.204 1.091 0.6 1.005 0.999 1.038 1.017 1.202 1.201 1.104 0.8 1.046 0.863 1.053 0.891 1.040 1.150 1.101 1.0 1.177 0.835 0.947 0.766 0.651 0.938 1.112

IFO: Institute of Fermentation, Osaka, Japan

KCCM: Korean Center for Microorganism Conservation, Korean Culture Center of Microorganism, Seoul, Korea

Comparison of growth of MS-1 and commercial fermentation yeast under various citric acid treatment conditions (unit: absorbance, 600 nm) Citric acid
(%) MS -One IFO KCCM M-07 S- O7 I-84 0233 1223 50549 0.0 1.174 0.972 1.108 1.029 1.015 1.116 1.087 0.2 1.177 1.052 1.118 0.964 0.916 1.138 1.025 0.4 1.189 0.874 1.095 0.991 0.951 1.115 0.970 0.6 1.194 0.861 0.985 1.014 0.949 0.883 1.034 0.8 1.239 0.850 0.974 0.923 0.821 0.869 0.901 1.0 1.194 0.742 0.973 0.825 0.497 0.586 0.577

IFO: Institute of Fermentation, Osaka, Japan

KCCM: Korean Center for Microorganism Conservation, Korean Culture Center of Microorganism, Seoul, Korea

Example  3: Ischchenia Oriental lease MS -1 of My legacy

The glucose tolerance of Ischchenkia orientalis MS-1 was determined by preparing a glucose medium containing 0 to 50% glucose in yeast extract medium (yeast extract 0.5%, polypeptone 0.5%) and then preincubating in the same manner as in Example 2 MS-1 and commercial fermented yeast were inoculated so that the initial absorbance (600 nm) was 0.04, and then cultured at 30 ° C for 24 hours. The results are shown in Table 7, and it was possible to grow even under the condition of 40% of sugar, and showed strong resistance to IFO S-07 and KCCM 1223, and showed similar resistance to IFO 0233 used in the manufacture of Japanese sake .

Comparison of Growth of MS-1 and Commercial Fermentation Yeasts at Various Glucose Concentrations (Unit: absorbance, 600 nm) Early party
density
(% w / w) MS -One IFO KCCM M-07 S- O7 I-84 0233 1223 50549 0 0.487 0.113 0.175 0.347 0.202 0.243 0.156 One 1.206 1.083 1.181 1.040 1.164 1.143 0.980 10 1.320 1.343 1.558 1.568 1.559 1.601 1.546 20 1.025 1.211 1.371 1.302 1.494 1.374 1.348 30 0.569 0.757 1.062 0.768 1.028 1.033 0.846 40 0.130 0.053 0.241 0.038 0.122 0.366 0.059 50 0.029 0.029 0.038 0.032 0.032 0.039 0.029

IFO: Institute of Fermentation, Osaka, Japan

KCCM: Korean Center for Microorganism Conservation, Korean Culture Center of Microorganism, Seoul, Korea

Example  4: Ischchenia Oriental lease MS -1 alcohol resistance

The alcohol resistance of Ischchenkia orientalis MS-1 was determined by adding 0 to 20% of anhydrous alcohol to YPD medium (yeast extract 0.5%, polypeptone 0.5%, dextrose 1%), MS-1 strain and commercial fermented yeast were inoculated so as to have an initial absorbance (600 nm) of 0.04 and then cultured at 30 ° C for 24 hours. The results are shown in Table 8. The MS-1 strain and the commercial yeast showed normal growth at the concentration of 5% alcohol (w / w), but MS-1 at the high concentration alcohol concentration of 10% (w / Only the strain was identified in the strain.

Comparison of the growth of MS-1 and commercial fermentation yeasts at various ethanol concentrations (unit: absorbance, 600 nm) Initial ethanol
density
(% w / w) MS -One IFO KCCM M-07 S- O7 I-84 0233 1223 50549 0 1.206 1.083 1.181 1.040 1.164 1.143 0.980 5 1.074 0.819 1.047 0.917 0.966 1.103 0.893 10 0.209 0.026 0.076 0.012 0.001 0.095 0.004 15 0.001 0.001 0.001 0.001 0.001 0.001 0.000 20 0.001 0.001 0.001 0.001 0.001 0.001 0.001

IFO: Institute of Fermentation, Osaka, Japan

KCCM: Korean Center for Microorganism Conservation, Korean Culture Center of Microorganism, Seoul, Korea

Example  5: Ischchenia Oriental lease MS -1 enzyme activity test

The enzymatic activity of Isenchichia orientalis MS-1 was measured using an API ZYME Kit (Korean Patent No. 10-0240687, Oct. 28, 199). Among the test enzymes, beta-glucuronidase, also known as one of the carcinogenic enzymes, was also included. As a control, Gram positive bacteria and Gram negative bacteria Escherichia coli were used, and the results are shown in the following Table 9 .

Enzymatic activity of Iscenkia orientalis MS-1 Enzyme name Bacillus Escherichia coli MS -One Control (null) 0 0 0 Alkaline phosphatase 0 2 4 C4-esterase (C4-esterase) 2 0 3 C8-esterase (C-8 esterase lipase) 2 0 3 C14-lipase (C14) 0 0 One Leucine arylamidase < RTI ID = 0.0 > 0 0 4 Valine arylamidase < RTI ID = 0.0 > 0 0 2 Cystine arylamidase 0 0 One Trypsin 0 0 One Alpha-chymotrypsin < / RTI > 0 0 3 Acid phosphatase 2 2 4 Naphthol AS-BI-phosphohydrolase
(Naphtol-AS-BI-phosphohydrolase) 2 2 2 Alpha-galactosidase < / RTI > 0 0 3 Beta-galactosidase < / RTI > 0 2 4 Beta-glucuronidase < / RTI > 0 2 0  Alpha-glucosidase < / RTI > 2 2 4 Beta-glucosidase < RTI ID = 0.0 > 0 0 3 N-acetyl-beta-glucosaminidase
(N-acetyl-β-glucosaminidase) 0 0 0 Alpha-mannosidase < / RTI > 0 0 0 Alpha-fucosidase < / RTI > 0 0 0

0 (no enzyme activity)

~ 3 (Enzyme activity usually)

~ 5 (enzyme activity is very strong)

As described above, it is known that Isocyanic acid orientalis MS-1 strongly produces acid and alkaline phosphatase, alpha and beta-galactosidase, and alpha and beta-glucosidase beta-glucosidase, - Glucuronidase activity, indicating that it is a safe strain. The Ischchenia orientalis strain has been known as a genetically recognized as safe (GRAS) strain that has been used for various wine fermentations for a long time.

Example  6: Ischchenia Oriental lease MS -1 of Efficacy  And flavor of fermented broth

The efficacy of new isolate yeast Chenkiia orientalis MS-1 and Japanese sake-fermented yeast Saccharomyces cerevisiae IFO 0233 strain was compared and evaluated. For the fermentation medium, glucose medium containing 20% glucose was prepared in YP basic medium (yeast extract 0.5%, polypeptone 0.5%), and the pre-cultured MS-1 and IFO 0233 cultures were each inoculated 2% Lt; / RTI > for 120 hours. At this time, alcohol fermentation was repeated three times using a 250 ml Erlenmeyer flask connected with a sulfuric acid fermentation tube containing 100 ml glucose medium. The results are shown in Table 10, while IFO 0233 strain showed fast fermentation speed and high efficiency, while MS-1 fermentation rate was somewhat slow and final yield was 46.5%, indicating that 6% (v / v) Alcohol production. However, with MS-1, it is possible to ferment at 40% solids (high osmotic pressure) conditions and low pH conditions (pH 3 or less) where commercial saccharomyces cerevisiae can not grow and ferment and prolonged fermentation Time, the fermentation problem does not occur since the final production alcohol concentration can be increased.

Foot efficiency in 20% glucose medium of Ischienki Orientalis MS-1 and Saccharomyces cerevisiae IFO 0233 Used strain Foot Efficiency (%) 0 12 hours 24 hours 48 hours 120 hours MS-1 0 0.2 ± 0.1 2.2 ± 0.5 13.1 ± 0.1 46.5 ± 0.1 S. cerevisiae
IFO-0233 0 0.2 ± 0.1 15.6 ± 1.6 63.5 ± 4.4 82.6 ± 5.3

The flavor components and methanol of the fermentation broth of MS-1 and IFO 0233 strains were analyzed by gas chromatography (Agilent Technologies 6890 N-5975B MSD). The pretreatment conditions and analysis conditions were as follows.

Pretreatment of flavor components: 2 ml of methylene chloride was extracted with 10 ml of the sample for 2 hours, and the solvent was removed by removing the solvent. The excess water was removed with 2 g of sodium sulfate anhydrous column, and then concentrated to a final volume of 100 μl.

(30 m x 50 m x 0.25 m), Oven: 40 deg. C 5 min hold -5 deg. C / min, 210 deg. C, 6 min, MS source: 230 ° C, MS quad: 150 ° C, solvent delay: 5 min, FID detector.

Sample preparation for methanol analysis: 100 ml of water was added to 100 ml of the sample, and then 80 ml of the distillate was recovered by distillation and the final volume was adjusted to 100 ml.

Methanol gas chromatography Analytical conditions: Inlet: 210 占 폚, Flow: 1.0 ml / min, Column: DB-WAX (30 m x 250 占 퐉 x 0.25 占 퐉), Oven: 32 占 폚, Deg.] C / min, 200 [deg.] C, FID detector.

As a result of analysis under the above conditions, both strains produced iso-propanol, iso-butanol, 1-butanol, isoamylalcohol and phenethyl alcohol , Methanol, ethyl caprylate and linalool were not produced (Table 11). In addition, MS-1 strain produced more flavor components than IFO 0233 strain, and it had a very strong flavor and strong aroma with distinctive grape flavor and orientation. Therefore, the above results show that the MS-1 strain is highly effective in fermentation of honey or natural fruit juice which requires future tolerance and acid resistance and produces a rich flavor, grape flavor and orientation, And the like.

Analysis of the flavor components of Ischchenkia Orientalis MS-1 and Saccharomyces cerevisiae IFO 0233 Flavor ingredient Fermentation medium MS-1
7 days fermentation IFO 0233
7 days fermentation 1-propanol 0 150 40 iso butanol 0 800 210 1-butanol 0 20 10 isoamylalcohol 0 2,250 1,590 피닐cohol 0 125,340 70,090 ethyl caprylate 0 0 0 피렌 ethyl acetate 0 0 0 linalool 0 0 0

Example  7: Manufacture of apple fermented beverages

After adding 1N citric acid to 1kg of apple crumbs finely crushed with a blender (Hanil Electric HMF-3150SP), the mixture was adjusted to pH 3.5 and then added with vitamin A, vitamin B1, vitamin B2, vitamin B6, vitamin C, tryptophan, lysine, methionine, 500 mg of leucine, isoleucine, threonine, and phenylalanine, respectively, were added and mixed. Then, 10 g of Isanchenia orientalis MS-1 was inoculated and fermented at 35 캜 for 1 week to prepare an apple fermented beverage.

Example  8: Manufacture of non-fermented beverages

1 kg citric acid was added to 1 kg of finely crushed non-crushed mixture and the mixture was adjusted to pH 3.5. Then, a mixture of vitamin A, vitamin B1, vitamin B2, vitamin B6, vitamin C, tryptophan, lysine, methionine, valine, leucine, isoleucine, threonine, phenylalanine Were added and mixed. Then, 10 g of Iscencia orientalis MS-1 was inoculated and fermented at 35 캜 for one week to prepare a non-fermented beverage.

Korea Biotechnology Research Institute KCTC12141BP 20120221

<110> andong national university industry-Academic cooperation foundation <120> ISSATCHENKIA ORIENTALIS MS-1 AND ITS USE <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 553 <212> DNA <213> Issatchenkia orientalis MS-1 28S rDNA <400> 1 tcagtagcgg cgagtgagcg gcaagagctc agatttgaaa tcgtgctttg cggcacgagt 60 tgtagattgc aggttggagt ctgtgtggaa ggcggtgtcc aagtcccttg gaacagggcg 120 cccaggaggg tgagagcccc gtgggatgcc ggcggaagca gtgaggccct tctgacgagt 180 cgagttgttt gggaatgcag ctccaagcgg gtggtaaatt ccatctaagg ctaaatactg 240 gcgagagacc gatagcgaac aagtactgtg aaggaaagat gaaaagcact ttgaaaagag 300 agtgaaacag cacgtgaaat tgttgaaagg gaagggtatt gcgcccgaca tggggattgc 360 gcaccgctgc ctctcgtggg cggcgctctg ggctttccct gggccagcat cggttcttgc 420 tgcaggagaa ggggttctgg aacgtggctc ttcggagtgt tatagccagg gccagatgct 480 gcgtgcgggg accgaggact gcggccgtgt aggtcacgga tgctggcaga acggcgcaac 540 accgcccgtc ttg 553

Claims (4)

Issatchenkia orientalis ) KCTC 12141BP. The method according to claim 1,
Issatchenkia orientalis KCTC 12141BP characterized by having the following mycological properties:
(1) Bacterial form: white to cream-colored round colony, 2x5 μm elliptic, post-culture membrane formation;
(2) Emergence: multiparous germination, simple hyphae form, but over 30% sugar concentration, development of gastric hypha;
(3) spore formation: conidia formation;
(4) Growth temperature: 20 to 40 캜;
(5) Growth pH: pH 2 to 9;
(6) Efficacy: glucose, fructose, sugar fermentation;
(7) Magnetizing ability: Lactic acid, citric acid, ethanol, succinic acid, malic acid, acetic acid, ethylamine, lysine, cardabelinization;
(8) Production enzymes: alkaline phosphatase, esterase, leucine arylamidase, chymotrypsin, acid phosphatase, alpha-galactosidase, beta-galactosidase, alpha-glucosidase, Shidaje production;
(9) Acid resistance: Growth of over 88% at pH 2 compared to pH 5.3, the optimum growth condition. Growth same as untreated at 0.4% oxalic acid, 1% citric acid and 1% Over 65% of the growth;
(10) Growth inhibition: 109%, 85%, 42% and 10.7%, respectively, compared to 1% glucose medium in 10%, 20%, 30% and 40% glucose media;
(11) Alcohol tolerance: 89% and 17.3% growth respectively in 5% and 10% alcohol-supplemented media compared to 0% alcohol medium;
(12) Efficacy: 46% efficacy and alcohol production 6% (v / v) when fermented in 20% glucose medium for 120 hours;
(13) Flavor when fermenting: Production of isobutanol, 1-butanol, isoamyl alcohol, phenethyl alcohol and ethyl caprylate, linalool, non-methanol production. Issatchenkia fermented food produced using orientalis) KCTC 12141BP a fermentation strain. The method of claim 3,
Wherein the fermented food is produced by using fruits or vegetables as a fermentation substrate.

Images