KR101411716B1 - Method for Screening Microorganism with High Lysine Productivity Using Riboswitch - Google Patents

Method for Screening Microorganism with High Lysine Productivity Using Riboswitch Download PDF

Info

Publication number
KR101411716B1
KR101411716B1 KR1020120066007A KR20120066007A KR101411716B1 KR 101411716 B1 KR101411716 B1 KR 101411716B1 KR 1020120066007 A KR1020120066007 A KR 1020120066007A KR 20120066007 A KR20120066007 A KR 20120066007A KR 101411716 B1 KR101411716 B1 KR 101411716B1
Authority
KR
South Korea
Prior art keywords
lysine
strain
teta
gene
seq
Prior art date
Application number
KR1020120066007A
Other languages
Korean (ko)
Other versions
KR20130142635A (en
Inventor
정규열
장성호
양진아
서상우
Original Assignee
포항공과대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 포항공과대학교 산학협력단 filed Critical 포항공과대학교 산학협력단
Priority to KR1020120066007A priority Critical patent/KR101411716B1/en
Publication of KR20130142635A publication Critical patent/KR20130142635A/en
Application granted granted Critical
Publication of KR101411716B1 publication Critical patent/KR101411716B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/08Lysine; Diaminopimelic acid; Threonine; Valine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 리보스위치를 이용한 라이신 고생산균 스크리닝 방법에 관한 것으로서, 보다 구체적으로 라이신 리보스위치(riboswitch) 및 TetA 유전자를 포함하는 라이신 고생산 균주 스크리닝용 벡터 및 이를 이용한 스크리닝 방법 등에 관한 것이다. 본 발명의 리보스위치 및 이를 이용하여 라이신(Lysine) 고생산균을 스크리닝하는 방법은 라이신을 고농도로 생산하는 균주를 비교적 빠르고 쉽게 선별할 수 있으며, 이를 이용하여 미생물을 이용한 트립토판 생산의 가격경쟁력을 높일 수 있다.More particularly, the present invention relates to a lysine riboswitch and a vector for screening a lysine-producing strain containing the TetA gene, a screening method using the riboswitch, and the like. The riboswitch of the present invention and the method of screening the lysine supernatant using the riboswitch of the present invention can sort the strain producing lysine at a high concentration relatively quickly and easily and thereby increase the price competitiveness of the tryptophan production using the microorganism have.

Description

리보스위치를 이용한 라이신 고생산균 스크리닝 방법{Method for Screening Microorganism with High Lysine Productivity Using Riboswitch}[0001] The present invention relates to a method for screening microorganisms with high lysine productivity using riboswitches,

본 발명은 리보스위치를 이용한 라이신 고생산균 스크리닝 방법에 관한 것으로서, 보다 구체적으로 라이신 리보스위치(riboswitch) 및 TetA 유전자를 포함하는 라이신 고생산 균주 스크리닝용 벡터 및 이를 이용한 스크리닝 방법 등에 관한 것이다.More particularly, the present invention relates to a lysine riboswitch and a vector for screening a lysine-producing strain containing the TetA gene, a screening method using the riboswitch, and the like.

미생물을 이용한 대사산물을 생산하는 방법의 가격경쟁력을 높이기 위해 지속적으로 균주 개발이 이루어지고 있다. 전통적이면서 효과적인, 균주 개발을 위한 조합적 접근법은 생산 균주를 기반으로 균주 라이브러리를 생성한 후 라이브러리 안의 개선된 균주를 스크리닝하는 단계로 이루어져 있다. 그 예로 1960년대 추출법에서 미생물을 이용한 발효법으로 생산방법이 전환된 MSG(monosodium glutamate)생산균주의 개발 사례를 들 수 있다.In order to increase the price competitiveness of the method for producing metabolites using microorganisms, the strain has been continuously developed. Traditional and effective approaches to the development of strains consist of a step of generating a strain library based on the production strain and then screening the improved strains in the library. One example is the development of a monosodium glutamate (MSG) producing strain that has been converted to a fermentation process using microorganisms in the 1960s extraction method.

균주 라이브러리를 생성하기 위하여 예전에는 UV 조사, NTG(nitrosoguanidine)와 같은 화학적 돌연변이원을 첨가하는 화학적 변이법 등이 사용되었다. 분자생물학적 도구와 생화학적 지식이 축적된 현대에 들어서는 PCR(polymerase chain reaction) 기반으로 유전자에 돌연변이를 유발시키거나 프로토플라스트 퓨전(protoplast fusion)을 통한 게놈 셔플링(genome shuffling), 트랜스포손(transposon)을 이용한 임의 삽입(random insertion) 등의 다양한 균주 라이브러리 생성법이 제시되었다. 균주 라이브러리의 크기가 커질수록 그 중에 목적 대사산물 고생산균이 포함되었을 가능성이 높아지므로, 상기된 라이브러리 제조방법을 다중으로 사용함으로써 균주 라이브러리를 생성할 수 있다.Previously, chemical mutagenesis, such as UV irradiation and addition of chemical mutagens such as NTG (nitrosoguanidine), was used to generate a library of strains. In the modern age of accumulation of molecular biology tools and biochemical knowledge, genome shuffling through genetic shuffling through protoplast fusion, transposon mutagenesis based on polymerase chain reaction (PCR) ), And random insertion using a variety of strains. As the size of the strain library becomes larger, the possibility that a target metabolite hyperpolarizing organism is contained therein becomes higher. Therefore, a strain library can be produced by using the aforementioned library preparation method in multiple ways.

균주의 목적 대사산물 생산성을 파악하기 위해서 다양한 분석법이 쓰이고 있다. 액체/기체 크로마토그래피(LC/GC)는 개별 균주를 배양한 후 배양액과 균주 내의 대사산물 농도를 분석하는 방법이다. 이 방법은 대부분의 대사산물을 검출할 수 있고 표준검정곡선을 얻을 수 있다면 정량적 분석이 가능하다. 하지만 한 번에 한 종의 변이 균주에 대해서만 측정할 수 있기 때문에 처리량(throughput)이 낮아서 일정 크기 이상의 균주 라이브러리를 분석하기에는 비효율적이다.Purpose of the strain Various assays are used to determine the metabolite productivity. Liquid / gas chromatography (LC / GC) is a method of culturing individual strains and then analyzing the culture medium and the metabolite concentration in the strain. This method is capable of detecting most metabolites and quantitative analysis if a standard calibration curve can be obtained. However, throughput is low because it can be measured only for one mutation strain at a time, which is inefficient for analyzing a library of strains larger than a certain size.

멀티웰플레이트(multiwell plates)를 사용한 대사산물 분석 방법은 변이 균주를 구분된 칸(well)에 투입한 뒤 소량 시료의 발색, 흡광도 또는 형광도 등의 변화를 측정하여 시료 안의 대사산물의 농도 변화를 분석하는 방법이다. 소량의 시료를 사용하고, 멀티플레이트를 사용하기 때문에 비교적 다수의 변이 균주들을 동시에 분석할 수 있다. 그러나 상기된 제조방법에 의해 만들어진 크기가 큰 균주 라이브러리를 분석하기에는 처리능이 낮다. 또한, 대사산물을 기질로 한 발색 반응이 가능하거나, 흡광도 또는 형광도의 변화를 측정할 수 있는 대사산물에 대해서만 적용 가능하기 때문에 활용범위가 좁다.Metabolite analysis using multiwell plates is performed by introducing the mutant strains into wells and measuring changes in color, absorbance, and fluorescence of a small sample to determine the concentration of metabolites in the sample It is a method of analysis. Since a small amount of sample is used and a multi-plate is used, a relatively large number of mutation strains can be simultaneously analyzed. However, the ability to analyze large-scale strain libraries made by the above described methods of production is poor. In addition, the application range is narrow because it can be applied only to a metabolite capable of performing a color reaction with a metabolite as a substrate or measuring a change in absorbance or fluorescence.

유전적 바이오센서를 활용하여 생산 균주를 스크리닝하는 방법은 합성된 목적 대사산물의 농도를 즉각적으로 검출할 수 있는 신호로 전환시켜서 검출한다. 목적 대사산물에 특이적인 바이오센서를 개발하여 적용한다면 적합한 검출기를 활용함으로써 시각적으로 검출할 수 없는 목적 대사산물의 농도변화를 관찰할 수 있다.A method for screening production strains using a genetic biosensor is performed by converting the concentration of the synthesized target metabolite into an immediately detectable signal. If a specific biosensor is developed and applied to a target metabolite, a suitable detector can be used to observe the concentration change of the target metabolite which can not be visually detected.

FACS(fluorescence activated cell sorting) 기법은 변이 균주를 검출기로 흘려보내면서 개별 균주에서 방출되는 형광을 검출한다. 대량의 세포들을 동시에 흘려보내며 매우 빠르게 형광검출을 할 수 있기 때문에, 처리능이 109 이상에 달한다. 목적 대사물질이 형광을 내는 경우, 큰 라이브러리를 비교적 빠르고 쉽게 분석할 수 있기 때문에 고생산균을 효율적으로 스크리닝 할 수 있다. 그러나 형광을 나타내는 대사산물에 대해서만 적용할 수 있다는 한계점이 있다.The fluorescence activated cell sorting (FACS) technique detects the fluorescence emitted from an individual strain while passing the mutant strain to the detector. The ability to process large volumes of cells at the same time and detect fluorescence very quickly yields a throughput of more than 10 9 . When a target metabolite fluoresces, it is possible to analyze a large library relatively quickly and easily, thereby efficiently screening the host bacteria. However, there is a limitation in that it can be applied only to metabolites that exhibit fluorescence.

마지막으로 선별(selection) 방법을 사용할 수 있다. 이 방법은 균주 라이브러리에서 목적 대사산물을 고농도로 생산해내는 균주만 살아남도록 만드는 기술이다. 이 방법은 처리량이 매우 높아서 큰 균주 라이브러리로부터 고생산 균주만을 효과적으로 골라낼 수 있다. 그러나 목적 대사산물의 농도가 균주의 성장 혹은 생존에 관여하는 경우에만 이 기술을 적용할 수 있다.Finally, a selection method can be used. This is a technique that allows only strains that produce high concentrations of the desired metabolite in the library of strains to survive. This method is very high throughput and can effectively isolate high yield strains from large strain libraries. However, this technique can only be applied if the concentration of the target metabolite is involved in the growth or survival of the strain.

한편, 리보스위치(riboswitch)는 세포 내에서 특정 대사산물의 농도를 감지하여 하류에 위치한 유전자의 발현량을 조절하는 생체 센서로서, 기질 특이성과 기질 친화도가 매우 높다. 또한, SELEX(Systematic Evolution of Ligand by Exponential Enrichment) 기술을 이용하여 특정 대사산물에 결합하는 압타머(aptamer)를 생성하고, 이를 기반으로 리보스위치를 만드는 기술들이 개발되어 있다. 따라서 우리가 스크리닝 하고자 하는 대사산물만을 특이적이고 민감하게 인지하여 하류에 위치한 유전자의 발현량을 조절하는 리보스위치를 개발할 수 있다.On the other hand, riboswitches are biosensor sensors that detect the concentration of a specific metabolite in a cell and regulate the expression level of a downstream gene. The riboswitch has a very high substrate specificity and substrate affinity. Techniques have also been developed to generate an aptamer that binds to a specific metabolite using SELEX (Systematic Evolution of Ligand by Exponential Enrichment) technology, and to make a rib switch based on the generated aptamer. Therefore, we can develop riboswitches that regulate the expression level of downstream genes by recognizing only specific metabolites that we want to screen.

이렇게 개발한 리보스위치의 하류에 선택 표지 유전자를 삽입하게 되면, 목적 대사산물의 농도에 따라 선택표지 유전자의 발현을 조절하는 RNA device를 얻을 수 있다. 다양한 방법을 이용하여 생성한 균주 라이브러리에 RNA device를 도입하면 각 균주 내부의 목적 대사산물의 농도에 따라서 선택표지 유전자의 발현량이 달라진다. 이때, 인공선택회로로 형질전환된 균주 후보군을 RNA device의 선택표지 유전자에 대응하는 적합한 선택압에 노출시킬 경우, 목적 대사산물을 고농도로 생산하는 균주만 살아남게 될 것이다.When the selectable marker gene is inserted downstream of the thus-developed riboswitch, an RNA device capable of regulating the expression of the selectable marker gene can be obtained according to the concentration of the target metabolite. When the RNA device is introduced into the strain library generated by various methods, the expression level of the selectable marker gene varies depending on the concentration of the target metabolite in each strain. At this time, when the candidate strain transformed with the artificial selection circuit is exposed to a suitable selection pressure corresponding to the selectable marker gene of the RNA device, only the strain producing the desired metabolite at high concentration will survive.

본 발명은 상기와 같은 종래 기술의 문제점을 해결하기 위하여 다양한 목적 대사산물에 대해 적용할 수 있고, 높은 처리량을 가지는 스크리닝 기술을 개발하고자 한다. 이를 위하여 본 발명은 라이신(Lysine) 고생산균 스크리닝을 위한 리보스위치를 제공하고자 한다. 본 발명은 또한, 상기 리보스위치를 이용하여 라이신(Lysine) 고생산균을 효과적으로 스크리닝하는 방법을 제공하는 것을 목적으로 한다.In order to solve the problems of the prior art as described above, the present invention aims to develop a screening technique which can be applied to various target metabolites and has a high throughput. To this end, the present invention provides a riboswitch for screening of a lysine-producing strain. It is another object of the present invention to provide a method for effectively screening for a lysine-producing strain using the riboswitch.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

본 발명은 라이신 리보스위치(riboswitch) 및 TetA 유전자를 포함하는 라이신 고생산 균주 스크리닝용 벡터를 제공한다.The present invention provides a lysine high production strain screening vector comprising a lysine riboswitch and a TetA gene.

본 발명에 있어서, 상기 라이신 리보스위치(riboswitch)는 서열번호 1로 기재되는 것이 바람직하나, 이에 한정되지 않는다.In the present invention, the lysine riboswitch is preferably represented by SEQ ID NO: 1, but is not limited thereto.

본 발명에 있어서, 상기 TetA 유전자는 서열번호 31로 기재되는 것이 바람직하나, 이에 한정되지 않는다.In the present invention, the TetA gene is preferably represented by SEQ ID NO: 31, but is not limited thereto.

본 발명에 있어서, 상기 라이신 고생산 균주 스크리닝용 벡터는 서열번호 11로 기재되는 것이 바람직하나, 이에 한정되지 않는다.In the present invention, the lysine-producing strain screening vector is preferably represented by SEQ ID NO: 11, but is not limited thereto.

본 발명은 라이신 리보스위치(riboswitch) 및 TetA 유전자를 포함하는 라이신 고생산 균주 스크리닝용 벡터로 형질전환된 균주를 제공한다. 상기 형질전환 균주는 기탁번호 KCTC 12184BP인 것을 특징으로 한다. 상기 균주의 종류에는 제한이 없다. 바람직하게는 대장균(Escherichia coli)이다.The present invention provides a strain transformed with a lysine high production strain screening vector comprising a lysine riboswitch and a TetA gene. The transformant strain is characterized by being the accession number KCTC 12184BP. There is no limitation on the kind of the strain. It is preferably Escherichia coli.

또한, 본 발명은 균주 라이브러리에 라이신 리보스위치(riboswitch) 및 TetA 유전자를 포함하는 벡터를 형질전환 하는 단계 및 상기 형질전환된 균주를 테트라마이신이 포함된 배지에서 배양하는 단계를 포함하는 라이신 고생산 균주를 스크리닝하는 방법을 제공한다.The present invention also provides a method for producing a lysine-producing strain, which comprises the steps of: transforming a strain library with a vector containing a lysine riboswitch and a TetA gene; and culturing the transformed strain in a medium containing tetramycin A screening method is provided.

본 발명은 균주 라이브러리에 라이신 리보스위치(riboswitch) 및 TetA 유전자를 포함하는 벡터를 형질전환 하는 단계 및 상기 형질전환된 균주를 니켈이 포함된 배지에서 배양하는 단계를 포함하는 라이신 저생산 균주를 스크리닝하는 방법을 제공한다.The present invention relates to a method for screening a lysine producing strain comprising a step of transforming a strain library into a vector containing a lysine riboswitch and a TetA gene and culturing the transformed strain in a medium containing nickel ≪ / RTI >

또한, 본 발명은 서열번호 30의 염기서열로 구성되는 프로모터 및 ppc 유전자를 포함하는 라이신 고생산용 벡터를 제공한다.In addition, the present invention provides a vector for lysine alpaca production comprising a promoter consisting of the nucleotide sequence of SEQ ID NO: 30 and a ppc gene.

본 발명의 일 구현예로, 상기 ppc 유전자는 서열번호 33의 염기서열로 구성되는 것을 특징으로 한다.In one embodiment of the present invention, the ppc gene is characterized in that it is composed of the nucleotide sequence of SEQ ID NO: 33.

본 발명의 리보스위치 및 이를 이용하여 라이신(Lycine) 고생산균을 스크리닝하는 방법은 라이신을 고농도로 생산하는 균주를 비교적 빠르고 쉽게 선별할 수 있으며, 이를 이용하여 미생물을 이용한 라이신 생산의 가격경쟁력을 높일 수 있다.The riboswitch of the present invention and the method of screening the lysine-producing strain of the present invention can select the strains producing the lysine at a high concentration relatively quickly and easily, and can increase the price competitiveness of the lysine production using the microorganism have.

도 1은 본 발명의 일실시예에 따른 리포터 시스템의 제조방법을 나타낸 개략적인 모식도이다.
도 2는 본 발명의 일실시예에 따른 상대적 라이신 저생산 균주 제작을 위한 유전자 재조합 방법을 나타낸 개략적인 모식도이다.
도 3은 라이신 생산성에 따른 균주의 비형광값의 변화를 분석한 결과이다.
도 4는 본 발명의 일실시예에 따른 인공선택 회로가 삽입된 라이신 생산성이 상이한 균주의 니켈과 테트라사이클린 선택압에 따른 성장 속도를 측정한 결과이다.
도 5는 본 발명의 일실시예에 따른 고수율 생산균주를 제작하기 위하여 합성경로 상의 유전자들의 프로모터를 교체하는 방법을 나타낸 모식도이다.
도 6은 본 발명의 일실시예에 따른 고수율 생산균주를 제작하기 위하여 코리네박테리움 글루타미컴(Corynebacterium glutamicum)의 ddh 유전자를 도입하는 방법을 개략적으로 나타낸 모식도이다.
도 7은 본 발명의 일실시예에 따른 고수율 생산균주를 제작하기 위하여 경쟁대사를 제고하는 방법을 개략적으로 나타낸 모식도이다.
도 8은 강화된 M9 배지에서 0.8 mM 니켈을 첨가하였을 때 인공선택회로 플라스미드(pACYC_ribo_TetA)를 가진 W3110, W3110_ME의 비성장속도를 측정한 결과이다.
도 9는 본 발명의 일실시예에 따른 W3110/pACYC_ribo_TetA와 W3110_ME/pACYC_ribo_TetA에 테트라사이클린을 선택압으로 주었을 때의 비성장속도를 관찰한 결과이다.
도 10은 균주 혼합 시 본 발명의 선택회로의 작동 여부를 확인한 PCR 결과이다.
도 11은 ppc 발현량이 다른 라이브러리 생성 과정을 나타낸 모식도이다.
도 12는 본 발명의 일실시예에 따른 인리치먼트된 변이주인 W3110_MEΔppc/pCDF_F0.3ppc의 라이신 축적량이 라이브러리화 되기 전의 균주인 W3110_ME/pCDF_Duet보다 더 높은 라이신 축적량을 분석한 결과이다.
도 13은 ribo_sGFP 유전자 서열을 나타낸 그림으로서, 빨간색은 제한효소사이트를, 파란색은 프로모터 서열을, 초록색은 lysC 5'UTR을, 나머지 부분은 sgfp 유전자와 터미네이터(terminator)를 나타낸다.
도 14는 ribo_TetA 유전자 서열을 나타낸 그림으로서, 빨간색은 제한효소사이트를, 파란색은 프로모터 서열을, 초록색은 lysC 5'UTR을, 나머지 부분은 TetA 유전자와 터미네이터(terminator)를 나타낸다.
1 is a schematic diagram illustrating a method of manufacturing a reporter system according to an embodiment of the present invention.
FIG. 2 is a schematic diagram showing a gene recombination method for producing a relatively lysine-producing strain according to an embodiment of the present invention.
FIG. 3 shows the result of analyzing the change of the non-fluorescence value of the strain according to lysine productivity.
FIG. 4 is a graph illustrating the results of measurement of growth rates of nickel and tetracycline selection pressures of strains with different lysine productivity inserted into an artificial selection circuit according to an embodiment of the present invention.
FIG. 5 is a schematic diagram showing a method of replacing a promoter of genes on a synthetic pathway to produce a high-yield producing strain according to an embodiment of the present invention.
FIG. 6 is a schematic diagram illustrating a method of introducing a ddh gene of Corynebacterium glutamicum to produce a high-yield producing strain according to an embodiment of the present invention.
FIG. 7 is a schematic diagram showing a method for enhancing competitive metabolism in order to produce a high-yield producing strain according to an embodiment of the present invention.
FIG. 8 shows the results of measurement of the growth rate of W3110 and W3110_ME with artificial selection circuit plasmid (pACYC_ribo_TetA) when 0.8 mM nickel was added in the enhanced M9 medium.
FIG. 9 shows the results of observing the growth rate of W3110 / pACYC_ribo_TetA and W3110_ME / pACYC_ribo_TetA according to an embodiment of the present invention when tetracycline is selected as a selective pressure.
FIG. 10 shows the result of PCR confirming whether the selection circuit of the present invention was operated when the strain was mixed.
11 is a schematic diagram showing a process of generating a library in which the amount of ppc expression is different.
FIG. 12 is a result of analyzing lysine accumulation amount higher than W3110_ME / pCDF_Duet, which is a strain before the lysine accumulation amount of W3110_MEΔppc / pCDF_F0.3ppc, which is a mutagens mutant according to an embodiment of the present invention, is libraryed.
FIG. 13 shows the ribo_sGFP gene sequence. In FIG. 13, red indicates a restriction site, blue indicates a promoter sequence, green indicates lysC 5'UTR, and the other indicates a sgfp gene and a terminator.
Fig. 14 shows the ribo_TetA gene sequence. In the figure, red indicates a restriction enzyme site, blue indicates a promoter sequence, green indicates lysC 5'UTR, and the other part indicates a TetA gene and a terminator.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

본 발명에 사용된 LA-Taq 폴리머라제(LA-Taq polymerase), Phusion 폴리머라제(Phusion polymerase) 및 제한효소들은 각각 TaKaRa, New England Biolabs에서 구매하였다. pACYC_ribo_TetA, pACYC_ribo_sgf와 프로모터 라이브러리를 만드는데 사용한 pACYC_Duet, pCDF_Duet 벡터는 Novagen에서 구입하였고, 올리고뉴클레오티드(oligonucleotide)들은 Genotech에서 합성하였다. 그 밖에 배양액 제조를 위한 재료들은 모두 Sigma에서 구매하였다.
The LA-Taq polymerase, Phusion polymerase and restriction enzymes used in the present invention were purchased from TaKaRa and New England Biolabs, respectively. pACYC_ribo_TetA, pACYC_ribo_sgf and the pACYC_Duet and pCDF_Duet vectors used to construct the promoter library were purchased from Novagen, and oligonucleotides were synthesized in Genotech. In addition, all the materials for culturing were purchased from Sigma.

실시예Example 1. 리포터 시스템의 제작 1. Production of reporter system

먼저, E. coli 염색체를 주형으로 하여 서열번호 1의 라이신 리보스위치를 증폭하였고 이를 sGFP 유전자와 오버랩 PCR을 하여 ribo_sGFP를 제작하였다. 이 때 리보스위치 증폭에 사용된 프라이머는 서열번호 2(P_ribo-F) 및 서열번호 3(ribo-B)에 나타내었으며, sGFP 증폭에 사용된 프라이머는 서열번호 4(ribo-sgfp-F) 및 서열번호 5(sgfp-R)에 나타내었다. 리보스위치와 sGFP 증폭 PCR 조건은 98℃에서 30 초, (98℃에서 10초, 60℃에서 30초, 72℃에서 1분/kb)×30 cycle, 72℃에서 5분 수행하였고, Phusion polymerase를 사용하였다.First, the lysine riboswitch of SEQ ID NO: 1 was amplified using the E. coli chromosome as a template, and ribo_sGFP was constructed by overlap PCR with the sGFP gene. The primers used for the amplification of the riboswitches are shown in SEQ ID NO: 2 (P_ribo-F) and SEQ ID NO: 3 (ribo-B), the primers used for sGFP amplification are SEQ ID NO: 4 (ribo-sgfp-F) No. 5 (sgfp-R). Riboswitch and sGFP amplification PCR conditions were performed for 30 min at 98 ° C, 30 sec at 90 ° C for 10 sec, 30 sec at 60 ° C, 1 min / kb at 72 ° C, and 5 min at 72 ° C. Phusion polymerase Respectively.

이후 ribo_sGFP를 지속적으로 발현시키는 프로모터(J23100)를 오버행으로 하는 프라이머(서열번호 6: KpnI-P-F, 서열번호 7: SacI-vec-R)를 이용하여 증폭한 후, PCR을 통해서 증폭된 sGFP유전자를 KpnI과 SacI 사이트를 이용하여 pACYC_Duet 벡터에 클로닝 하였다. 구체적으로 오버랩 PCR은 프라이머 없이 lysC 5'UTR과 gfp 증폭산물을 섞은 후 95℃에서 1분, (95℃에서 30초, 64℃에서 30초, 72℃에서 1분/kb)× 5 cycle 후, 프라이머 추가하여 (95℃에서 30초, 64℃에서 30초, 72℃에서 1분/kb)× 25 cycle, 72℃에서 5분 수행하였다. 상기 실험에 대한 개략적인 모식도는 도 1에 간략히 나타내었다.
(SEQ ID NO: 6: KpnI-PF, SEQ ID NO: 7: SacI-vec-R), which promotes the expression of ribo_sGFP continuously, and then amplified the sGFP gene by PCR And cloned into the pACYC_Duet vector using KpnI and SacI sites. Specifically, the overlap PCR was performed by mixing the lysC 5'UTR and the gfp amplification product without the primer, followed by 1 minute at 95 ° C (30 seconds at 95 ° C, 30 seconds at 64 ° C, 1 minute / kb at 72 ° C) Primer (95 ° C for 30 seconds, 64 ° C for 30 seconds, 72 ° C for 1 minute / kb) × 25 cycles, and 72 ° C for 5 minutes. A schematic diagram of the above experiment is shown briefly in FIG.

실시예Example 2. 상대적 라이신 저생산 균주 제작을 위한 유전자 재조합 2. Genetic recombination for production of relative lysine-producing strains

상대적 라이신 저생산 균주를 만들기 위해 라이신 합성경로 상의 효소들 중 3개의 아이소자임(thrA , metL , lysC)이 관여하는 스텝에서 lysC를 제거함으로써 라이신 합성 경로로의 흐름을 저해된 라이신 저생산 균주를 제조하기 위하여, Red/ET 유전자 재조합 시스템을 이용하였다. Escherichia coli K12 W3110을 pKD46으로 형질전환시킨 후, Red recombinase가 발현된 컴피턴트 셀(competent cell)을 준비하였다. lysC 유전자의 인접서열과의 상등서열을 오버행으로 하는 유전자 제거용 PCR 산물(FRT_neo_FRT)을 제조하기 위하여, pKD4 variant의 FRT_neo_FRT 영역을 주형으로 하여, LA-Taq 폴리머라제를 이용하여 서열번호 8(D-lysC-F) 및 서열번호 9(D-lysC-R)의 프라이머로 증폭하였다. PCR 조건은 상기 실시예 1의 리보스위치 증폭 조건과 같다. 이 PCR 증폭산물은 Red-recombination 기작에 의해 lysC 영역을 대체한다. 증폭된 FRT_neo_FRT은 아가로스 겔(argarose gel) 상에서 정제하고, 에탄올에서 침전 농축시켜서 준비하였다. 상기 PCR 산물을 전기천공(electroporation) 시킨 후 카나마이신(kanamycin)을 함유한 LB 플레이트(Luria-Bertani plate)에서 선별(selection) 하였다. 얻어진 콜로니들은 pCP20 플라스미드의 FLP(DNA flipase)를 발현시켜 선택표지인 카나마이신(kanamycin) 저항성 유전자를 제거한 후 재조합된 영역을 시퀀싱하여 최종적으로 lysC 유전자의 제거를 확인하였다. 상기 실험에 대한 개략적인 모식도는 도 2에 간략히 나타내었다.
In order to produce a relatively lysine-producing strain, lysC is removed in a step involving three isozymes ( thrA , metL , lysC ) among the enzymes in the lysine synthesis pathway to produce a lysine-producing strain inhibited flow to the lysine synthesis pathway , The Red / ET gene recombination system was used. Escherichia After coli K12 W3110 was transformed with pKD46, a competent cell expressing Red recombinase was prepared. In order to prepare a gene-removing PCR product (FRT_neo_FRT) having an overhang of the contiguous sequence with the adjacent sequence of the lysC gene, the FRT_neo_FRT region of the pKD4 variant was used as a template and the sequence of SEQ ID NO: 8 (D- lysC-F) and SEQ ID NO: 9 (D-lysC-R). The PCR conditions were the same as those for the riboswitch amplification of Example 1 above. This PCR amplification product replaces the lysC region by a red-recombination mechanism. The amplified FRT_neo_FRT was purified on an agarose gel and precipitated and concentrated in ethanol. The PCR product was electroporated and then selected on LB plate containing kanamycin (Luria-Bertani plate). The resulting colonies express the FLP (DNA flipase) of the pCP20 plasmid to remove the kanamycin resistance gene and sequenced the selected recombinant region. Finally, the removal of the lysC gene was confirmed. A schematic schematic diagram of the experiment is shown briefly in FIG.

실시예Example 3. 라이신 생산성이 다른 균주에 의해 달라지는 형광과 성장속도 측정 3. Measurement of fluorescence and growth rate by different strains of lysine productivity

W3110과 상기 실시예 2에서 제조한 W3110ΔlysC에 각각 상기 실시예 1에서 제조된 pACYC_ribo_sGFP를 형질전환 시켰으며, pACYC_Duet을 가지고 있을 때를 대조군으로 하여 라이신 생산성이 다른 균주에 의해 달라지는 형광과 성장속도를 측정하였다. 먼저, 벡터 유지를 위한 34 μg/ml 클로람페니콜(chloramphenicol)이 함유된 강화된 M9 배지(라이신을 제외한 아미노산을 첨가한 배지)에서 12시간 이상 배양하여 시드를 준비하였다. 세포를 수확한 후 세척하여 새로운 배지에 OD600이 0.05가 되도록 희석한 후 OD600이 약 0.8이 될 때까지 5시간 동안 배양하였다. 준비된 시드를 상기 배지 4 ㎖에 OD600이 0.05가 되도록 접종한 후 2시간 간격으로 비형광값을 측정하였다. 형광은 배양체를 96-well 형광측정 플레이트에 옮긴 후 VICTOR3TM 1420 multilabel counter (PerkinElmer)를 사용하여 측정하였다. The pACYC_ribo_sGFP prepared in Example 1 was transformed into W3110 and W3110? LysC prepared in Example 2, and the fluorescence and the growth rate of pACYC_Duet having different lysine productivity were measured by using pACYC_Duet as a control group . First, a seed was prepared by culturing for 12 hours or longer in an enhanced M9 medium (amino acid supplemented with an amino acid other than lysine) containing 34 μg / ml chloramphenicol for vector maintenance. The cells were harvested, washed, diluted to a new medium with an OD600 of 0.05, and then cultured for 5 hours until OD600 reached about 0.8. The prepared seeds were inoculated in 4 ml of the medium to an OD600 of 0.05, and non-fluorescence values were measured at intervals of 2 hours. Fluorescence was measured using a VICTOR3TM 1420 multilabel counter (PerkinElmer) after transferring the cultures to a 96-well fluorescent assay plate.

구체적으로, 라이신 생산량의 차이에 의한 비형광값의 변화는 선정된 J23100 프로모터 하에서 pACYC_Duet 벡터 상에 존재할 때, lysC 5’ UTR이 세포 내의 라이신 농도를 감지하여 sGFP의 발현량을 조절함으로써 형광값이 달라짐을 이용하여 확인하였다. W3110 과 W3110ΔlysC에서 pACYC_ribo_sGFP에 의해 나타나는 비형광값의 변화를 분석한 결과를 도 3에 나타내었다. Specifically, when the change in the non-fluorescence value due to the difference in lysine production amount is present on the pACYC_Duet vector under the selected J23100 promoter, the lysC 5 'UTR senses the lysine concentration in the cell and controls the expression amount of sGFP, Respectively. The results of analyzing the change of the non-fluorescence value indicated by pACYC_ribo_sGFP in W3110 and W3110? LysC are shown in Fig.

도 3의 실험 결과는 벡터 유지를 위해 클로람페니콜(chloramphenicol)이 함유된 강화된 M9 배지에서 W3110/pACYC_ribo_sGFP(검정색 원: 라이신 고생산 균주)와 W3110ΔlysC/pACYC_ribo_sGFP(흰색 원: 라이신 저생산 균주)를 배양한 후, 2시간 간격으로 비형광값을 나타낸 것이다. X 축은 배양시간을, Y 축은 비형광값의 비율변화를 나타낸다. 비형광값이란 측정된 형광값을 OD600 값으로 나눈 것이며, 비형광값의 비율 변화는 각 시간에 나타나는 비형광값을 2시간째의 비형광값으로 나눈 값이다. 오차값은 SD값으로 표현하였다. 도 3에 나타난 바와 같이, 라이신 생성량이 상대적으로 적은 W3110ΔlysC에서 sGFP의 발현량이 더 높기 때문에, 형광값이 크게 증가하는 것을 확인할 수 있었다.
The experimental results in Fig. 3 show that W3110 / pACYC_ribo_sGFP (black lane: lysine high producing strain) and W3110? LysC / pACYC_ribo_sGFP (white source: lysine low producing strain) were cultured in the enhanced M9 medium containing chloramphenicol The non-fluorescence values are shown at intervals of 2 hours. The X axis represents the incubation time and the Y axis represents the change in the ratio of the non-fluorescent value. The non-fluorescence value is a value obtained by dividing the measured fluorescence value by the OD600 value, and the ratio change of the non-fluorescence value is a value obtained by dividing the non-fluorescence value appearing at each time by the non-fluorescence value at the second time. The error values are expressed as SD values. As shown in FIG. 3, since the expression level of sGFP was higher in W3110? LysC with a relatively low lysine production amount, it was confirmed that the fluorescence value was greatly increased.

실시예Example 4. 인공선택 회로의 구축 및 라이신 생산량의 차이에 의한  4. Due to the construction of the artificial selection circuit and the difference in lysine production TetATetA 의 발현 조절Modulation of

pBR322유래의 TetA로 pACYC_ribo_sGFP의 리포터 유전자인 sGFP를 교체하여 인공선택회로 플라스미드(pACYC_ribo_TetA)를 제작함으로써, 라이신 농도에 의한 비성장 속도의 변화를 유도하였다. J23100-ribo-TetA는 PCR을 통해 증폭되어 pACYC_ribo_sGFP의 J23100-ribo-sGFP위치에 클로닝 되었다.The artificial selection circuit plasmid (pACYC_ribo_TetA) was produced by replacing the reporter gene of pACYC_ribo_sGFP, sGFP, with pTB322-derived TetA, to induce a change in non-growth rate by lysine concentration. J23100-ribo-TetA was amplified by PCR and cloned into the J23100-ribo-sGFP site of pACYC_ribo_sGFP.

구체적으로, tetA 유전자는 pBR322 플라스미드(plasmid)를 주형으로 서열번호 12(ribo-tetA-F) 및 서열번호 13(tetA-R)의 프라이머를 사용하여 증폭하였고, tetA 증폭산물과 lysC 5'UTR을 서열번호 6(KpnI-P-F) 및 서열번호 13(tetA-R)의 프라이머를 사용하여 오버랩 PCR 하여 ribo-tetA(서열번호 11)를 구축하였다. PCR 조건은 상기 실시예 1의 ribo-sgfp 구축조건과 같다. 증폭산물은 KpnI과 SacI 제한효소 자리를 이용하여 pACYCDuet vector에 삽입하였다.Specifically, the tetA gene was amplified using primers of SEQ ID NO: 12 (ribo-tetA-F) and SEQ ID NO: 13 (tetA-R) as a template, and the tetA amplification product and lysC 5'UTR were amplified using the pBR322 plasmid as a template Ribo-tetA (SEQ ID NO: 11) was constructed by overlap PCR using primers of SEQ ID NO: 6 (KpnI-PF) and SEQ ID NO: 13 (tetA-R). The PCR conditions were the same as the ribo-sgfp construction conditions of Example 1 above. The amplified product was inserted into pACYCDuet vector using KpnI and SacI restriction enzyme sites.

TetA 단백질이 테트라사이클린(tetracycline)에 대한 저항성과 니켈에 대한 민감도 증가에 동시에 관여하므로, 라이신 농도에 따라 달라지는 TetA의 발현량을 이용하여 목적에 맞는 선택압을 사용하여 원하는 균주를 선택적으로 분리할 수 있다. 구체적으로, tetA 유전자가 발현되면 tetA 단백질이 세포막으로 이동하여 세포 내부의 테트라사이클린(tetracycline)을 외부로 배출하게 되며, 이로 인해 세포는 테트라사이클린에 내성을 가지게 된다. 그러나 tetA 유전자가 과발현되면, 세포가 니켈 이온(nickel ion)에 의해 사멸하게 되는 효과가 있다. 상기와 같은 tetA 유전자의 성질을 이용하면, 세포 내 라이신 농도가 높을 때 tetA가 많이 발현되고, 라이신 농도가 낮을 때 tetA를 발현하지 않는 플라스미드를 가지는 세포를 골라낼 수 있다. Since the TetA protein is involved in both resistance to tetracycline and sensitivity to nickel, it is possible to selectively isolate a desired strain by using the expression pressure of TetA depending on the concentration of lysine have. Specifically, when the tetA gene is expressed, the tetA protein migrates to the cell membrane to release the tetracycline inside the cell to the outside, which causes the cell to become resistant to tetracycline. However, when the tetA gene is overexpressed, the cells are killed by nickel ions. Using the properties of the tetA gene as described above, it is possible to select a cell having a plasmid in which tetA is highly expressed when the concentration of lysine in the cell is high and is not expressed when the concentration of lysine is low.

라이신 생성량이 다른 두 균주, W3110과 W3110ΔlysC에 인공선택회로 플라스미드(pACYC_ribo_TetA)를 형질전환 시켰고, 테트라사이클린을 선택압으로 하는 배지와 니켈을 선택압으로 하는 배지 각각에서 비성장속도를 관찰한 결과 라이신 생성량의 차이에 의해 TetA의 발현량이 조절되는 것을 확인 할 수 있었다. 벡터 유지를 위해 클로람페니콜(chloramphenicol)이 함유된 M9 배지에서 배양하였으며, 선택압으로 사용된 니켈의 농도는 0.1 mM, 테트라사이클린의 농도는 60 μg/ml이다. 12시간 동안의 OD600값으로 비성장속도를 계산하였으며, 이를 도 4에 나타내었다. 도 4에서 Y 축은 비성장 속도[h-1]를 나타낸다.The artificial selection circuit plasmid (pACYC_ribo_TetA) was transformed into W3110 and W3110? LysC of two strains with different lysine production amounts, and the growth rate was observed in each of the culture medium with tetracycline as the selective pressure and the culture medium with the nickel as the selective pressure. The amount of TetA expression was regulated by the difference in the expression level of TetA. For vector maintenance, the cells were cultured in M9 medium containing chloramphenicol. The concentration of nickel used was 0.1 mM and the concentration of tetracycline was 60 μg / ml. The non-growth rate was calculated by the OD600 value for 12 hours, which is shown in FIG. In Fig. 4, the Y axis represents the non-growth rate [h-1].

도 4에 나타난 바와 같이, 라이신에 의해 발현을 저해시키는 lysC 5’UTR 라이신 리보스위치의 경우 상대적 라이신 고생산 균주인 W3110에서 TetA의 발현이 저해되어, 사용된 테트라사이클린 농도에서 테트라사이클린에는 민감성을, 사용된 니켈 농도에서는 니켈에 저항성을 가지는 것을 확인하였다. 상기 결과를 통해 현재 구축된 라이신에 대한 인공선택회로 플라스미드(pACYC_ribo_TetA)를 이용하면, 라이신 고생산균주가 TetA의 발현이 저해되어 상대적으로 니켈에 대해 저항성을 가지게 되고, 이를 이용하여 양성 선택이 가능하다는 것을 확인할 수 있었다.
As shown in FIG. 4, in the case of the lysC 5'UTR lysine riboswitch inhibiting the expression by lysine, the expression of TetA was inhibited in W3110, which is a relatively high lysine-producing strain, and tetracycline was sensitive to tetracycline, It was confirmed that the used nickel concentration had resistance to nickel. Using the artificial selection circuit plasmid (pACYC_ribo_TetA) for the currently constructed lysine through the above results, it was found that the lysine-producing strain was inhibited in the expression of TetA and was relatively resistant to nickel, .

실시예Example 5. 고수율  5. High yield 생산균주를Production strains 위한 대사공학 Metabolic Engineering

5-1. 5-1. 합성경로상의Synthetic route 유전자들의 프로모터 교체 Promoter replacement of genes

라이신 합성경로상에 있는 dapA, dapB, lysA의 프로모터를 PCR을 활용한 Red/ET 재조합기술을 이용하여 J23100 프로모터로 교체하였다. The promoters of dapA, dapB, and lysA in the lysine synthesis pathway were replaced with the J23100 promoter using Red / ET recombination technology using PCR.

이를 위해 FRT_neo_FRT-J23100 부분을 프로모터와 재조합시키기 위하여, 상등서열을 포함한 프라이머를 이용하여 증폭하였다. PCR조건은 상기 실시예 2와 동일하나 주형은 pGEM-FRT-neo-FRT-Pc-sgfp로, J23100 프로모터가 주형에 들어있는 pKD4 variant를 사용하였다. dapA 프로모터 교체를 위해 사용된 프라이머는 서열번호 14(P-dapA-F) 및 서열번호 15(P-dapA-R)로, dapB 프로모터 교체를 위해 사용된 프라이머는 서열번호 16(P-dapB-F) 및 서열번호 17(P-dapB-R)로, lysA 프로모터 교체를 위해 사용된 프라이머는 서열번호 18(P-lysA-F) 및 서열번호 19(P-lysA-R)로 사용하였다. 상기 PCR 증폭산물을 정제하고 농축한 후 pKD46에서 발현된 람다 재조합효소(λ recombinase)를 가지고 있는 균주에 전기천공(electroporation) 시켰다. 재조합 균주는 카나마이신(kanamycine)을 함유한 배지에 의해 선별되었고 목표지점에서의 프로모터 변화를 콜로니 PCR을 통해 확인하였다. 이후 카나마이신(kanamycine) 저항성 유전자는 pCP20 벡터의 플립페이즈를 이용하여 제거하였고, 최종적으로 교체된 프로모터의 서열을 DNA 시퀀싱을 통해 확인하였다. 본 실시예의 실험에 대한 개략적인 모식도는 도 5에 간략히 나타내었다.
For this purpose, the FRT_neo_FRT-J23100 fragment was amplified with a primer containing an upstream sequence to recombine with the promoter. The PCR conditions were the same as in Example 2, but the template was pGEM-FRT-neo-FRT-Pc-sgfp and the pKD4 variant in which the J23100 promoter was contained in the template was used. The primers used for the dapA promoter replacement were SEQ ID NO: 14 (P-dapA-F) and SEQ ID NO: 15 (P-dapA-R) ) And SEQ ID NO: 17 (P-dapB-R), the primers used for lysA promoter replacement were used as SEQ ID NO: 18 (P-lysA-F) and SEQ ID NO: 19 (P-lysA-R). The PCR amplification product was purified, concentrated, and electroporated into a strain having a lambda recombinase expressed in pKD46. The recombinant strains were screened by a medium containing kanamycin and the promoter changes at target sites were confirmed by colony PCR. The kanamycin resistance gene was then removed using the pCP20 vector flip phase, and finally the sequence of the replaced promoter was confirmed by DNA sequencing. A schematic schematic diagram of the experiment of this embodiment is shown briefly in Fig.

5-2. 5-2. AspartokinaseAspartokinase 에서의 피드백 제어 제거Remove feedback control from

상기 5-1)에서 제조된 피드백 제어가 제거된 lysC 유전자를 W3110 균주의 염색체에 Red/ET 재조합 시스템을 이용하여 삽입하였다. 사용된 PCR 단편은 FRT_neo_FRT와 사이트 특이적 변이생성을 이용해 아스파르토키나아제(aspartokinase)의 피드백 제어를 제거하고, UTR을 교체하여 번역단계에서의 조절을 제거시킨 lysC 유전자가 연결된 것을 주형으로 하여, W3110 염색체의 lysC 유전자의 위치에 삽입되었다.
The lysC gene without the feedback control prepared in 5-1) was inserted into the chromosome of W3110 strain using Red / ET recombination system. The PCR fragments used were those in which the feedback control of aspartokinase was eliminated using FRT_neo_FRT and site-specific mutagenesis, and the lysC gene, in which the UTR was replaced and the control in the translation step was eliminated, was used as the template and W3110 Was inserted at the position of the lysC gene of the chromosome.

5-3. 5-3. 코리네박테리움Corynebacterium 글루타미컴(Glutamicum ( Corynebacterium glutamicumCorynebacterium glutamicum )의)of ddhddh 유전자 도입 Gene introduction

THDP부터의 효소 반응 단계를 줄이기 위해 ddh 유전자(서열번호 32)를 염색체상의 lac 오페론 위치에 Red/ET 재조합 시스템을 이용해 삽입하였다. PCR 단편은 lac 오페론의 상부(upstream), 하부(downstream)와 각각 상등한 서열을 단편 말단에 포함한 프라이머를 이용하여 pGEM_FRT_neo_FRT_Pc_ddh를 주형으로 PCR 하였다. PCR조건은 실시예 2와 동일하며, 주형은 corynebacterium glutamicum 콜로니를 95℃에서 10분 동안 끓인 것을 50ul PCR 시 0.5ul 첨가하였다. ddh 증폭용 프라이머는 서열번호 20(S-ddh-F) 및 서열번호 21(S-ddh-R)로, 재조합 단편(FRT_neo_FRT_Pc_ddh)증폭용 프라이머는 서열번호 22(P-ddh-F) 및 서열번호 23(P-ddh-R)으로 나타내었다. 주형을 위해 C. glutamicum 염색체에서 증폭된 ddh 를 NdeI, XhoI 제한효소를 사용하여 클로닝 하였다. 본 실시예의 실험에 대한 개략적인 모식도는 도 6에 간략히 나타내었다.
To reduce the enzymatic step from THDP, the ddh gene (SEQ ID NO: 32) was inserted into the lac operon site on the chromosome using the Red / ET recombination system. The PCR fragment was primed with pGEM_FRT_neo_FRT_Pc_ddh as a template using a primer containing a sequence identical to the upstream and downstream of the lac operon at the end of the fragment. The PCR conditions were the same as in Example 2, and the template was corynebacterium The glutamicum colonies were boiled at 95 ° C for 10 minutes and then added with 0.5ul in 50ul PCR. ddh-F) and SEQ ID NO: 21 (S-ddh-R), the primer for amplification of the recombinant fragment (FRT_neo_FRT_Pc_ddh) comprises SEQ ID NO: 22 (P- 23 (P-ddh-R). C. glutamicum for the template The ddh amplified from the chromosome was cloned using NdeI and XhoI restriction enzymes. A schematic schematic diagram of the experiment of this embodiment is briefly shown in Fig.

5-4. 경쟁대사의 제거5-4. Elimination of Competitive Ambassadors

W3110의 염색체상의 metL, thrA유전자가 Red/ET 재조합 시스템을 이용한 one-step 유전자 제거 방법을 통하여 제거되었다. 재조합 방법은 상기 실시예 5-1 내지 5-3과 같으며 프로모터 시퀀스나 외래 유전자 없이 FRT_neo_FRT 단편을 사용하였다. 이를 통하여, 라이신 생산성을 높인 라이신 고생산 균주 W3110_ME가 생산되었다. 본 실시예의 실험에 대한 개략적인 모식도는 도 7에 간략히 나타내었다.
The metL and thrA genes on W3110 chromosomes were removed by the one-step gene deletion method using the Red / ET recombination system. The recombinant method was the same as those of Examples 5-1 to 5-3, except that the FRT_neo_FRT fragment was used without a promoter sequence or a foreign gene. Through this, a lysine - producing strain, W3110_ME, which enhanced lysine productivity, was produced. A schematic schematic diagram of the experiment of this embodiment is shown briefly in Fig.

실시예Example 6. 라이신 생산성에 의해 달라지는 니켈 함유 배지에서의 성장 속도 분석 6. Growth rate analysis in nickel-containing media depending on lysine productivity

라이신 고생산 균주에서 라이신의 축적에 의해 리보스위치가 TetA 발현을 저해함으로써 해당 균주의 니켈에 대한 저항성을 유지시키는 것을 확인하기 위하여 상대적 라이신 저생산 균주인 W3110과 대사공학을 통하여 라이신 생산성을 높인 라이신 고생산 균주 W3110_ME에 선택회로 플라스미드(pACYC_ribo_TetA)를 형질전환 시킨 후 비성장속도 변화를 관찰하였다. In order to confirm that the riboswitches inhibit TetA expression by accumulation of lysine in the lysine-producing strain, the strain W3110, which is a relatively lysine-producing strain, and the lysine- The non-growth rate change was observed after transformation of the selection circuit plasmid (pACYC_ribo_TetA) into the production strain W3110_ME.

W3110/pACYC_ribo_TetA와 W3110_ME/pACYC_ribo_TetA 각각 3 ㎖씩을 강화된 M9 배지(라이신을 제외한 모든 아미노산 첨가)에서 플라스미드 유지를 위한 34μg/ml 클로람페니콜(chloramphenicol)과 함께 배양하였다. 이것을 새로운 M9 배지에 OD600이 0.2가 되도록 접종한 후 5시간 동안 배양하여 시드를 준비하였다. 준비된 시드는 보강된 M9 배지에 (3 ml 혹은 0.25 ml Bioscreen C) OD600이 0.03이 되도록 희석한 후 NiCl2농도를 0, 0.4, 0.8 mM로 달리하여 16시간 동안 배양하였다. 한편, 비성장속도의 변화가 인공선택회로 플라스미드의 TetA 발현량 변화에 의한 것임을 확인하기 위한 대조군으로 TetA를 sGFP(형광단백질)로 교체하여(pACYC_ribo_sGFP) 마찬가지 조건에서 비성장속도를 관찰하였으며 그 결과를 도 8에 나타내었다. 도 8은 강화된 M9 배지에서 0.8 mM 니켈을 첨가하였을 때 인공선택회로 플라스미드(pACYC_ribo_TetA)를 가진 W3110, W3110_ME의 비성장속도를 나타낸다. Y 축은 비성장속도를 나타내며[h-1]각 막대가 나타내는 균주는 범례에 표시하였다. 비성장속도는 각 배양조건에서 12시간 동안 배양한 OD600측정값을 이용하여 계산하였다.3 ml each of W3110 / pACYC_ribo_TetA and W3110_ME / pACYC_ribo_TetA were incubated with 34 μg / ml chloramphenicol for enhanced plasmid maintenance in enhanced M9 medium (all amino acids except lysine). The seeds were inoculated on a new M9 medium to an OD600 of 0.2 and cultured for 5 hours to prepare seeds. The prepared seeds were diluted to a M9 medium (3 ml or 0.25 ml Bioscreen C) to an OD600 of 0.03, and then the NiCl 2 concentration was changed to 0, 0.4, and 0.8 mM for 16 hours. On the other hand, non-growth rate was observed under the same conditions (pACYC_ribo_sGFP) by replacing TetA with sGFP (fluorescent protein) as a control group to confirm that the change of non-growth rate was due to the change of TetA expression amount of the artificial selection circuit plasmid. 8. Figure 8 shows the growth rate of W3110, W3110_ME with artificial selection circuit plasmid (pACYC_ribo_TetA) when 0.8 mM nickel was added in the enhanced M9 medium. The Y axis represents the rate of non-growth and [h-1] the strain indicated by each bar is shown in the legend. The non-growth rate was calculated using the OD600 readings obtained for 12 hours at each culture condition.

도 8에 나타난 바와 같이, 니켈을 선택압으로 가하는 경우 선택회로에서 라이신 고생산균주의 비성장속도가 빠름을 확인하였다. 니켈 민감도에 관여하지 않는 sGFP가 리보스위치에 의해 조절되는 경우에는 라이신 생산성에 따른 니켈 민감도의 변화가 거의 없었다. 그러나 발현량에 따라 니켈에 대한 민감도에 차이를 주는 TetA가 리보스위치에 의해 조절되는 인공선택회로 플라스미드를 가진 경우에는, 라이신 고생산균주에서 TetA의 발현이 억제됨으로써 니켈에 대한 민감도가 적어서 비성장속도가 유지되고, 상대적 라이신 저생산균주의 경우 NiCl2 0.8 mM 농도에서 TetA의 발현에 의한 니켈 민감도를 관찰할 수 있었다.
As shown in FIG. 8, it was confirmed that the non-growth rate of the lysine-producing strain was fast in the selection circuit when nickel was applied at the selective pressure. When sGFP not involved in nickel sensitivity was regulated by riboswitch, there was little change in nickel sensitivity according to lysine productivity. However, in the case of an artificial selection circuit plasmid in which TetA, which varies sensitivity to nickel depending on the expression level, is controlled by a riboswitch, the expression of TetA is suppressed in a lysine-producing strain, so that sensitivity to nickel is low, And for relative lysine-producing strains, NiCl 2 The sensitivity of TetA to Ni was 0.8 mM.

실시예Example 7. 선택회로에 기인한 라이신  7. Lysine due to the selection circuit 고생산균주의Of high producing strains 테트라사이클린에On tetracycline 대한 민감도 증가 분석 Sensitivity increase analysis

라이신 고생산균주에서 보다 직접적인 TetA 유전자의 발현억제를 확인하기 위하여 상대적 라이신 저생산균주인 W3110과 상대적 라이신 고생산균주인 W3110_ME에 인공선택회로 플라스미드(pACYC_ribo_TetA)로 형질전환 시킨 후, 60 μg/ml 테트라사이클린을 함유한 강화된 M9 배지(라이신 제외 모든 아미노산 첨가)에서 성장속도를 관찰하였다. 라이신 고생산균주는 라이신 축적 농도가 높기 때문에 리보스위치에 의해 TetA 발현이 저해되어 테트라사이클린에서 음성 선별되어야 한다. W3110/pACYC_ribo_TetA와 W3110_ME/pACYC_ribo_TetA에 테트라사이클린을 선택압으로 주었을 때의 비성장속도를 관찰한 결과를 도 9에 나타내었다. 도 9에서 Y 축은 비성장속도를 나타내며[h-1]각 막대가 나타내는 균주와 항생제 첨가여부는 범례에 표시하였다. 비성장속도는 각 배양조건에서 12시간 동안 배양한 OD600측정값을 이용하여 계산하였다.In order to confirm the suppression of TetA gene expression more directly in the lysine-producing strain, an artificial selection circuit plasmid (pACYC_ribo_TetA) was transformed into W3110, a relative lysine-producing strain and W3110_ME, The growth rate was monitored in the enhanced M9 medium (with all amino acids except lysine). Because the lysine accumulation concentration is high, the lysine-induced pathogen is inhibited by riboswitching and TetA expression should be negative for tetracycline. The results of observing the non-growth rate when tetracycline is applied to W3110 / pACYC_ribo_TetA and W3110_ME / pACYC_ribo_TetA are shown in FIG. In Fig. 9, the Y axis represents the non-growth rate. [H-1] Whether the strain indicated by each rod and the addition of antibiotics is indicated in the legend. The non-growth rate was calculated using the OD600 readings obtained for 12 hours at each culture condition.

도 9에 나타난 바와 같이, 라이신 고생산균주인 W3110_ME/pACYC_ribo_TetA의 비성장 속도가 라이신 저생산균주인 W3110/pACYC_ribo_TetA보다 저해되었음을 확인하였다. 이는 라이신 고생산균주의 라이신 축적이 높기 때문에 선택회로에서 라이신 리보스위치에 의해 TetA의 발현이 저해되고, TetA 발현 저해에 의해 테트라사이클린을 함유한 배지에서 성장이 억제되었기 때문이다.
As shown in Fig. 9, it was confirmed that the non-growth rate of W3110_ME / pACYC_ribo_TetA, which is a host of lysine-resistant bacteria, was inhibited more than the lysine-producing strain W3110 / pACYC_ribo_TetA. This is because the lysine accumulation of the lysine-producing strain is high, so that the expression of TetA is inhibited by the lysine riboswitch in the selection circuit and the growth is inhibited by the tetracycline-containing medium due to inhibition of TetA expression.

실시예Example 8. 균주 혼합 배양 시 선택회로의 작동 8. Operation of the selection circuit when culturing the strain

실제 조합적 접근법에 의한 균주개선 방법을 사용할 때, 선택회로의 선택력을 이용하여 생산균주의 라이브러리로부터 라이신 고생산균주를 분리할 수 있는지 알아보기 위해 균주를 혼합한 후 배양하여 개체수가 우세해지는 균주를 관찰하였다. 인공선택회로 플라스미드(pACYC_ribo_TetA)와 음성대조군으로 형광단백질을 발현시키는 플라스미드(pACYC_ribo_sGFP)를 W3110과 W3110_ME에 형질전환 시킨 후, 강화된 M9 배지에서 배양하며 어느 균주가 우세하게 성장하는지 관찰하였다. 선택압으로 니켈 0.8 mM을 사용하였고 8시간 간격으로 배양액에서의 우세 균주를 확인하였다. 균주의 확인은 W3110과 W3110_ME에서 PCR을 하였을 때 유전자 길이에 차이가 나는 iclR 지역을 목적으로 하여 PCR을 통해 확인하였다. W3110_ME의 경우 iclR의 제거에 의해 목적 지역의 증폭된 DNA 단편의 길이가 짧다. 실험 결과는 도 10에 나타내었다.In order to investigate whether a lysine-producing strain can be isolated from a production strain's library by using the selectivity of the selection circuit when using the method of improving the strain by an actual combinatorial approach, a strain in which the population is dominant by mixing with the strain is cultured Respectively. Plasmid (pACYC_ribo_TetA) and a plasmid (pACYC_ribo_sGFP) expressing the fluorescent protein as a negative control were transformed into W3110 and W3110_ME, and cultured in the enhanced M9 medium to observe which strain was predominantly grown. Nickel 0.8 mM was used as the selective pressure, and dominant strains were identified at 8 hour intervals. The identification of the strains was confirmed by PCR for the iclR region with different gene length when PCR was performed in W3110 and W3110_ME. In the case of W3110_ME, the length of the amplified DNA fragment in the target region is short due to the removal of iclR. The experimental results are shown in Fig.

도 10에 나타낸 각 lane에서 C의 경우 TetA 유전자가 없는 음성 대조군으로 pACYC_ribo_sGFP를 사용한 경우를 나타내고, ET는 고속선택회로 플라스미드인 pACYC_ribo_TetA를 나타낸다. 시간이 지날수록 라이신 고생산균주의 표지의 밴드가 두꺼워 지는 것을 볼 수 있으며, 이로부터 라이신 고생산균주의 우세한 성장을 확인할 수 있다. 반면 음성 대조군에서는 니켈을 선택압으로 하였을 때 균주의 선택적 분리가 일어나지 않았다는 것을 알 수 있다.10 shows the case where pACYC_ribo_sGFP is used as a negative control group lacking the TetA gene in each lane shown in FIG. 10, and ET represents pACYC_ribo_TetA which is a rapid selection circuit plasmid. As the time passes, the band of the label of the lysine-producing strain becomes thicker, and the predominant growth of the lysine-producing strain can be confirmed from this. On the other hand, in the negative control group, it can be seen that selective separation of the strain did not occur when nickel was selected as the selective pressure.

한편, 니켈이 함유되었을지라도 두 균주가 모두 성장하는 음성대조군(pACYC_ribo_sGFP가 형질전환된 균주)과 달리 선택회로 플라스미드를 가진 경우에는 니켈이 선택압으로 작용하는 배지에서 라이신 고생산 균주가 우세해짐을 확인할 수 있었다. 상기 결과를 통하여 선택회로 플라스미드를 가지고 있는 균주 사이에서 니켈을 선택압으로 주어 배양할 경우 라이신 고생산균에 대한 선택력이 있음을 확인하였다.
On the other hand, unlike the negative control (strain transformed with pACYC_ribo_sGFP) in which both strains were grown even when nickel was contained, it was confirmed that lysine-producing strains predominated in the medium in which nickel was the selective pressure when the selection circuit plasmid was used I could. From the above results, it was confirmed that, when cultured with nickel at a selective pressure between strains having a selection circuit plasmid, the selectivity for lysine - resistant strains was confirmed.

실시예Example 9.  9. EnrichmentEnrichment fromfrom librarylibrary

9-1. 9-1. ppcppc 발현량 라이브러리 생성 Generation of expression level library

포스포에놀피루브산카르복실화효소(phosphoenol pyruvate carboxylase, ppc) 유전자는 포스포에놀피루브산(phosphoenolpyruvate, PEP)의 카르복실산화를 통해 라이신의 전구체인 옥살로아세트산(oxaloacetate)의 보전(anaplerosis)을 담당한다. 한편, PEP는 균주의 에너지 대사 과정인 TCA 사이클의 전구체인 피루브산(pyruvate)으로도 전환되어야 하기 때문에 두 개의 반응이 균형 잡혀야 한다. 이를 위해 ppc 발현량에 대한 분석들이 in silico로 이뤄지고 있지만 실제 균주 개선에서 최적의 발현량을 구현하여 성공한 사례는 없다. 따라서 본 발명에서는 무작위화시킨 프로모터를 이용하여 ppc 발현량이 다양한 플라스미드 생산균주 라이브러리를 제작한 후 인공선택회로를 활용하여 최적화된 발현량을 찾을 목적 효소로 선정하였다.The phosphoenol pyruvate carboxylase (ppc) gene has been shown to inhibit the anaplerosis of oxaloacetate, a precursor of lysine, through the carboxyl oxidation of phosphoenolpyruvate (PEP) I am responsible. On the other hand, PEP should be converted to pyruvate which is the precursor of the TCA cycle, the energy metabolism of the strain, so that the two reactions must be balanced. For this purpose, analysis of ppc expression level is carried out in silico, but there is no successful case in which the optimum expression level is realized in the improvement of strain. Therefore, in the present invention, a plasmid producing strain library having various amounts of ppc expression was prepared using a randomized promoter, and an optimized expression amount was selected as a target enzyme to be searched using an artificial selection circuit.

구체적으로, pCDF_ppc를 구축하기 위해 E.coli 염색체상의 ppc 유전자(서열번호 33)를 증폭하여 KpnI, SacI 제한 효소를 이용하여 pCDF_Duet 벡터에 클로닝 하였다. ppc 증폭에 사용된 PCR 조건은 상기 실시예 2와 같으며 주형은 W3110 콜로니를 95℃에서 10분 동안 끓인 것을 50ul PCR 시 0.5 uL 첨가하였다. ppc 증폭에 사용된 프라이머 서열은 서열번호 24(S-ppc-F) 및 서열번호 25(S-ppc-R)로 나타내었다.Specifically, to construct pCDF_ppc, the ppc gene (SEQ ID NO: 33) on the E. coli chromosome was amplified and cloned into a pCDF_Duet vector using KpnI and SacI restriction enzymes. The PCR conditions used for the amplification of ppc were the same as those in Example 2. The W3110 colonies were boiled at 95 ° C for 10 minutes, and 0.5 μL was added in 50 μl PCR. The primer sequences used for ppc amplification are shown in SEQ ID NO: 24 (S-ppc-F) and SEQ ID NO: 25 (S-ppc-R).

ppc 유전자의 프로모터 서열이 다양해진 플라스미드라이브러리를 구축하기 위하여, 무작위서열 프로모터 오버행 ppc PCR을 실시하였다. 사용된 프라이머는 서열번호 26(J23series-ppc-F) 및 서열번호 27(ppc-lib-R)에 나타내었으며, 상기 클로닝된 pCDF_Duet 벡터를 주형으로 하여 서열번호 28(D-ppc-F) 및 서열번호 29(D-ppc-R)로 나타낸 프라이머에 프로모터의 -35박스, -10박스 영역을 무작위화 시킨 서열을 오버행으로 넣은 후, 5’말단에 인산기(phosphate)를 추가하여 PCR 하였다. PCR 조건은 상기 실시예 1의 PCR 조건과 같으며, PCR 산물은 GeneAll ExpinTM PCRSV PCR purification kit를 이용하여 수확되었으며, DpnI 처리를 통해 주형을 제거하고 T4 라이게이션을 수행하였다. In order to construct a plasmid library with various promoter sequences of the ppc gene, a random sequence promoter overhang ppc PCR was performed. The primers used were shown in SEQ ID NO: 26 (J23series-ppc-F) and SEQ ID NO: 27 (ppc-lib-R), and SEQ ID NO: 28 (D-ppc-F) The sequence shown in SEQ ID NO: 29 (D-ppc-R), in which the -35 box and -10 box regions of the promoter were randomized, was inserted into the overhang, followed by the addition of phosphate at the 5 'end. The PCR conditions were the same as those in Example 1, and the PCR products were GeneAll Expin TM PCRSV PCR purification kit, and the template was removed by DpnI treatment and T4 ligation was performed.

라이게이션 혼합물은 E.coli MegaX DH10BTM에 형질전환 된 후 pCDF_Duet 벡터의 선택표지를 위한 스트렙토마이신(streptomycin)을 함유한 배지를 이용하여 플라스미드가 선별되었다. 12시간 이후 플레이트상의 균주를 모은 후 ppc 유전자의 프로모터가 다양해진 pCDF_J23series_ppc 라이브러리를 수확하였으며, 이를 염색체상의 ppc 유전자를 지운 W3110_MEΔppc 균주에 형질전환 시킴으로써 생산균주 라이브러리를 생성하였다. The ligation mixture was transformed into E. coli MegaX DH10BTM and the plasmid was screened using a medium containing streptomycin for selection of the pCDF_Duet vector. After 12 hours, the strain on the plate was harvested and the pCDF_J23series_ppc library in which the ppc gene promoter was varied was harvested and the production strain library was generated by transforming the ppc gene on the chromosome to the W3110_MEΔppc strain.

염색체상의 ppc 유전자를 제거하는 방법은 상기 실시예 2 의 lysC 제거방법과 같으며 FRT_neo_FRT 증폭시 사용한 프라이머 서열은 서열번호 28(D-ppc-F) 및 서열번호 29(D-ppc-R)에 나타내었다.The primer sequence used in the amplification of FRT_neo_FRT is shown in SEQ ID NO: 28 (D-ppc-F) and SEQ ID NO: 29 (D-ppc-R) in the same manner as in Example 2, except that the ppc gene on the chromosome was removed. .

도 11은 ppc 발현량이 다른 라이브러리 생성과정을 나타낸다. ppc 유전자를 프로모터 없이 pCDF_Duet 벡터에 클로닝 시킨 후 이를 주형으로 하여 무작위화된 프로모터를 오버행으로 가진 프라이머를 이용하여 PCR하였다. PCR 산물을 라이게이션 시키면 pCDF_J23series_ppc 벡터 라이브러리가 생성된다.
Fig. 11 shows a library generation process in which the amount of ppc expression is different. The ppc gene was cloned into a pCDF_Duet vector without a promoter, and PCR was performed using a primer having an overhang as a template and a randomized promoter. When the PCR product is ligated, the pCDFJSeries_ppc vector library is generated.

9-2. 9-2. 생산균주Production strain 라이브러리에서 라이신 고생산 균주를 선별하기 위한 인공선택회로 Artificial selection circuit for screening lysine-producing strains from the library

ppc 발현량이 서로 다른 생산균주 라이브러리를 플레이트에서 수확한 후 M9 배지로 두 번 세척하였다. 세척된 생산균주 라이브러리는 보강된 M9 배지에 OD600이 0.1이 되도록 희석되었다. 그리고 선정된 NiCl2 농도에서 12시간 동안 배양된 후 같은 NiCl2 농도를 첨가한 새로운 보강된 M9 배지에서 OD600이 0.05가 되도록 희석시킨 후 12시간 동안 배양하였다. 이러한 연속된 희석과 배양과정을 세 번 반복하였다.
The production strain library with different amounts of ppc expression was harvested from the plate and then washed twice with M9 medium. The washed production strain library was diluted in M9 medium supplemented to an OD600 of 0.1. After incubation for 12 h at the selected NiCl 2 concentration, the same NiCl 2 The cells were diluted to an OD600 of 0.05 in the newly supplemented M9 medium to which the concentration was added and then cultured for 12 hours. This serial dilution and incubation procedure was repeated three times.

9-3. 선택회로를 이용한 라이신 고생산 균주의 선택적 분리 및 ppc 최적발현을 위한 프로모터 시퀀스 분석9-3. Selective isolation of lysine-producing strains using selective circuit and promoter sequence analysis for optimal expression of ppc

PEP의 흐름이 TCA 회로(TCA cycle)와 옥살로아세트산(oxaloacetate)의 보전(anaplerosis)사이에서 라이신 생산을 위해 최적화된 ppc 유전자 발현량을 보이는 프로모터를 찾기 위하여, 선택회로 플라스미드를 가지고 있는 W3110_MEΔppc에 pCDF_J23series_ppc를 형질전환 시킨 후 니켈을 선택압으로 하여 스트렙토마이신(Streptomycin)을 함유한 보강된 M9 배지에 스트리킹 하고 37℃에서 배양하였다. 니켈 선택압은 pACYC_ribo_sGFP를 함유한 균주를 선택회로 플라스미드의 TetA유전자 발현이 모두 억제된 상태로 판단하여 W3110_ME/pACYC_ribo_sGFP와 W3110_ME/pACYC_ribo_TetA 균주의 니켈 최소 저해 농도(minima inhibitory concentration) 사이에서 선정하였다. In order to find a promoter showing the amount of ppc gene expression optimized for lysine production between the TCA cycle (TCA cycle) and oxalacetate (anaplerosis), the PEP flow was set to W3110_MEΔppc with the selection circuit plasmid pCDF_J23series_ppc And nickel was used as a selective pressure, streaked on stiffened M9 medium containing streptomycin, and cultured at 37 ° C. The nickel selection pressure was selected between the W3110_ME / pACYC_ribo_sGFP and the minima inhibitory concentration of W3110_ME / pACYC_ribo_TetA by judging that the strain containing pACYC_ribo_sGFP was suppressed to all TetA gene expression of the selection circuit plasmid.

라이신 고생산 균주의 선택적 분리를 위해 세 번에 걸친 희석과 배양을 통하여 우세해진 변이주들을 플레이트에서 단일 콜로니화 시켰다. 성장한 콜로니 중 4개의 콜로니를 선택하여 스트렙토마이신(Streptomycin)을 함유한 LB 배지(Luria-Bertani medium)에서 배양한 후 ppc 발현용 플라스미드를 추출하여 인리치먼트된 균주가 가지고 있는 ppc 유전자의 프로모터 시퀀스를 분석하였다(Solgent, 대전). 총 4개 중에 2개의 프로모터 서열이 동일(서열번호 30)하였으며, 아래와 같이 나타내었다. 밑줄로 표시된 부분 중 TTGTCAG이 무작위화된 -35박스 영역, TTCCAG이 -10박스 영역이며, ATG가 시작코돈이다. For selective isolation of the lysine-producing strain, mutants predominantly through three rounds of dilution and incubation were single colonized on the plate. Four colonies of the grown colonies were selected and cultured in LB medium (Luria-Bertani medium) containing streptomycin. Then, the plasmid for ppc expression was extracted and the promoter sequence of the ppc gene of the cultivated strain was obtained (Solgent, Daejeon). Two of the four promoter sequences were the same (SEQ ID NO: 30) and were shown as follows. Among the underlined parts, TTGTCAG is the randomized -35 box area, TTCCAG is the -10 box area, and ATG is the starting codon.

AGAGTTGTCAGCTAGCTCAGTCCTAGGTTCCAGGCTAGCAGACGACGAAAAGCAAAGCCCGAGCATATTCGCGCCAATGCGACGTGAAGGATACAGGGCTATCAAACGATAAGATGGGGTGTCTGGGGTAATATGAACGAACAA (서열번호 30)AGAG TTGTCA GCTAGCTCAGTCCTAGG TTCCAG GCTAGCAGACGACGAAAAGCAAAGCCCGAGCATATTCGCGCCAATGCGACGTGAAGGATACAGGGCTATCAAACGATAAGATGGGGTGTCTGGGGTAAT ATG AACGAACAA (SEQ ID NO: 30)

상기 서열번호 30으로 기재된 프로모터를 포함한 플라스미드를 가지는 균주와 W3110_ME의 라이신 축적량, 글루코스 소비량을 비교하였다. 인리치먼트된 변이주인 W3110_MEΔppc/pCDF_F0.3ppc의 라이신 축적량이 라이브러리화 되기 전의 균주인 W3110_ME/pCDF_Duet보다 더 높은 라이신 축적량을 보임을 확인하였으며, 그 결과를 도 12에 나타내었다. 각 균주는 스트렙토마이신을 함유한 보강된 M9 배지에서 배양되었다. W3110_ME의 경우 염색체상의 ppc 유전자를 바꾸지 않은 균주를 나타내며 대조군으로 사용하기 위해 pCDF_Duet벡터로 형질전환시켰다.
The lysine accumulation amount and the glucose consumption amount of W3110_ME were compared with strains having a plasmid containing the promoter shown in SEQ ID NO: 30. It was confirmed that lysine accumulation of the mutant strain W3110_MEΔppc / pCDF_F0.3ppc showed higher lysine accumulation than the strain W3110_ME / pCDF_Duet before the library was obtained, and the results are shown in FIG. Each strain was cultured in stiffened M9 medium containing streptomycin. In the case of W3110_ME, the strain expressing the ppc gene on the chromosome was transformed into pCDF_Duet vector for use as a control.

9-4. 니켈 함유 배지에서의 성장 분석9-4. Growth analysis in nickel-containing medium

pACYC_ribo_TetA로 형질전환 시킨 W3110_ME/pCDF_Duet와 W3110_MEΔppc/pCDF_F0.3ppc를 3 ml 보강된 M9 배지에서 벡터유지를 위한 항생제와 함께 배양하였다. 이것을 새로운 보강된 M9 배지에 OD600이 0.2가 되도록 접종한 후 5시간 동안 배양하여 시드를 준비하였다. 준비된 시드는 보강된 M9 배지에(3 ml 혹은 5ml의 Bioscreen C) OD600이 0.03이 되도록 희석한 후 NiCl2농도를 달리하여(0 ~ 2.0 mM, 0.5mM 간격) 16시간 동안 배양하였다.
W3110_ME / pCDF_Duet and W3110_MEΔppc / pCDF_F0.3ppc transformed with pACYC_ribo_TetA were incubated with 3 ml of the supplemented M9 medium with antibiotics for vector maintenance. The seeds were inoculated on a new M9 medium supplemented with OD600 of 0.2 and cultured for 5 hours to prepare seeds. Prepared seeds were diluted in M9 medium (3 ml or 5 ml of Bioscreen C) to an OD600 of 0.03 and cultured for 16 hours at different concentrations of NiCl 2 (0 to 2.0 mM, 0.5 mM intervals).

9-5. 9-5. ppcppc 발현량 변화에 따른 라이신 축적량 변화 Changes in lysine accumulation with changes in expression level

W3110_ME/pCDF_Duet과 W3110_MEΔppc/pCDF_F0.3ppc를 보강된 M9 배지에 벡터 유지를 위한 항생제와 함께 접종한 후 새로운 배지에 OD600이 0.1이 되도록 희석하여 7시간 동안 배양한 것을 시드로 사용하였다. 라이신 측정을 위한 배양은 300 ml 플라스크를 사용하였으며 30 ml의 보강된 M9 배지에 초기 OD600이 0.05가 되도록 접종 한 후 37℃, 200rpm으로 총 20시간 동안 배양하였다. 2시간 간격으로 OD600과 남아있는 글루코스의 양, 배지에 축적된 라이신의 양을 HPLC를 이용하여 측정하였다. 그 결과는 도 12에 나타내었다.W3110_ME / pCDF_Duet and W3110_MEΔppc / pCDF_F0.3ppc were inoculated in the supplemented M9 medium with antibiotics for vector maintenance, diluted to an OD600 of 0.1 in fresh medium, and cultured for 7 hours. For the lysine assay, 300 ml flasks were used and 30 ml of the supplemented M9 medium was inoculated to an initial OD600 of 0.05, followed by incubation at 37 ° C and 200 rpm for a total of 20 hours. The amount of OD600 and remaining glucose and the amount of lysine accumulated in the medium were measured by HPLC every 2 hours. The results are shown in Fig.

도 12에 나타난 바와 같이, 인리치먼트된 변이주인 W3110_MEΔppc/pCDF_F0.3ppc의 라이신 축적량이 라이브러리화 되기 전의 균주인 W3110_ME/pCDF_Duet보다 더 높은 라이신 축적량을 보임을 확인하였다.
As shown in FIG. 12, it was confirmed that the lysine accumulation amount of the mutant strain W3110_MEΔppc / pCDF_F0.3ppc showed a higher lysine accumulation than the strain W3110_ME / pCDF_Duet before being libraryed.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

한국생명공학연구원Korea Biotechnology Research Institute KCTC12184BPKCTC12184BP 2012040520120405

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Method for Screening Microorganism with High Lysine Productivity Using Riboswitch <130> PB11-09889 <160> 33 <170> KopatentIn 2.0 <210> 1 <211> 306 <212> DNA <213> Artificial Sequence <220> <223> Lysine riboswitch <400> 1 gtactacctg cgctagcgca ggccagaaga ggcgcgttgc ccaagtaacg gtgttggagg 60 agccagtcct gtgataacac ctgagggggt gcatcgccga ggtgattgaa cggctggcca 120 cgttcatcat cggctacagg ggctgaatcc cctgggttgt caccagaagc gttcgcagtc 180 gggcgtttcg caagtggtgg agcacttctg ggtgaaaata gtagcgaagt atcgctctgc 240 gcccacccgt cttccgctct tcccttgtgc caaggctgaa aatggatccc ctgacacgag 300 gtagtt 306 <210> 2 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> P_ribo-F primer <400> 2 attgacggct agctcagtcc taggtacagt gctagcgtac tacctgcgct agcgca 56 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ribo-B primer <400> 3 aactacctcg tgtcagggga tccat 25 <210> 4 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> ribo-sgfp-F primer <400> 4 ctcttccctt gtgccaaggc tgaaaatgga tcccctgaca cgaggtagtt atggctagca 60 agggcgagga gctgt 75 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> sgfp-R primer <400> 5 acaaaaaacc cctcaagacc cgtttagagg c 31 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> KpnI-P-F primer <400> 6 aggtaccttg acggctagct cagtcctagg tacagtg 37 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> SacI-vec-R primer <400> 7 agagctcgtg gccaggaccc aacgctgccc ga 32 <210> 8 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> D-lysC-F primer <400> 8 gactttggaa gattgtagcg ccagtcacag aaaaatgtga tggttttagt gcgatgcctc 60 atccgcttct c 71 <210> 9 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D-lysC-R primer <400> 9 gacaagaaaa tcaatacggc ccgaaatata gcttccaggc catacagtat gcaacgcagt 60 agctggagtc 70 <210> 10 <211> 1112 <212> DNA <213> Artificial Sequence <220> <223> ribo_sGFP <400> 10 ggtaccttga cggctagctc agtcctaggt acagtgctag cgtactacct gcgctagcgc 60 aggccagaag aggcgcgttg cccaagtaac ggtgttggag gagccagtcc tgtgataaca 120 cctgaggggg tgcatcgccg aggtgattga acggctggcc acgttcatca tcggctacag 180 gggctgaatc ccctgggttg tcaccagaag cgttcgcagt cgggcgtttc gcaagtggtg 240 gagcacttct gggtgaaaat agtagcgaag tatcgctctg cgcccacccg tcttccgctc 300 ttcccttgtg ccaaggctga aaatggatcc cctgacacga ggtagttatg gctagcaagg 360 gcgaggagct gttcaccggg gtggtgccca tcctggtcga gctggacggc gacgtaaacg 420 gccacaagtt cagcgtgcgc ggcgagggcg agggcgatgc caccaacggc aagctgaccc 480 tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc gtgaccaccc 540 tgacctacgg cgtgcagtgc ttcagccgct accccgacca catgaagcag cacgacttct 600 tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac catcagcttc aaggacgacg 660 gcacctacaa gacccgcgcc gaggtgaagt tcgagggcga caccctggtg aaccgcatcg 720 agctgaaggg catcgacttc aaggaggacg gcaacatcct ggggcacaag ctggagtaca 780 acttcaacag ccacaacgtc tatatcaccg ccgacaagca gaagaacggc atcaaggcca 840 acttcaagat ccgccacaac gtggaggacg gcagcgtgca gctcgccgac cactaccagc 900 agaacacccc catcggcgac ggccccgtgc tgctgcccga caaccactac ctgagcaccc 960 agtccgtgct gagcaaagac cccaacgaga agcgcgatca catggtcctg ctggagttcg 1020 tgaccgccgc cgggatcact ctcggcatgg acgagctgta caagaagctt gcggccgcac 1080 tcgagcacca ccaccaccac cactgagagc tc 1112 <210> 11 <211> 1718 <212> DNA <213> Artificial Sequence <220> <223> ribo_TetA <400> 11 ggtaccttga cggctagctc agtcctaggt acagtgctag cgtactacct gcgctagcgc 60 aggccagaag aggcgcgttg cccaagtaac ggtgttggag gagccagtcc tgtgataaca 120 cctgaggggg tgcatcgccg aggtgattga acggctggcc acgttcatca tcggctacag 180 gggctgaatc ccctgggttg tcaccagaag cgttcgcagt cgggcgtttc gcaagtggtg 240 gagcacttct gggtgaaaat agtagcgaag tatcgctctg cgcccacccg tcttccgctc 300 ttcccttgtg ccaaggctga aaatggatcc cctgacacga ggtagttatg aaatctaaca 360 atgcgctcat cgtcatcctc ggcaccgtca ccctggatgc tgtaggcata ggcttggtta 420 tgccggtact gccgggcctc ttgcgggata tcgtccattc cgacagcatc gccagtcact 480 atggcgtgct gctagcgcta tatgcgttga tgcaatttct atgcgcaccc gttctcggag 540 cactgtccga ccgctttggc cgccgcccag tcctgctcgc ttcgctactt ggagccacta 600 tcgactacgc gatcatggcg accacacccg tcctgtggat cctctacgcc ggacgcatcg 660 tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc gacatcaccg 720 atggggaaga tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc gtgggtatgg 780 tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca ccattccttg 840 cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg caggagtcgc 900 ataagggaga gcgtcgaccg atgcccttga gagccttcaa cccagtcagc tccttccggt 960 gggcgcgggg catgactatc gtcgccgcac ttatgactgt cttctttatc atgcaactcg 1020 taggacaggt gccggcagcg ctctgggtca ttttcggcga ggaccgcttt cgctggagcg 1080 cgacgatgat cggcctgtcg cttgcggtat tcggaatctt gcacgccctc gctcaagcct 1140 tcgtcactgg tcccgccacc aaacgtttcg gcgagaagca ggccattatc gccggcatgg 1200 cggccgacgc gctgggctac gtcttgctgg cgttcgcgac gcgaggctgg atggccttcc 1260 ccattatgat tcttctcgct tccggcggca tcgggatgcc cgcgttgcag gccatgctgt 1320 ccaggcaggt agatgacgac catcagggac agcttcaagg atcgctcgcg gctcttacca 1380 gcctaacttc gatcactgga ccgctgatcg tcacggcgat ttatgccgcc tcggcgagca 1440 catggaacgg gttggcatgg attgtaggcg ccgccctata ccttgtctgc ctccccgcgt 1500 tgcgtcgcgg tgcatggagc cgggccacct cgacctgaat ggaagccggc ggcacctcgc 1560 taacggattc accactccaa gaattggagc caatcaattc ttgcggagaa ctgtgaatgc 1620 gcaaaccaac ccttggcaga acatatccat cgcgtccgcc atctccagca gccgcacgcg 1680 gcgcatctcg ggcagcgttg ggtcctggcc acgagctc 1718 <210> 12 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> ribo-tetA-F primer <400> 12 ctcttccctt gtgccaaggc tgaaaatgga tcccctgaca cgaggtagtt atgaaatcta 60 acaatgcgct catcg 75 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> tetA-R primer <400> 13 agagctcgtg gccaggaccc aacgctgccc ga 32 <210> 14 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> P-dapA-F primer <400> 14 ggaaagcata aaaaaaacat gcatacaaca atcagaacgg ttctgtctgc atgggaatta 60 gccatggtcc atatg 75 <210> 15 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> P-dapA-R primer <400> 15 atcgcgacaa tacttcccgt gaacatgggc catcctctgt gcaaacaagt gctagcactg 60 tacctaggac tgagc 75 <210> 16 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> P-dapB-F primer <400> 16 gtaacctgtc acatgttatt ggcatgcagt cattcatcga ctcatgccat gggaattagc 60 catggtcc 68 <210> 17 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> P-dapB-R primer <400> 17 ggatgtttgc atcatgcata gctattctct tttgttaatt tgcatagacc gctagcactg 60 tacctaggac tgagc 75 <210> 18 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> P-lysA-F primer <400> 18 gccattagcg ctctctcgca atccggtaat ccatatcatt tttgcataga gaatatcctc 60 cttagttcct attccgaag 79 <210> 19 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> P-lysA-R primer <400> 19 agattttcgg cggtgagatc ggtatcggtg ctgaacagtg aatgtggcat atgtatatct 60 ccttcttaaa gttaaacaa 79 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> S-ddh-F primer <400> 20 acatatgacc aacatccgcg tagctatcgt gg 32 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> S-ddh-R primer <400> 21 actcgagcta aattagacgt cgcgtg 26 <210> 22 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> P-ddh-F primer <400> 22 ttaaactgac gattcaactt tataatcttt gaaataatag tgcttatccc gtctatttcg 60 ttcatccgaa tatcctcc 78 <210> 23 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> P-ddh-R primer <400> 23 gcggtatggc atgatagcgc ccggaagaga gtcaattcag ggtggtgaat gagctccaaa 60 aaacccctca agac 74 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S-ppc-F primer <400> 24 agacgacgaa aagcaaagcc cgagc 25 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> S-ppc-R primer <400> 25 gcagacagaa atatattgaa aacgagggtg 30 <210> 26 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> J23series-ppc-F primer <400> 26 agagnnnnnn gctagctcag tcctaggnnn nnngctagca gacgacgaaa agcaaagccc 60 gagc 64 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ppc-lib-R primer <400> 27 gcagacagaa atatattgaa aacgagggtg 30 <210> 28 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> D-ppc-F primer <400> 28 ccagtgccgc aataatgtcg gatgcgatac ttgcgcatct tatccgaccg ttagcccgtc 60 tgtcccaa 68 <210> 29 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> D-ppc-R primer <400> 29 gcagacagaa atatattgaa aacgagggtg ttagaacaga agtatcatac tcgctcttgg 60 gtcgg 65 <210> 30 <211> 144 <212> DNA <213> Artificial Sequence <220> <223> promoter of ppc gene <400> 30 agagttgtca gctagctcag tcctaggttc caggctagca gacgacgaaa agcaaagccc 60 gagcatattc gcgccaatgc gacgtgaagg atacagggct atcaaacgat aagatggggt 120 gtctggggta atatgaacga acaa 144 <210> 31 <211> 1191 <212> DNA <213> Artificial Sequence <220> <223> TetA gene <400> 31 atgaaatcta acaatgcgct catcgtcatc ctcggcaccg tcaccctgga tgctgtaggc 60 ataggcttgg ttatgccggt actgccgggc ctcttgcggg atatcgtcca ttccgacagc 120 atcgccagtc actatggcgt gctgctagcg ctatatgcgt tgatgcaatt tctatgcgca 180 cccgttctcg gagcactgtc cgaccgcttt ggccgccgcc cagtcctgct cgcttcgcta 240 cttggagcca ctatcgacta cgcgatcatg gcgaccacac ccgtcctgtg gatcctctac 300 gccggacgca tcgtggccgg catcaccggc gccacaggtg cggttgctgg cgcctatatc 360 gccgacatca ccgatgggga agatcgggct cgccacttcg ggctcatgag cgcttgtttc 420 ggcgtgggta tggtggcagg ccccgtggcc gggggactgt tgggcgccat ctccttgcat 480 gcaccattcc ttgcggcggc ggtgctcaac ggcctcaacc tactactggg ctgcttccta 540 atgcaggagt cgcataaggg agagcgtcga ccgatgccct tgagagcctt caacccagtc 600 agctccttcc ggtgggcgcg gggcatgact atcgtcgccg cacttatgac tgtcttcttt 660 atcatgcaac tcgtaggaca ggtgccggca gcgctctggg tcattttcgg cgaggaccgc 720 tttcgctgga gcgcgacgat gatcggcctg tcgcttgcgg tattcggaat cttgcacgcc 780 ctcgctcaag ccttcgtcac tggtcccgcc accaaacgtt tcggcgagaa gcaggccatt 840 atcgccggca tggcggccga cgcgctgggc tacgtcttgc tggcgttcgc gacgcgaggc 900 tggatggcct tccccattat gattcttctc gcttccggcg gcatcgggat gcccgcgttg 960 caggccatgc tgtccaggca ggtagatgac gaccatcagg gacagcttca aggatcgctc 1020 gcggctctta ccagcctaac ttcgatcact ggaccgctga tcgtcacggc gatttatgcc 1080 gcctcggcga gcacatggaa cgggttggca tggattgtag gcgccgccct ataccttgtc 1140 tgcctccccg cgttgcgtcg cggtgcatgg agccgggcca cctcgacctg a 1191 <210> 32 <211> 1063 <212> DNA <213> Artificial Sequence <220> <223> ddh gene <400> 32 ggtaccttga cggctagctc agtcctaggt acagtgctag cgaccacaac ggtttccctc 60 tagaaataat tttgtttaac tttaagaagg agatatacat atgaccaaca tccgcgtagc 120 tatcgtgggc tacggaaacc tgggacgcag cgtcgaaaag cttattgcca agcagcccga 180 catggacctt gtaggaatct tctcgcgccg ggccaccctc gacacaaaga cgccagtctt 240 tgatgtcgcc gacgtggaca agcacgccga cgacgtggac gtgctgttcc tgtgcatggg 300 ctccgccacc gacatccctg agcaggcacc aaagttcgcg cagttcgcct gcaccgtaga 360 cacctacgac aaccaccgcg acatcccacg ccaccgccag gtcatgaacg aagccgccac 420 cgcagccggc aacgttgcac tggtctctac cggctgggat ccaggaatgt tctccatcaa 480 ccgcgtctac gcagcggcag tcttagccga gcaccagcag cacaccttct ggggcccagg 540 tttgtcacag ggccactccg atgctttgcg acgcatccct ggcgttcaaa aggcagtcca 600 gtacaccctc ccatccgaag acgccctgga aaaggcccgc cgcggcgaag ccggcgacct 660 taccggaaag caaacccaca agcgccaatg cttcgtggtt gccgacgcgg ccgatcacga 720 gcgcatcgaa aacgacatcc gcaccatgcc tgattacttc gttggctacg aagtcgaagt 780 caacttcatc gacgaagcaa ccttcgactc cgagcacacc ggcatgccac acggtggcca 840 cgtgattacc accggcgaca ccggtggctt caaccacacc gtggaataca tcctcaagct 900 ggaccgaaac ccagatttca ccgcttcctc acagatcgct ttcggtcgcg cagctcaccg 960 catgaagcag cagggccaaa gcggagcttt caccgtcctc gaagttgctc catacctgct 1020 ctccccagag aacttggacg atctgatcgc acgcgacgtc taa 1063 <210> 33 <211> 2652 <212> DNA <213> Artificial Sequence <220> <223> ppc gene <400> 33 atgaacgaac aatattccgc attgcgtagt aatgtcagta tgctcggcaa agtgctggga 60 gaaaccatca aggatgcgtt gggagaacac attcttgaac gcgtagaaac tatccgtaag 120 ttgtcgaaat cttcacgcgc tggcaatgat gctaaccgcc aggagttgct caccacctta 180 caaaatttgt cgaacgacga gctgctgccc gttgcgcgtg cgtttagtca gttcctgaac 240 ctggccaaca ccgccgagca ataccacagc atttcgccga aaggcgaagc tgccagcaac 300 ccggaagtga tcgcccgcac cctgcgtaaa ctgaaaaacc agccggaact gagcgaagac 360 accatcaaaa aagcagtgga atcgctgtcg ctggaactgg tcctcacggc tcacccaacc 420 gaaattaccc gtcgtacact gatccacaaa atggtggaag tgaacgcctg tttaaaacag 480 ctcgataaca aagatatcgc tgactacgaa cacaaccagc tgatgcgtcg cctgcgccag 540 ttgatcgccc agtcatggca taccgatgaa atccgtaagc tgcgtccaag cccggtagat 600 gaagccaaat ggggctttgc cgtagtggaa aacagcctgt ggcaaggcgt accaaattac 660 ctgcgcgaac tgaacgaaca actggaagag aacctcggct acaaactgcc cgtcgaattt 720 gttccggtcc gttttacttc gtggatgggc ggcgaccgcg acggcaaccc gaacgtcact 780 gccgatatca cccgccacgt cctgctactc agccgctgga aagccaccga tttgttcctg 840 aaagatattc aggtgctggt ttctgaactg tcgatggttg aagcgacccc tgaactgctg 900 gcgctggttg gcgaagaagg tgccgcagaa ccgtatcgct atctgatgaa aaacctgcgt 960 tctcgcctga tggcgacaca ggcatggctg gaagcgcgcc tgaaaggcga agaactgcca 1020 aaaccagaag gcctgctgac acaaaacgaa gaactgtggg aaccgctcta cgcttgctac 1080 cagtcacttc aggcgtgtgg catgggtatt atcgccaacg gcgatctgct cgacaccctg 1140 cgccgcgtga aatgtttcgg cgtaccgctg gtccgtattg atatccgtca ggagagcacg 1200 cgtcataccg aagcgctggg cgagctgacc cgctacctcg gtatcggcga ctacgaaagc 1260 tggtcagagg ccgacaaaca ggcgttcctg atccgcgaac tgaactccaa acgtccgctt 1320 ctgccgcgca actggcaacc aagcgccgaa acgcgcgaag tgctcgatac ctgccaggtg 1380 attgccgaag caccgcaagg ctccattgcc gcctacgtga tctcgatggc gaaaacgccg 1440 tccgacgtac tggctgtcca cctgctgctg aaagaagcgg gtatcgggtt tgcgatgccg 1500 gttgctccgc tgtttgaaac cctcgatgat ctgaacaacg ccaacgatgt catgacccag 1560 ctgctcaata ttgactggta tcgtggcctg attcagggca aacagatggt gatgattggc 1620 tattccgact cagcaaaaga tgcgggagtg atggcagctt cctgggcgca atatcaggca 1680 caggatgcat taatcaaaac ctgcgaaaaa gcgggtattg agctgacgtt gttccacggt 1740 cgcggcggtt ccattggtcg cggcggcgca cctgctcatg cggcgctgct gtcacaaccg 1800 ccaggaagcc tgaaaggcgg cctgcgcgta accgaacagg gcgagatgat ccgctttaaa 1860 tatggtctgc cagaaatcac cgtcagcagc ctgtcgcttt ataccggggc gattctggaa 1920 gccaacctgc tgccaccgcc ggagccgaaa gagagctggc gtcgcattat ggatgaactg 1980 tcagtcatct cctgcgatgt ctaccgcggc tacgtacgtg aaaacaaaga ttttgtgcct 2040 tacttccgct ccgctacgcc ggaacaagaa ctgggcaaac tgccgttggg ttcacgtccg 2100 gcgaaacgtc gcccaaccgg cggcgtcgag tcactacgcg ccattccgtg gatcttcgcc 2160 tggacgcaaa accgtctgat gctccccgcc tggctgggtg caggtacggc gctgcaaaaa 2220 gtggtcgaag acggcaaaca gagcgagctg gaggctatgt gccgcgattg gccattcttc 2280 tcgacgcgtc tcggcatgct ggagatggtc ttcgccaaag cagacctgtg gctggcggaa 2340 tactatgacc aacgcctggt agacaaagca ctgtggccgt taggtaaaga gttacgcaac 2400 ctgcaagaag aagacatcaa agtggtgctg gcgattgcca acgattccca tctgatggcc 2460 gatctgccgt ggattgcaga gtctattcag ctacggaata tttacaccga cccgctgaac 2520 gtattgcagg ccgagttgct gcaccgctcc cgccaggcag aaaaagaagg ccaggaaccg 2580 gatcctcgcg tcgaacaagc gttaatggtc actattgccg ggattgcggc aggtatgcgt 2640 aataccggct aa 2652 <110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Method for Screening Microorganism with High Lysine Productivity          Using Riboswitch <130> PB11-09889 <160> 33 <170> Kopatentin 2.0 <210> 1 <211> 306 <212> DNA <213> Artificial Sequence <220> <223> Lysine riboswitch <400> 1 gtactacctg cgctagcgca ggccagaaga ggcgcgttgc ccaagtaacg gtgttggagg 60 agccagtcct gtgataacac ctgagggggt gcatcgccga ggtgattgaa cggctggcca 120 cgttcatcat cggctacagg ggctgaatcc cctgggttgt caccagaagc gttcgcagtc 180 gggcgtttcg caagtggtgg agcacttctg ggtgaaaata gtagcgaagt atcgctctgc 240 gcccacccgt cttccgctct tcccttgtgc caaggctgaa aatggatccc ctgacacgag 300 gtagtt 306 <210> 2 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> P_ribo-F primer <400> 2 attgacggct agctcagtcc taggtacagt gctagcgtac tacctgcgct agcgca 56 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ribo-B primer <400> 3 aactacctcg tgtcagggga tccat 25 <210> 4 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> ribo-sgfp-F primer <400> 4 ctcttccctt gtgccaaggc tgaaaatgga tcccctgaca cgaggtagtt atggctagca 60 agggcgagga gctgt 75 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> sgfp-R primer <400> 5 acaaaaaacc cctcaagacc cgtttagagg c 31 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> KpnI-P-F primer <400> 6 aggtaccttg acggctagct cagtcctagg tacagtg 37 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> SacI-vec-R primer <400> 7 agagctcgtg gccaggaccc aacgctgccc ga 32 <210> 8 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> D-lysC-F primer <400> 8 gactttggaa gattgtagcg ccagtcacag aaaaatgtga tggttttagt gcgatgcctc 60 atccgcttct c 71 <210> 9 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D-lysC-R primer <400> 9 gacaagaaaa tcaatacggc ccgaaatata gcttccaggc catacagtat gcaacgcagt 60 agctggagtc 70 <210> 10 <211> 1112 <212> DNA <213> Artificial Sequence <220> <223> ribo_sGFP <400> 10 ggtaccttga cggctagctc agtcctaggt acagtgctag cgtactacct gcgctagcgc 60 aggccagaag aggcgcgttg cccaagtaac ggtgttggag gagccagtcc tgtgataaca 120 cctgaggggg tgcatcgccg aggtgattga acggctggcc acgttcatca tcggctacag 180 gggctgaatc ccctgggttg tcaccagaag cgttcgcagt cgggcgtttc gcaagtggtg 240 gagcacttct gggtgaaaat agtagcgaag tatcgctctg cgcccacccg tcttccgctc 300 ttcccttgtg ccaaggctga aaatggatcc cctgacacga ggtagttatg gctagcaagg 360 gt; gccacaagtt cagcgtgcgc ggcgagggcg agggcgatgc caccaacggc aagctgaccc 480 tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc gtgaccaccc 540 tgacctacgg cgtgcagtgc ttcagccgct accccgacca catgaagcag cacgacttct 600 tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac catcagcttc aaggacgacg 660 gcacctacaa gacccgcgcc gaggtgaagt tcgagggcga caccctggtg aaccgcatcg 720 agctgaaggg catcgacttc aaggaggacg gcaacatcct ggggcacaag ctggagtaca 780 acttcaacag ccacaacgtc tatatcaccg ccgacaagca gaagaacggc atcaaggcca 840 acttcaagat ccgccacaac gtggaggacg gcagcgtgca gctcgccgac cactaccagc 900 agaacacccc catcggcgac ggccccgtgc tgctgcccga caaccactac ctgagcaccc 960 agtccgtgct gagcaaagac cccaacgaga agcgcgatca catggtcctg ctggagttcg 1020 tgaccgccgc cgggatcact ctcggcatgg acgagctgta caagaagctt gcggccgcac 1080 tcgagcacca ccaccaccac cactgagagc tc 1112 <210> 11 <211> 1718 <212> DNA <213> Artificial Sequence <220> <223> ribo_TetA <400> 11 ggtaccttga cggctagctc agtcctaggt acagtgctag cgtactacct gcgctagcgc 60 aggccagaag aggcgcgttg cccaagtaac ggtgttggag gagccagtcc tgtgataaca 120 cctgaggggg tgcatcgccg aggtgattga acggctggcc acgttcatca tcggctacag 180 gggctgaatc ccctgggttg tcaccagaag cgttcgcagt cgggcgtttc gcaagtggtg 240 gagcacttct gggtgaaaat agtagcgaag tatcgctctg cgcccacccg tcttccgctc 300 ttcccttgtg ccaaggctga aaatggatcc cctgacacga ggtagttatg aaatctaaca 360 atgcgctcat cgtcatcctc ggcaccgtca ccctggatgc tgtaggcata ggcttggtta 420 tgccggtact gccgggcctc ttgcgggata tcgtccattc cgacagcatc gccagtcact 480 atggcgtgct gctagcgcta tatgcgttga tgcaatttct atgcgcaccc gttctcggag 540 cactgtccga ccgctttggc cgccgcccag tcctgctcgc ttcgctactt ggagccacta 600 tcgactacgc gatcatggcg accacacccg tcctgtggat cctctacgcc ggacgcatcg 660 tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc gacatcaccg 720 atggggaaga tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc gtgggtatgg 780 tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca ccattccttg 840 cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg caggagtcgc 900 ataagggaga gcgtcgaccg atgcccttga gagccttcaa cccagtcagc tccttccggt 960 gggcgcgggg catgactatc gtcgccgcac ttatgactgt cttctttatc atgcaactcg 1020 taggacaggt gccggcagcg ctctgggtca ttttcggcga ggaccgcttt cgctggagcg 1080 cgacgatgat cggcctgtcg cttgcggtat tcggaatctt gcacgccctc gctcaagcct 1140 tcgtcactgg tcccgccacc aaacgtttcg gcgagaagca ggccattatc gccggcatgg 1200 cggccgacgc gctgggctac gtcttgctgg cgttcgcgac gcgaggctgg atggccttcc 1260 ccattatgat tcttctcgct tccggcggca tcgggatgcc cgcgttgcag gccatgctgt 1320 ccaggcaggt agatgacgac catcagggac agcttcaagg atcgctcgcg gctcttacca 1380 gcctaacttc gatcactgga ccgctgatcg tcacggcgat ttatgccgcc tcggcgagca 1440 catggaacgg gttggcatgg attgtaggcg ccgccctata ccttgtctgc ctccccgcgt 1500 tgcgtcgcgg tgcatggagc cgggccacct cgacctgaat ggaagccggc ggcacctcgc 1560 taacggattc accactccaa gaattggagc caatcaattc ttgcggagaa ctgtgaatgc 1620 gcaaaccaac ccttggcaga acatatccat cgcgtccgcc atctccagca gccgcacgcg 1680 gcgcatctcg ggcagcgttg ggtcctggcc acgagctc 1718 <210> 12 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> ribo-tetA-F primer <400> 12 ctcttccctt gtgccaaggc tgaaaatgga tcccctgaca cgaggtagtt atgaaatcta 60 acaatgcgct catcg 75 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> tetA-R primer <400> 13 agagctcgtg gccaggaccc aacgctgccc ga 32 <210> 14 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> P-dapA-F primer <400> 14 ggaaagcata aaaaaaacat gcatacaaca atcagaacgg ttctgtctgc atgggaatta 60 gccatggtcc atatg 75 <210> 15 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> P-dapA-R primer <400> 15 atcgcgacaa tacttcccgt gaacatgggc catcctctgt gcaaacaagt gctagcactg 60 tacctaggac tgagc 75 <210> 16 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> P-dapB-F primer <400> 16 gtaacctgtc acatgttatt ggcatgcagt cattcatcga ctcatgccat gggaattagc 60 catggtcc 68 <210> 17 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> P-dapB-R primer <400> 17 ggatgtttgc atcatgcata gctattctct tttgttaatt tgcatagacc gctagcactg 60 tacctaggac tgagc 75 <210> 18 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> P-lysA-F primer <400> 18 gccattagcg ctctctcgca atccggtaat ccatatcatt tttgcataga gaatatcctc 60 cttagttcct attccgaag 79 <210> 19 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> P-lysA-R primer <400> 19 agattttcgg cggtgagatc ggtatcggtg ctgaacagtg aatgtggcat atgatatat 60 ccttcttaaa gttaaacaa 79 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> S-ddH-F primer <400> 20 acatatgacc aacatccgcg tagctatcgt gg 32 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> S-ddH-R primer <400> 21 actcgagcta aattagacgt cgcgtg 26 <210> 22 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> P-ddH-F primer <400> 22 ttaaactgac gattcaactt tataatcttt gaaataatag tgcttatccc gtctatttcg 60 ttcatccgaa tatcctcc 78 <210> 23 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> P-ddH-R primer <400> 23 gcggtatggc atgatagcgc ccggaagaga gtcaattcag ggtggtgaat gagctccaaa 60 aaacccctca agac 74 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S-ppc-F primer <400> 24 agacgacgaa aagcaaagcc cgagc 25 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> S-ppc-R primer <400> 25 gcagacagaa atatattgaa aacgagggtg 30 <210> 26 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> J23series-ppc-F primer <400> 26 agagnnnnnn gctagctcag tcctaggnnn nnngctagca gacgacgaaa agcaaagccc 60 gagc 64 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ppc-lib-R primer <400> 27 gcagacagaa atatattgaa aacgagggtg 30 <210> 28 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> D-ppc-F primer <400> 28 ccagtgccgc aataatgtcg gatgcgatac ttgcgcatct tatccgaccg ttagcccgtc 60 tgtcccaa 68 <210> 29 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> D-ppc-R primer <400> 29 gcagacagaa atatattgaa aacgagggtg ttagaacaga agtatcatac tcgctcttgg 60 gtcgg 65 <210> 30 <211> 144 <212> DNA <213> Artificial Sequence <220> <223> promoter of ppc gene <400> 30 agagttgtca gctagctcag tcctaggttc caggctagca gacgacgaaa agcaaagccc 60 gagcatattc gcgccaatgc gacgtgaagg atacagggct atcaaacgat aagatggggt 120 gtctggggta atatgaacga acaa 144 <210> 31 <211> 1191 <212> DNA <213> Artificial Sequence <220> <223> The TetA gene <400> 31 atgaaatcta acaatgcgct catcgtcatc ctcggcaccg tcaccctgga tgctgtaggc 60 ataggcttgg ttatgccggt actgccgggc ctcttgcggg atatcgtcca ttccgacagc 120 atcgccagtc actatggcgt gctgctagcg ctatatgcgt tgatgcaatt tctatgcgca 180 cccgttctcg gagcactgtc cgaccgcttt ggccgccgcc cagtcctgct cgcttcgcta 240 cttggagcca ctatcgacta cgcgatcatg gcgaccacac ccgtcctgtg gatcctctac 300 gccggacgca tcgtggccgg catcaccggc gccacaggtg cggttgctgg cgcctatatc 360 gccgacatca ccgatgggga agatcgggct cgccacttcg ggctcatgag cgcttgtttc 420 ggcgtgggta tggtggcagg ccccgtggcc gggggactgt tgggcgccat ctccttgcat 480 gcaccattcc ttgcggcggc ggtgctcaac ggcctcaacc tactactggg ctgcttccta 540 atgcaggagt cgcataaggg agagcgtcga ccgatgccct tgagagcctt caacccagtc 600 agctccttcc ggtgggcgcg gggcatgact atcgtcgccg cacttatgac tgtcttcttt 660 atcatgcaac tcgtaggaca ggtgccggca gcgctctggg tcattttcgg cgaggaccgc 720 tttcgctgga gcgcgacgat gatcggcctg tcgcttgcgg tattcggaat cttgcacgcc 780 ctcgctcaag ccttcgtcac tggtcccgcc accaaacgtt tcggcgagaa gcaggccatt 840 atcgccggca tggcggccga cgcgctgggc tacgtcttgc tggcgttcgc gacgcgaggc 900 tggatggcct tccccattat gattcttctc gcttccggcg gcatcgggat gcccgcgttg 960 caggccatgc tgtccaggca ggtagatgac gaccatcagg gacagcttca aggatcgctc 1020 gcggctctta ccagcctaac ttcgatcact ggaccgctga tcgtcacggc gatttatgcc 1080 gcctcggcga gcacatggaa cgggttggca tggattgtag gcgccgccct ataccttgtc 1140 tgcctccccg cgttgcgtcg cggtgcatgg agccgggcca cctcgacctg a 1191 <210> 32 <211> 1063 <212> DNA <213> Artificial Sequence <220> <223> ddh gene <400> 32 ggtaccttga cggctagctc agtcctaggt acagtgctag cgaccacaac ggtttccctc 60 tagaaataat tttgtttaac tttaagaagg agatatacat atgaccaaca tccgcgtagc 120 tatcgtgggc tacggaaacc tgggacgcag cgtcgaaaag cttattgcca agcagcccga 180 catggacctt gtaggaatct tctcgcgccg ggccaccctc gacacaaaga cgccagtctt 240 tgatgtcgcc gacgtggaca agcacgccga cgacgtggac gtgctgttcc tgtgcatggg 300 ctccgccacc gacatccctg agcaggcacc aaagttcgcg cagttcgcct gcaccgtaga 360 cacctacgac aaccaccgcg acatcccacg ccaccgccag gtcatgaacg aagccgccac 420 cgcagccggc aacgttgcac tggtctctac cggctgggat ccaggaatgt tctccatcaa 480 ccgcgtctac gcagcggcag tcttagccga gcaccagcag cacaccttct ggggcccagg 540 tttgtcacag ggccactccg atgctttgcg acgcatccct ggcgttcaaa aggcagtcca 600 gtacaccctc ccatccgaag acgccctgga aaaggcccgc cgcggcgaag ccggcgacct 660 taccggaaag caaacccaca agcgccaatg cttcgtggtt gccgacgcgg ccgatcacga 720 gcgcatcgaa aacgacatcc gcaccatgcc tgattacttc gttggctacg aagtcgaagt 780 caacttcatc gacgaagcaa ccttcgactc cgagcacacc ggcatgccac acggtggcca 840 cgtgattacc accggcgaca ccggtggctt caaccacacc gtggaataca tcctcaagct 900 ggaccgaaac ccagatttca ccgcttcctc acagatcgct ttcggtcgcg cagctcaccg 960 catgaagcag cagggccaaa gcggagcttt caccgtcctc gaagttgctc catacctgct 1020 ctccccagag aacttggacg atctgatcgc acgcgacgtc taa 1063 <210> 33 <211> 2652 <212> DNA <213> Artificial Sequence <220> <223> ppc gene <400> 33 atgaacgaac aatattccgc attgcgtagt aatgtcagta tgctcggcaa agtgctggga 60 gaaaccatca aggatgcgtt gggagaacac attcttgaac gcgtagaaac tatccgtaag 120 ttgtcgaaat cttcacgcgc tggcaatgat gctaaccgcc aggagttgct caccacctta 180 caaaatttgt cgaacgacga gctgctgccc gttgcgcgtg cgtttagtca gttcctgaac 240 ctggccaaca ccgccgagca ataccacagc atttcgccga aaggcgaagc tgccagcaac 300 ccggaagtga tcgcccgcac cctgcgtaaa ctgaaaaacc agccggaact gagcgaagac 360 accatcaaaa aagcagtgga atcgctgtcg ctggaactgg tcctcacggc tcacccaacc 420 gaaattaccc gtcgtacact gatccacaaa atggtggaag tgaacgcctg tttaaaacag 480 ctcgataaca aagatatcgc tgactacgaa cacaaccagc tgatgcgtcg cctgcgccag 540 ttgatcgccc agtcatggca taccgatgaa atccgtaagc tgcgtccaag cccggtagat 600 gaagccaaat ggggctttgc cgtagtggaa aacagcctgt ggcaaggcgt accaaattac 660 ctgcgcgaac tgaacgaaca actggaagag aacctcggct acaaactgcc cgtcgaattt 720 gttccggtcc gttttacttc gtggatgggc ggcgaccgcg acggcaaccc gaacgtcact 780 gccgatatca cccgccacgt cctgctactc agccgctgga aagccaccga tttgttcctg 840 aaagatattc aggtgctggt ttctgaactg tcgatggttg aagcgacccc tgaactgctg 900 gcgctggttg gcgaagaagg tgccgcagaa ccgtatcgct atctgatgaa aaacctgcgt 960 tctcgcctga tggcgacaca ggcatggctg gaagcgcgcc tgaaaggcga agaactgcca 1020 aaaccagaag gcctgctgac acaaaacgaa gaactgtggg aaccgctcta cgcttgctac 1080 cagtcacttc aggcgtgtgg catgggtatt atcgccaacg gcgatctgct cgacaccctg 1140 cgccgcgtga aatgtttcgg cgtaccgctg gtccgtattg atatccgtca ggagagcacg 1200 cgtcataccg aagcgctggg cgagctgacc cgctacctcg gtatcggcga ctacgaaagc 1260 tggtcagagg ccgacaaaca ggcgttcctg atccgcgaac tgaactccaa acgtccgctt 1320 ctgccgcgca actggcaacc aagcgccgaa acgcgcgaag tgctcgatac ctgccaggtg 1380 attgccgaag caccgcaagg ctccattgcc gcctacgtga tctcgatggc gaaaacgccg 1440 tccgacgtac tggctgtcca cctgctgctg aaagaagcgg gtatcgggtt tgcgatgccg 1500 gttgctccgc tgtttgaaac cctcgatgat ctgaacaacg ccaacgatgt catgacccag 1560 ctgctcaata ttgactggta tcgtggcctg attcagggca aacagatggt gatgattggc 1620 tattccgact cagcaaaaga tgcgggagtg atggcagctt cctgggcgca atatcaggca 1680 caggatgcat taatcaaaac ctgcgaaaaa gcgggtattg agctgacgtt gttccacggt 1740 cgcggcggtt ccattggtcg cggcggcgca cctgctcatg cggcgctgct gtcacaaccg 1800 ccaggaagcc tgaaaggcgg cctgcgcgta accgaacagg gcgagatgat ccgctttaaa 1860 tatggtctgc cagaaatcac cgtcagcagc ctgtcgcttt ataccggggc gattctggaa 1920 gccaacctgc tgccaccgcc ggagccgaaa gagagctggc gtcgcattat ggatgaactg 1980 tcagtcatct cctgcgatgt ctaccgcggc tacgtacgtg aaaacaaaga ttttgtgcct 2040 tacttccgct ccgctacgcc ggaacaagaa ctgggcaaac tgccgttggg ttcacgtccg 2100 gcgaaacgtc gcccaaccgg cggcgtcgag tcactacgcg ccattccgtg gatcttcgcc 2160 tggacgcaaa accgtctgat gctccccgcc tggctgggtg caggtacggc gctgcaaaaa 2220 gtggtcgaag acggcaaaca gagcgagctg gaggctatgt gccgcgattg gccattcttc 2280 tcgacgcgtc tcggcatgct ggagatggtc ttcgccaaag cagacctgtg gctggcggaa 2340 tactatgacc aacgcctggt agacaaagca ctgtggccgt taggtaaaga gttacgcaac 2400 ctgcaagaag aagacatcaa agtggtgctg gcgattgcca acgattccca tctgatggcc 2460 gatctgccgt ggattgcaga gtctattcag ctacggaata tttacaccga cccgctgaac 2520 gtattgcagg ccgagttgct gcaccgctcc cgccaggcag aaaaagaagg ccaggaaccg 2580 gatcctcgcg tcgaacaagc gttaatggtc actattgccg ggattgcggc aggtatgcgt 2640 aataccggct aa 2652

Claims (9)

라이신 리보스위치(riboswitch) 및 TetA 유전자를 포함하는, 라이신 고생산 균주 스크리닝용 벡터로서, 상기 라이신 리보스위치 유전자는 서열번호 1의 염기서열로 이루어지는 것을 특징으로 하는, 라이신 고생산 균주 스크리닝용 벡터.1. A lysine-producing strain screening vector, comprising a lysine riboswitch and a TetA gene, wherein the lysine riboswitch gene comprises the nucleotide sequence of SEQ ID NO: 1. 삭제delete 제 1 항에 있어서,
상기 TetA 유전자는 서열번호 31로 기재된 염기서열을 포함하는 것인, 라이신 고생산 균주 스크리닝용 벡터.
The method according to claim 1,
Wherein the TetA gene comprises the nucleotide sequence of SEQ ID NO: 31.
제 1 항에 있어서,
상기 라이신 고생산 균주 스크리닝용 벡터는 서열번호 11로 기재된 염기서열을 포함하는 것인, 라이신 고생산 균주 스크리닝용 벡터.
The method according to claim 1,
Wherein the lysine-producing strain screening vector comprises the nucleotide sequence shown in SEQ ID NO: 11.
제 1 항의 벡터로 형질전환 된, 대장균(Escherichia coli) KCTC12184BP.An Escherichia coli transformed with the vector of claim 1 coli KCTC12184BP. 균주 라이브러리에 라이신 리보스위치(riboswitch) 및 TetA 유전자를 포함하는 벡터를 형질전환 하는 단계; 및
상기 형질전환된 균주를 테트라마이신이 포함된 배지에서 배양하는 단계를 포함하는 라이신 고생산 균주를 스크리닝하는 방법으로서,
상기 라이신 리보스위치유전자는 서열번호 1의 염기서열로 이루어지는 것을 특징으로 하는, 라이신 고생산 균주를 스크리닝하는 방법.
Transforming a vector comprising a lysine riboswitch and a TetA gene into a strain library; And
A method for screening a lysine-producing strain comprising culturing the transformed strain in a culture medium containing tetramycin,
Wherein the lysine riboswitch gene comprises the nucleotide sequence of SEQ ID NO: 1.
균주 라이브러리에 라이신 리보스위치(riboswitch) 및 TetA 유전자를 포함하는 벡터를 형질전환 하는 단계; 및
상기 형질전환된 균주를 니켈이 포함된 배지에서 배양하는 단계를 포함하는 라이신 저생산 균주를 스크리닝하는 방법.
Transforming a vector comprising a lysine riboswitch and a TetA gene into a strain library; And
And culturing the transformed strain in a medium containing nickel.
서열번호 30의 염기서열로 이루어지는 프로모터 및 포스포에놀피루브산카르복실화효소(Phosphoenolpyruvate carboxylase, ppc) 유전자를 포함하는, 라이신 고생산용 벡터.A promoter comprising the nucleotide sequence of SEQ ID NO: 30, and a phosphoenolpyruvate carboxylase (ppc) gene. 제 8 항에 있어서,
상기 포스포에놀피루브산카르복실화효소 유전자는 서열번호 33의 염기서열로 이루어지는 것을 특징으로 하는, 라이신 고생산용 벡터.
9. The method of claim 8,
Wherein the phosphoenolpyruvate carboxylase gene is the nucleotide sequence of SEQ ID NO: 33.
KR1020120066007A 2012-06-20 2012-06-20 Method for Screening Microorganism with High Lysine Productivity Using Riboswitch KR101411716B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120066007A KR101411716B1 (en) 2012-06-20 2012-06-20 Method for Screening Microorganism with High Lysine Productivity Using Riboswitch

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120066007A KR101411716B1 (en) 2012-06-20 2012-06-20 Method for Screening Microorganism with High Lysine Productivity Using Riboswitch

Publications (2)

Publication Number Publication Date
KR20130142635A KR20130142635A (en) 2013-12-30
KR101411716B1 true KR101411716B1 (en) 2014-06-25

Family

ID=49986201

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120066007A KR101411716B1 (en) 2012-06-20 2012-06-20 Method for Screening Microorganism with High Lysine Productivity Using Riboswitch

Country Status (1)

Country Link
KR (1) KR101411716B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180038403A (en) * 2016-10-06 2018-04-16 포항공과대학교 산학협력단 Method for screening microorganism with high naringenin productivity using riboswitch

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021256582A1 (en) * 2020-06-17 2021-12-23 포항공과대학교 산학협력단 Biosensor for detecting tryptophan, comprising transcription activation factor and toehold switch

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GenBank Accession Number J01749.1 (2008.09.30.) *
양지나 등. 한국생물공학회 2011 춘계학술발표대회. 2011.04.14. 제출번호 0392. A artificial Enrichment System based on Riboswitch for High Lysine Producing Escherichia coli. *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180038403A (en) * 2016-10-06 2018-04-16 포항공과대학교 산학협력단 Method for screening microorganism with high naringenin productivity using riboswitch
KR101965355B1 (en) * 2016-10-06 2019-04-03 포항공과대학교 산학협력단 Method for screening microorganism with high naringenin productivity using riboswitch

Also Published As

Publication number Publication date
KR20130142635A (en) 2013-12-30

Similar Documents

Publication Publication Date Title
JP6609475B2 (en) A method for identifying a cell in which the intracellular concentration of a specific metabolite is increased compared to its wild type, wherein the modification of the cell is achieved by recombinant manipulation, as well as optimally producing the specific metabolite, Method for producing production cells genetically modified compared to wild type, method for producing this metabolite, and nucleic acid suitable therefor
CN112912496B (en) Novel mutations that increase the DNA cleavage activity of CPF1 of the genus amino acid coccus
CN113201535B (en) Mutant of glutamate dehydrogenase gene promoter and application thereof
Baltz Genetic methods and strategies for secondary metabolite yield improvement in actinomycetes
Chen et al. CRISPR/Cas9-facilitated engineering with growth-coupled and sensor-guided in vivo screening of enzyme variants for a more efficient chorismate pathway in E. coli
Prell et al. Adaptive laboratory evolution accelerated glutarate production by Corynebacterium glutamicum
WO2017044476A1 (en) Methods and compositions for recombinase-based genetic diversification
CN110741091A (en) Genome engineering of NADPH-increasing biosynthetic pathways
KR20210144816A (en) Methods for Construction of Chimeric Plasmid Libraries
DeBenedictis et al. Measuring the tolerance of the genetic code to altered codon size
Femmer et al. In vivo directed enzyme evolution in nanoliter reactors with antimetabolite selection
CN111849852A (en) Construction method of high-optical-purity L-lactic acid engineering bacteria
Srivastava et al. Gene expression systems in corynebacteria
KR101411716B1 (en) Method for Screening Microorganism with High Lysine Productivity Using Riboswitch
CN109666617A (en) The production bacterial strain and its construction method of a kind of L- homoserine and application
WO2014093402A2 (en) A synthetic transcription factor and uses thereof
Hill et al. Three different missense suppressor mutations affecting the tRNAGGGGly species of Escherichia coli
KR101500839B1 (en) Method for Screening Microorganism with High L-tryptophan Productivity Using Riboswitch
US11859172B2 (en) Programmable and portable CRISPR-Cas transcriptional activation in bacteria
Bott et al. Novel technologies for optimal strain breeding
WO2016159536A1 (en) Novel promoter and use for same
KR102683624B1 (en) Microorganisms with stabilized copy numbers of functional DNA sequences and related methods
CN113677795B (en) Novel DAHP synthetase
WO2020081958A2 (en) Compositions and methods for identifying mutations of genes of multi-gene systems having improved function
WO2020036181A1 (en) Method for isolating or identifying cell, and cell mass

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
LAPS Lapse due to unpaid annual fee