KR101411716B1 - Method for Screening Microorganism with High Lysine Productivity Using Riboswitch - Google Patents

Abstract

More particularly, the present invention relates to a lysine riboswitch and a vector for screening a lysine-producing strain containing the TetA gene, a screening method using the riboswitch, and the like. The riboswitch of the present invention and the method of screening the lysine supernatant using the riboswitch of the present invention can sort the strain producing lysine at a high concentration relatively quickly and easily and thereby increase the price competitiveness of the tryptophan production using the microorganism have.

Description

[0001] The present invention relates to a method for screening microorganisms with high lysine productivity using riboswitches,

More particularly, the present invention relates to a lysine riboswitch and a vector for screening a lysine-producing strain containing the TetA gene, a screening method using the riboswitch, and the like.

In order to increase the price competitiveness of the method for producing metabolites using microorganisms, the strain has been continuously developed. Traditional and effective approaches to the development of strains consist of a step of generating a strain library based on the production strain and then screening the improved strains in the library. One example is the development of a monosodium glutamate (MSG) producing strain that has been converted to a fermentation process using microorganisms in the 1960s extraction method.

Previously, chemical mutagenesis, such as UV irradiation and addition of chemical mutagens such as NTG (nitrosoguanidine), was used to generate a library of strains. In the modern age of accumulation of molecular biology tools and biochemical knowledge, genome shuffling through genetic shuffling through protoplast fusion, transposon mutagenesis based on polymerase chain reaction (PCR) ), And random insertion using a variety of strains. As the size of the strain library becomes larger, the possibility that a target metabolite hyperpolarizing organism is contained therein becomes higher. Therefore, a strain library can be produced by using the aforementioned library preparation method in multiple ways.

Purpose of the strain Various assays are used to determine the metabolite productivity. Liquid / gas chromatography (LC / GC) is a method of culturing individual strains and then analyzing the culture medium and the metabolite concentration in the strain. This method is capable of detecting most metabolites and quantitative analysis if a standard calibration curve can be obtained. However, throughput is low because it can be measured only for one mutation strain at a time, which is inefficient for analyzing a library of strains larger than a certain size.

Metabolite analysis using multiwell plates is performed by introducing the mutant strains into wells and measuring changes in color, absorbance, and fluorescence of a small sample to determine the concentration of metabolites in the sample It is a method of analysis. Since a small amount of sample is used and a multi-plate is used, a relatively large number of mutation strains can be simultaneously analyzed. However, the ability to analyze large-scale strain libraries made by the above described methods of production is poor. In addition, the application range is narrow because it can be applied only to a metabolite capable of performing a color reaction with a metabolite as a substrate or measuring a change in absorbance or fluorescence.

A method for screening production strains using a genetic biosensor is performed by converting the concentration of the synthesized target metabolite into an immediately detectable signal. If a specific biosensor is developed and applied to a target metabolite, a suitable detector can be used to observe the concentration change of the target metabolite which can not be visually detected.

The fluorescence activated cell sorting (FACS) technique detects the fluorescence emitted from an individual strain while passing the mutant strain to the detector. The ability to process large volumes of cells at the same time and detect fluorescence very quickly yields a throughput of more than 10 ⁹ . When a target metabolite fluoresces, it is possible to analyze a large library relatively quickly and easily, thereby efficiently screening the host bacteria. However, there is a limitation in that it can be applied only to metabolites that exhibit fluorescence.

Finally, a selection method can be used. This is a technique that allows only strains that produce high concentrations of the desired metabolite in the library of strains to survive. This method is very high throughput and can effectively isolate high yield strains from large strain libraries. However, this technique can only be applied if the concentration of the target metabolite is involved in the growth or survival of the strain.

On the other hand, riboswitches are biosensor sensors that detect the concentration of a specific metabolite in a cell and regulate the expression level of a downstream gene. The riboswitch has a very high substrate specificity and substrate affinity. Techniques have also been developed to generate an aptamer that binds to a specific metabolite using SELEX (Systematic Evolution of Ligand by Exponential Enrichment) technology, and to make a rib switch based on the generated aptamer. Therefore, we can develop riboswitches that regulate the expression level of downstream genes by recognizing only specific metabolites that we want to screen.

When the selectable marker gene is inserted downstream of the thus-developed riboswitch, an RNA device capable of regulating the expression of the selectable marker gene can be obtained according to the concentration of the target metabolite. When the RNA device is introduced into the strain library generated by various methods, the expression level of the selectable marker gene varies depending on the concentration of the target metabolite in each strain. At this time, when the candidate strain transformed with the artificial selection circuit is exposed to a suitable selection pressure corresponding to the selectable marker gene of the RNA device, only the strain producing the desired metabolite at high concentration will survive.

In order to solve the problems of the prior art as described above, the present invention aims to develop a screening technique which can be applied to various target metabolites and has a high throughput. To this end, the present invention provides a riboswitch for screening of a lysine-producing strain. It is another object of the present invention to provide a method for effectively screening for a lysine-producing strain using the riboswitch.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

The present invention provides a lysine high production strain screening vector comprising a lysine riboswitch and a TetA gene.

In the present invention, the lysine riboswitch is preferably represented by SEQ ID NO: 1, but is not limited thereto.

In the present invention, the TetA gene is preferably represented by SEQ ID NO: 31, but is not limited thereto.

In the present invention, the lysine-producing strain screening vector is preferably represented by SEQ ID NO: 11, but is not limited thereto.

The present invention provides a strain transformed with a lysine high production strain screening vector comprising a lysine riboswitch and a TetA gene. The transformant strain is characterized by being the accession number KCTC 12184BP. There is no limitation on the kind of the strain. It is preferably Escherichia coli.

The present invention also provides a method for producing a lysine-producing strain, which comprises the steps of: transforming a strain library with a vector containing a lysine riboswitch and a TetA gene; and culturing the transformed strain in a medium containing tetramycin A screening method is provided.

The present invention relates to a method for screening a lysine producing strain comprising a step of transforming a strain library into a vector containing a lysine riboswitch and a TetA gene and culturing the transformed strain in a medium containing nickel ≪ / RTI >

In addition, the present invention provides a vector for lysine alpaca production comprising a promoter consisting of the nucleotide sequence of SEQ ID NO: 30 and a ppc gene.

In one embodiment of the present invention, the ppc gene is characterized in that it is composed of the nucleotide sequence of SEQ ID NO: 33.

The riboswitch of the present invention and the method of screening the lysine-producing strain of the present invention can select the strains producing the lysine at a high concentration relatively quickly and easily, and can increase the price competitiveness of the lysine production using the microorganism have.

1 is a schematic diagram illustrating a method of manufacturing a reporter system according to an embodiment of the present invention.
FIG. 2 is a schematic diagram showing a gene recombination method for producing a relatively lysine-producing strain according to an embodiment of the present invention.
FIG. 3 shows the result of analyzing the change of the non-fluorescence value of the strain according to lysine productivity.
FIG. 4 is a graph illustrating the results of measurement of growth rates of nickel and tetracycline selection pressures of strains with different lysine productivity inserted into an artificial selection circuit according to an embodiment of the present invention.
FIG. 5 is a schematic diagram showing a method of replacing a promoter of genes on a synthetic pathway to produce a high-yield producing strain according to an embodiment of the present invention.
FIG. 6 is a schematic diagram illustrating a method of introducing a ddh gene of Corynebacterium glutamicum to produce a high-yield producing strain according to an embodiment of the present invention.
FIG. 7 is a schematic diagram showing a method for enhancing competitive metabolism in order to produce a high-yield producing strain according to an embodiment of the present invention.
FIG. 8 shows the results of measurement of the growth rate of W3110 and W3110_ME with artificial selection circuit plasmid (pACYC_ribo_TetA) when 0.8 mM nickel was added in the enhanced M9 medium.
FIG. 9 shows the results of observing the growth rate of W3110 / pACYC_ribo_TetA and W3110_ME / pACYC_ribo_TetA according to an embodiment of the present invention when tetracycline is selected as a selective pressure.
FIG. 10 shows the result of PCR confirming whether the selection circuit of the present invention was operated when the strain was mixed.
11 is a schematic diagram showing a process of generating a library in which the amount of ppc expression is different.
FIG. 12 is a result of analyzing lysine accumulation amount higher than W3110_ME / pCDF_Duet, which is a strain before the lysine accumulation amount of W3110_MEΔppc / pCDF_F0.3ppc, which is a mutagens mutant according to an embodiment of the present invention, is libraryed.
FIG. 13 shows the ribo_sGFP gene sequence. In FIG. 13, red indicates a restriction site, blue indicates a promoter sequence, green indicates lysC 5'UTR, and the other indicates a sgfp gene and a terminator.
Fig. 14 shows the ribo_TetA gene sequence. In the figure, red indicates a restriction enzyme site, blue indicates a promoter sequence, green indicates lysC 5'UTR, and the other part indicates a TetA gene and a terminator.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

The LA-Taq polymerase, Phusion polymerase and restriction enzymes used in the present invention were purchased from TaKaRa and New England Biolabs, respectively. pACYC_ribo_TetA, pACYC_ribo_sgf and the pACYC_Duet and pCDF_Duet vectors used to construct the promoter library were purchased from Novagen, and oligonucleotides were synthesized in Genotech. In addition, all the materials for culturing were purchased from Sigma.

Example  1. Production of reporter system

First, the lysine riboswitch of SEQ ID NO: 1 was amplified using the E. coli chromosome as a template, and ribo_sGFP was constructed by overlap PCR with the sGFP gene. The primers used for the amplification of the riboswitches are shown in SEQ ID NO: 2 (P_ribo-F) and SEQ ID NO: 3 (ribo-B), the primers used for sGFP amplification are SEQ ID NO: 4 (ribo-sgfp-F) No. 5 (sgfp-R). Riboswitch and sGFP amplification PCR conditions were performed for 30 min at 98 ° C, 30 sec at 90 ° C for 10 sec, 30 sec at 60 ° C, 1 min / kb at 72 ° C, and 5 min at 72 ° C. Phusion polymerase Respectively.

(SEQ ID NO: 6: KpnI-PF, SEQ ID NO: 7: SacI-vec-R), which promotes the expression of ribo_sGFP continuously, and then amplified the sGFP gene by PCR And cloned into the pACYC_Duet vector using KpnI and SacI sites. Specifically, the overlap PCR was performed by mixing the lysC 5'UTR and the gfp amplification product without the primer, followed by 1 minute at 95 ° C (30 seconds at 95 ° C, 30 seconds at 64 ° C, 1 minute / kb at 72 ° C) Primer (95 ° C for 30 seconds, 64 ° C for 30 seconds, 72 ° C for 1 minute / kb) × 25 cycles, and 72 ° C for 5 minutes. A schematic diagram of the above experiment is shown briefly in FIG.

Example  2. Genetic recombination for production of relative lysine-producing strains

In order to produce a relatively lysine-producing strain, lysC is removed in a step involving three isozymes ( thrA , metL , lysC ) among the enzymes in the lysine synthesis pathway to produce a lysine-producing strain inhibited flow to the lysine synthesis pathway , The Red / ET gene recombination system was used. Escherichia After coli K12 W3110 was transformed with pKD46, a competent cell expressing Red recombinase was prepared. In order to prepare a gene-removing PCR product (FRT_neo_FRT) having an overhang of the contiguous sequence with the adjacent sequence of the lysC gene, the FRT_neo_FRT region of the pKD4 variant was used as a template and the sequence of SEQ ID NO: 8 (D- lysC-F) and SEQ ID NO: 9 (D-lysC-R). The PCR conditions were the same as those for the riboswitch amplification of Example 1 above. This PCR amplification product replaces the lysC region by a red-recombination mechanism. The amplified FRT_neo_FRT was purified on an agarose gel and precipitated and concentrated in ethanol. The PCR product was electroporated and then selected on LB plate containing kanamycin (Luria-Bertani plate). The resulting colonies express the FLP (DNA flipase) of the pCP20 plasmid to remove the kanamycin resistance gene and sequenced the selected recombinant region. Finally, the removal of the lysC gene was confirmed. A schematic schematic diagram of the experiment is shown briefly in FIG.

Example  3. Measurement of fluorescence and growth rate by different strains of lysine productivity

The pACYC_ribo_sGFP prepared in Example 1 was transformed into W3110 and W3110? LysC prepared in Example 2, and the fluorescence and the growth rate of pACYC_Duet having different lysine productivity were measured by using pACYC_Duet as a control group . First, a seed was prepared by culturing for 12 hours or longer in an enhanced M9 medium (amino acid supplemented with an amino acid other than lysine) containing 34 μg / ml chloramphenicol for vector maintenance. The cells were harvested, washed, diluted to a new medium with an OD600 of 0.05, and then cultured for 5 hours until OD600 reached about 0.8. The prepared seeds were inoculated in 4 ml of the medium to an OD600 of 0.05, and non-fluorescence values were measured at intervals of 2 hours. Fluorescence was measured using a VICTOR3TM 1420 multilabel counter (PerkinElmer) after transferring the cultures to a 96-well fluorescent assay plate.

Specifically, when the change in the non-fluorescence value due to the difference in lysine production amount is present on the pACYC_Duet vector under the selected J23100 promoter, the lysC 5 'UTR senses the lysine concentration in the cell and controls the expression amount of sGFP, Respectively. The results of analyzing the change of the non-fluorescence value indicated by pACYC_ribo_sGFP in W3110 and W3110? LysC are shown in Fig.

The experimental results in Fig. 3 show that W3110 / pACYC_ribo_sGFP (black lane: lysine high producing strain) and W3110? LysC / pACYC_ribo_sGFP (white source: lysine low producing strain) were cultured in the enhanced M9 medium containing chloramphenicol The non-fluorescence values are shown at intervals of 2 hours. The X axis represents the incubation time and the Y axis represents the change in the ratio of the non-fluorescent value. The non-fluorescence value is a value obtained by dividing the measured fluorescence value by the OD600 value, and the ratio change of the non-fluorescence value is a value obtained by dividing the non-fluorescence value appearing at each time by the non-fluorescence value at the second time. The error values are expressed as SD values. As shown in FIG. 3, since the expression level of sGFP was higher in W3110? LysC with a relatively low lysine production amount, it was confirmed that the fluorescence value was greatly increased.

Example  4. Due to the construction of the artificial selection circuit and the difference in lysine production TetA Modulation of

The artificial selection circuit plasmid (pACYC_ribo_TetA) was produced by replacing the reporter gene of pACYC_ribo_sGFP, sGFP, with pTB322-derived TetA, to induce a change in non-growth rate by lysine concentration. J23100-ribo-TetA was amplified by PCR and cloned into the J23100-ribo-sGFP site of pACYC_ribo_sGFP.

Specifically, the tetA gene was amplified using primers of SEQ ID NO: 12 (ribo-tetA-F) and SEQ ID NO: 13 (tetA-R) as a template, and the tetA amplification product and lysC 5'UTR were amplified using the pBR322 plasmid as a template Ribo-tetA (SEQ ID NO: 11) was constructed by overlap PCR using primers of SEQ ID NO: 6 (KpnI-PF) and SEQ ID NO: 13 (tetA-R). The PCR conditions were the same as the ribo-sgfp construction conditions of Example 1 above. The amplified product was inserted into pACYCDuet vector using KpnI and SacI restriction enzyme sites.

Since the TetA protein is involved in both resistance to tetracycline and sensitivity to nickel, it is possible to selectively isolate a desired strain by using the expression pressure of TetA depending on the concentration of lysine have. Specifically, when the tetA gene is expressed, the tetA protein migrates to the cell membrane to release the tetracycline inside the cell to the outside, which causes the cell to become resistant to tetracycline. However, when the tetA gene is overexpressed, the cells are killed by nickel ions. Using the properties of the tetA gene as described above, it is possible to select a cell having a plasmid in which tetA is highly expressed when the concentration of lysine in the cell is high and is not expressed when the concentration of lysine is low.

The artificial selection circuit plasmid (pACYC_ribo_TetA) was transformed into W3110 and W3110? LysC of two strains with different lysine production amounts, and the growth rate was observed in each of the culture medium with tetracycline as the selective pressure and the culture medium with the nickel as the selective pressure. The amount of TetA expression was regulated by the difference in the expression level of TetA. For vector maintenance, the cells were cultured in M9 medium containing chloramphenicol. The concentration of nickel used was 0.1 mM and the concentration of tetracycline was 60 μg / ml. The non-growth rate was calculated by the OD600 value for 12 hours, which is shown in FIG. In Fig. 4, the Y axis represents the non-growth rate [h-1].

As shown in FIG. 4, in the case of the lysC 5'UTR lysine riboswitch inhibiting the expression by lysine, the expression of TetA was inhibited in W3110, which is a relatively high lysine-producing strain, and tetracycline was sensitive to tetracycline, It was confirmed that the used nickel concentration had resistance to nickel. Using the artificial selection circuit plasmid (pACYC_ribo_TetA) for the currently constructed lysine through the above results, it was found that the lysine-producing strain was inhibited in the expression of TetA and was relatively resistant to nickel, .

Example  5. High yield Production strains  Metabolic Engineering

5-1. Synthetic route  Promoter replacement of genes

The promoters of dapA, dapB, and lysA in the lysine synthesis pathway were replaced with the J23100 promoter using Red / ET recombination technology using PCR.

For this purpose, the FRT_neo_FRT-J23100 fragment was amplified with a primer containing an upstream sequence to recombine with the promoter. The PCR conditions were the same as in Example 2, but the template was pGEM-FRT-neo-FRT-Pc-sgfp and the pKD4 variant in which the J23100 promoter was contained in the template was used. The primers used for the dapA promoter replacement were SEQ ID NO: 14 (P-dapA-F) and SEQ ID NO: 15 (P-dapA-R) ) And SEQ ID NO: 17 (P-dapB-R), the primers used for lysA promoter replacement were used as SEQ ID NO: 18 (P-lysA-F) and SEQ ID NO: 19 (P-lysA-R). The PCR amplification product was purified, concentrated, and electroporated into a strain having a lambda recombinase expressed in pKD46. The recombinant strains were screened by a medium containing kanamycin and the promoter changes at target sites were confirmed by colony PCR. The kanamycin resistance gene was then removed using the pCP20 vector flip phase, and finally the sequence of the replaced promoter was confirmed by DNA sequencing. A schematic schematic diagram of the experiment of this embodiment is shown briefly in Fig.

5-2. Aspartokinase Remove feedback control from

The lysC gene without the feedback control prepared in 5-1) was inserted into the chromosome of W3110 strain using Red / ET recombination system. The PCR fragments used were those in which the feedback control of aspartokinase was eliminated using FRT_neo_FRT and site-specific mutagenesis, and the lysC gene, in which the UTR was replaced and the control in the translation step was eliminated, was used as the template and W3110 Was inserted at the position of the lysC gene of the chromosome.

5-3. Corynebacterium Glutamicum ( Corynebacterium glutamicum )of ddh  Gene introduction

To reduce the enzymatic step from THDP, the ddh gene (SEQ ID NO: 32) was inserted into the lac operon site on the chromosome using the Red / ET recombination system. The PCR fragment was primed with pGEM_FRT_neo_FRT_Pc_ddh as a template using a primer containing a sequence identical to the upstream and downstream of the lac operon at the end of the fragment. The PCR conditions were the same as in Example 2, and the template was corynebacterium The glutamicum colonies were boiled at 95 ° C for 10 minutes and then added with 0.5ul in 50ul PCR. ddh-F) and SEQ ID NO: 21 (S-ddh-R), the primer for amplification of the recombinant fragment (FRT_neo_FRT_Pc_ddh) comprises SEQ ID NO: 22 (P- 23 (P-ddh-R). C. glutamicum for the template The ddh amplified from the chromosome was cloned using NdeI and XhoI restriction enzymes. A schematic schematic diagram of the experiment of this embodiment is briefly shown in Fig.

5-4. Elimination of Competitive Ambassadors

The metL and thrA genes on W3110 chromosomes were removed by the one-step gene deletion method using the Red / ET recombination system. The recombinant method was the same as those of Examples 5-1 to 5-3, except that the FRT_neo_FRT fragment was used without a promoter sequence or a foreign gene. Through this, a lysine - producing strain, W3110_ME, which enhanced lysine productivity, was produced. A schematic schematic diagram of the experiment of this embodiment is shown briefly in Fig.

Example  6. Growth rate analysis in nickel-containing media depending on lysine productivity

In order to confirm that the riboswitches inhibit TetA expression by accumulation of lysine in the lysine-producing strain, the strain W3110, which is a relatively lysine-producing strain, and the lysine- The non-growth rate change was observed after transformation of the selection circuit plasmid (pACYC_ribo_TetA) into the production strain W3110_ME.

3 ml each of W3110 / pACYC_ribo_TetA and W3110_ME / pACYC_ribo_TetA were incubated with 34 μg / ml chloramphenicol for enhanced plasmid maintenance in enhanced M9 medium (all amino acids except lysine). The seeds were inoculated on a new M9 medium to an OD600 of 0.2 and cultured for 5 hours to prepare seeds. The prepared seeds were diluted to a M9 medium (3 ml or 0.25 ml Bioscreen C) to an OD600 of 0.03, and then the NiCl ₂ concentration was changed to 0, 0.4, and 0.8 mM for 16 hours. On the other hand, non-growth rate was observed under the same conditions (pACYC_ribo_sGFP) by replacing TetA with sGFP (fluorescent protein) as a control group to confirm that the change of non-growth rate was due to the change of TetA expression amount of the artificial selection circuit plasmid. 8. Figure 8 shows the growth rate of W3110, W3110_ME with artificial selection circuit plasmid (pACYC_ribo_TetA) when 0.8 mM nickel was added in the enhanced M9 medium. The Y axis represents the rate of non-growth and [h-1] the strain indicated by each bar is shown in the legend. The non-growth rate was calculated using the OD600 readings obtained for 12 hours at each culture condition.

As shown in FIG. 8, it was confirmed that the non-growth rate of the lysine-producing strain was fast in the selection circuit when nickel was applied at the selective pressure. When sGFP not involved in nickel sensitivity was regulated by riboswitch, there was little change in nickel sensitivity according to lysine productivity. However, in the case of an artificial selection circuit plasmid in which TetA, which varies sensitivity to nickel depending on the expression level, is controlled by a riboswitch, the expression of TetA is suppressed in a lysine-producing strain, so that sensitivity to nickel is low, And for relative lysine-producing strains, NiCl ₂ The sensitivity of TetA to Ni was 0.8 mM.

Example  7. Lysine due to the selection circuit Of high producing strains On tetracycline  Sensitivity increase analysis

In order to confirm the suppression of TetA gene expression more directly in the lysine-producing strain, an artificial selection circuit plasmid (pACYC_ribo_TetA) was transformed into W3110, a relative lysine-producing strain and W3110_ME, The growth rate was monitored in the enhanced M9 medium (with all amino acids except lysine). Because the lysine accumulation concentration is high, the lysine-induced pathogen is inhibited by riboswitching and TetA expression should be negative for tetracycline. The results of observing the non-growth rate when tetracycline is applied to W3110 / pACYC_ribo_TetA and W3110_ME / pACYC_ribo_TetA are shown in FIG. In Fig. 9, the Y axis represents the non-growth rate. [H-1] Whether the strain indicated by each rod and the addition of antibiotics is indicated in the legend. The non-growth rate was calculated using the OD600 readings obtained for 12 hours at each culture condition.

As shown in Fig. 9, it was confirmed that the non-growth rate of W3110_ME / pACYC_ribo_TetA, which is a host of lysine-resistant bacteria, was inhibited more than the lysine-producing strain W3110 / pACYC_ribo_TetA. This is because the lysine accumulation of the lysine-producing strain is high, so that the expression of TetA is inhibited by the lysine riboswitch in the selection circuit and the growth is inhibited by the tetracycline-containing medium due to inhibition of TetA expression.

Example  8. Operation of the selection circuit when culturing the strain

In order to investigate whether a lysine-producing strain can be isolated from a production strain's library by using the selectivity of the selection circuit when using the method of improving the strain by an actual combinatorial approach, a strain in which the population is dominant by mixing with the strain is cultured Respectively. Plasmid (pACYC_ribo_TetA) and a plasmid (pACYC_ribo_sGFP) expressing the fluorescent protein as a negative control were transformed into W3110 and W3110_ME, and cultured in the enhanced M9 medium to observe which strain was predominantly grown. Nickel 0.8 mM was used as the selective pressure, and dominant strains were identified at 8 hour intervals. The identification of the strains was confirmed by PCR for the iclR region with different gene length when PCR was performed in W3110 and W3110_ME. In the case of W3110_ME, the length of the amplified DNA fragment in the target region is short due to the removal of iclR. The experimental results are shown in Fig.

10 shows the case where pACYC_ribo_sGFP is used as a negative control group lacking the TetA gene in each lane shown in FIG. 10, and ET represents pACYC_ribo_TetA which is a rapid selection circuit plasmid. As the time passes, the band of the label of the lysine-producing strain becomes thicker, and the predominant growth of the lysine-producing strain can be confirmed from this. On the other hand, in the negative control group, it can be seen that selective separation of the strain did not occur when nickel was selected as the selective pressure.

On the other hand, unlike the negative control (strain transformed with pACYC_ribo_sGFP) in which both strains were grown even when nickel was contained, it was confirmed that lysine-producing strains predominated in the medium in which nickel was the selective pressure when the selection circuit plasmid was used I could. From the above results, it was confirmed that, when cultured with nickel at a selective pressure between strains having a selection circuit plasmid, the selectivity for lysine - resistant strains was confirmed.

Example  9. Enrichment from library

9-1. ppc  Generation of expression level library

The phosphoenol pyruvate carboxylase (ppc) gene has been shown to inhibit the anaplerosis of oxaloacetate, a precursor of lysine, through the carboxyl oxidation of phosphoenolpyruvate (PEP) I am responsible. On the other hand, PEP should be converted to pyruvate which is the precursor of the TCA cycle, the energy metabolism of the strain, so that the two reactions must be balanced. For this purpose, analysis of ppc expression level is carried out in silico, but there is no successful case in which the optimum expression level is realized in the improvement of strain. Therefore, in the present invention, a plasmid producing strain library having various amounts of ppc expression was prepared using a randomized promoter, and an optimized expression amount was selected as a target enzyme to be searched using an artificial selection circuit.

Specifically, to construct pCDF_ppc, the ppc gene (SEQ ID NO: 33) on the E. coli chromosome was amplified and cloned into a pCDF_Duet vector using KpnI and SacI restriction enzymes. The PCR conditions used for the amplification of ppc were the same as those in Example 2. The W3110 colonies were boiled at 95 ° C for 10 minutes, and 0.5 μL was added in 50 μl PCR. The primer sequences used for ppc amplification are shown in SEQ ID NO: 24 (S-ppc-F) and SEQ ID NO: 25 (S-ppc-R).

In order to construct a plasmid library with various promoter sequences of the ppc gene, a random sequence promoter overhang ppc PCR was performed. The primers used were shown in SEQ ID NO: 26 (J23series-ppc-F) and SEQ ID NO: 27 (ppc-lib-R), and SEQ ID NO: 28 (D-ppc-F) The sequence shown in SEQ ID NO: 29 (D-ppc-R), in which the -35 box and -10 box regions of the promoter were randomized, was inserted into the overhang, followed by the addition of phosphate at the 5 'end. The PCR conditions were the same as those in Example 1, and the PCR products were GeneAll Expin ^TM PCRSV PCR purification kit, and the template was removed by DpnI treatment and T4 ligation was performed.

The ligation mixture was transformed into E. coli MegaX DH10BTM and the plasmid was screened using a medium containing streptomycin for selection of the pCDF_Duet vector. After 12 hours, the strain on the plate was harvested and the pCDF_J23series_ppc library in which the ppc gene promoter was varied was harvested and the production strain library was generated by transforming the ppc gene on the chromosome to the W3110_MEΔppc strain.

The primer sequence used in the amplification of FRT_neo_FRT is shown in SEQ ID NO: 28 (D-ppc-F) and SEQ ID NO: 29 (D-ppc-R) in the same manner as in Example 2, except that the ppc gene on the chromosome was removed. .

Fig. 11 shows a library generation process in which the amount of ppc expression is different. The ppc gene was cloned into a pCDF_Duet vector without a promoter, and PCR was performed using a primer having an overhang as a template and a randomized promoter. When the PCR product is ligated, the pCDFJSeries_ppc vector library is generated.

9-2. Production strain  Artificial selection circuit for screening lysine-producing strains from the library

The production strain library with different amounts of ppc expression was harvested from the plate and then washed twice with M9 medium. The washed production strain library was diluted in M9 medium supplemented to an OD600 of 0.1. After incubation for 12 h at the selected NiCl ₂ concentration, the same NiCl ₂ The cells were diluted to an OD600 of 0.05 in the newly supplemented M9 medium to which the concentration was added and then cultured for 12 hours. This serial dilution and incubation procedure was repeated three times.

9-3. Selective isolation of lysine-producing strains using selective circuit and promoter sequence analysis for optimal expression of ppc

In order to find a promoter showing the amount of ppc gene expression optimized for lysine production between the TCA cycle (TCA cycle) and oxalacetate (anaplerosis), the PEP flow was set to W3110_MEΔppc with the selection circuit plasmid pCDF_J23series_ppc And nickel was used as a selective pressure, streaked on stiffened M9 medium containing streptomycin, and cultured at 37 ° C. The nickel selection pressure was selected between the W3110_ME / pACYC_ribo_sGFP and the minima inhibitory concentration of W3110_ME / pACYC_ribo_TetA by judging that the strain containing pACYC_ribo_sGFP was suppressed to all TetA gene expression of the selection circuit plasmid.

For selective isolation of the lysine-producing strain, mutants predominantly through three rounds of dilution and incubation were single colonized on the plate. Four colonies of the grown colonies were selected and cultured in LB medium (Luria-Bertani medium) containing streptomycin. Then, the plasmid for ppc expression was extracted and the promoter sequence of the ppc gene of the cultivated strain was obtained (Solgent, Daejeon). Two of the four promoter sequences were the same (SEQ ID NO: 30) and were shown as follows. Among the underlined parts, TTGTCAG is the randomized -35 box area, TTCCAG is the -10 box area, and ATG is the starting codon.

AGAG TTGTCA GCTAGCTCAGTCCTAGG TTCCAG GCTAGCAGACGACGAAAAGCAAAGCCCGAGCATATTCGCGCCAATGCGACGTGAAGGATACAGGGCTATCAAACGATAAGATGGGGTGTCTGGGGTAAT ATG AACGAACAA (SEQ ID NO: 30)

The lysine accumulation amount and the glucose consumption amount of W3110_ME were compared with strains having a plasmid containing the promoter shown in SEQ ID NO: 30. It was confirmed that lysine accumulation of the mutant strain W3110_MEΔppc / pCDF_F0.3ppc showed higher lysine accumulation than the strain W3110_ME / pCDF_Duet before the library was obtained, and the results are shown in FIG. Each strain was cultured in stiffened M9 medium containing streptomycin. In the case of W3110_ME, the strain expressing the ppc gene on the chromosome was transformed into pCDF_Duet vector for use as a control.

9-4. Growth analysis in nickel-containing medium

W3110_ME / pCDF_Duet and W3110_MEΔppc / pCDF_F0.3ppc transformed with pACYC_ribo_TetA were incubated with 3 ml of the supplemented M9 medium with antibiotics for vector maintenance. The seeds were inoculated on a new M9 medium supplemented with OD600 of 0.2 and cultured for 5 hours to prepare seeds. Prepared seeds were diluted in M9 medium (3 ml or 5 ml of Bioscreen C) to an OD600 of 0.03 and cultured for 16 hours at different concentrations of NiCl ₂ (0 to 2.0 mM, 0.5 mM intervals).

9-5. ppc  Changes in lysine accumulation with changes in expression level

W3110_ME / pCDF_Duet and W3110_MEΔppc / pCDF_F0.3ppc were inoculated in the supplemented M9 medium with antibiotics for vector maintenance, diluted to an OD600 of 0.1 in fresh medium, and cultured for 7 hours. For the lysine assay, 300 ml flasks were used and 30 ml of the supplemented M9 medium was inoculated to an initial OD600 of 0.05, followed by incubation at 37 ° C and 200 rpm for a total of 20 hours. The amount of OD600 and remaining glucose and the amount of lysine accumulated in the medium were measured by HPLC every 2 hours. The results are shown in Fig.

As shown in FIG. 12, it was confirmed that the lysine accumulation amount of the mutant strain W3110_MEΔppc / pCDF_F0.3ppc showed a higher lysine accumulation than the strain W3110_ME / pCDF_Duet before being libraryed.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Korea Biotechnology Research Institute KCTC12184BP 20120405

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Method for Screening Microorganism with High Lysine Productivity          Using Riboswitch <130> PB11-09889 <160> 33 <170> Kopatentin 2.0 <210> 1 <211> 306 <212> DNA <213> Artificial Sequence <220> <223> Lysine riboswitch <400> 1 gtactacctg cgctagcgca ggccagaaga ggcgcgttgc ccaagtaacg gtgttggagg 60 agccagtcct gtgataacac ctgagggggt gcatcgccga ggtgattgaa cggctggcca 120 cgttcatcat cggctacagg ggctgaatcc cctgggttgt caccagaagc gttcgcagtc 180 gggcgtttcg caagtggtgg agcacttctg ggtgaaaata gtagcgaagt atcgctctgc 240 gcccacccgt cttccgctct tcccttgtgc caaggctgaa aatggatccc ctgacacgag 300 gtagtt 306 <210> 2 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> P_ribo-F primer <400> 2 attgacggct agctcagtcc taggtacagt gctagcgtac tacctgcgct agcgca 56 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ribo-B primer <400> 3 aactacctcg tgtcagggga tccat 25 <210> 4 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> ribo-sgfp-F primer <400> 4 ctcttccctt gtgccaaggc tgaaaatgga tcccctgaca cgaggtagtt atggctagca 60 agggcgagga gctgt 75 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> sgfp-R primer <400> 5 acaaaaaacc cctcaagacc cgtttagagg c 31 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> KpnI-P-F primer <400> 6 aggtaccttg acggctagct cagtcctagg tacagtg 37 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> SacI-vec-R primer <400> 7 agagctcgtg gccaggaccc aacgctgccc ga 32 <210> 8 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> D-lysC-F primer <400> 8 gactttggaa gattgtagcg ccagtcacag aaaaatgtga tggttttagt gcgatgcctc 60 atccgcttct c 71 <210> 9 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D-lysC-R primer <400> 9 gacaagaaaa tcaatacggc ccgaaatata gcttccaggc catacagtat gcaacgcagt 60 agctggagtc 70 <210> 10 <211> 1112 <212> DNA <213> Artificial Sequence <220> <223> ribo_sGFP <400> 10 ggtaccttga cggctagctc agtcctaggt acagtgctag cgtactacct gcgctagcgc 60 aggccagaag aggcgcgttg cccaagtaac ggtgttggag gagccagtcc tgtgataaca 120 cctgaggggg tgcatcgccg aggtgattga acggctggcc acgttcatca tcggctacag 180 gggctgaatc ccctgggttg tcaccagaag cgttcgcagt cgggcgtttc gcaagtggtg 240 gagcacttct gggtgaaaat agtagcgaag tatcgctctg cgcccacccg tcttccgctc 300 ttcccttgtg ccaaggctga aaatggatcc cctgacacga ggtagttatg gctagcaagg 360 gt; gccacaagtt cagcgtgcgc ggcgagggcg agggcgatgc caccaacggc aagctgaccc 480 tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc gtgaccaccc 540 tgacctacgg cgtgcagtgc ttcagccgct accccgacca catgaagcag cacgacttct 600 tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac catcagcttc aaggacgacg 660 gcacctacaa gacccgcgcc gaggtgaagt tcgagggcga caccctggtg aaccgcatcg 720 agctgaaggg catcgacttc aaggaggacg gcaacatcct ggggcacaag ctggagtaca 780 acttcaacag ccacaacgtc tatatcaccg ccgacaagca gaagaacggc atcaaggcca 840 acttcaagat ccgccacaac gtggaggacg gcagcgtgca gctcgccgac cactaccagc 900 agaacacccc catcggcgac ggccccgtgc tgctgcccga caaccactac ctgagcaccc 960 agtccgtgct gagcaaagac cccaacgaga agcgcgatca catggtcctg ctggagttcg 1020 tgaccgccgc cgggatcact ctcggcatgg acgagctgta caagaagctt gcggccgcac 1080 tcgagcacca ccaccaccac cactgagagc tc 1112 <210> 11 <211> 1718 <212> DNA <213> Artificial Sequence <220> <223> ribo_TetA <400> 11 ggtaccttga cggctagctc agtcctaggt acagtgctag cgtactacct gcgctagcgc 60 aggccagaag aggcgcgttg cccaagtaac ggtgttggag gagccagtcc tgtgataaca 120 cctgaggggg tgcatcgccg aggtgattga acggctggcc acgttcatca tcggctacag 180 gggctgaatc ccctgggttg tcaccagaag cgttcgcagt cgggcgtttc gcaagtggtg 240 gagcacttct gggtgaaaat agtagcgaag tatcgctctg cgcccacccg tcttccgctc 300 ttcccttgtg ccaaggctga aaatggatcc cctgacacga ggtagttatg aaatctaaca 360 atgcgctcat cgtcatcctc ggcaccgtca ccctggatgc tgtaggcata ggcttggtta 420 tgccggtact gccgggcctc ttgcgggata tcgtccattc cgacagcatc gccagtcact 480 atggcgtgct gctagcgcta tatgcgttga tgcaatttct atgcgcaccc gttctcggag 540 cactgtccga ccgctttggc cgccgcccag tcctgctcgc ttcgctactt ggagccacta 600 tcgactacgc gatcatggcg accacacccg tcctgtggat cctctacgcc ggacgcatcg 660 tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc gacatcaccg 720 atggggaaga tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc gtgggtatgg 780 tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca ccattccttg 840 cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg caggagtcgc 900 ataagggaga gcgtcgaccg atgcccttga gagccttcaa cccagtcagc tccttccggt 960 gggcgcgggg catgactatc gtcgccgcac ttatgactgt cttctttatc atgcaactcg 1020 taggacaggt gccggcagcg ctctgggtca ttttcggcga ggaccgcttt cgctggagcg 1080 cgacgatgat cggcctgtcg cttgcggtat tcggaatctt gcacgccctc gctcaagcct 1140 tcgtcactgg tcccgccacc aaacgtttcg gcgagaagca ggccattatc gccggcatgg 1200 cggccgacgc gctgggctac gtcttgctgg cgttcgcgac gcgaggctgg atggccttcc 1260 ccattatgat tcttctcgct tccggcggca tcgggatgcc cgcgttgcag gccatgctgt 1320 ccaggcaggt agatgacgac catcagggac agcttcaagg atcgctcgcg gctcttacca 1380 gcctaacttc gatcactgga ccgctgatcg tcacggcgat ttatgccgcc tcggcgagca 1440 catggaacgg gttggcatgg attgtaggcg ccgccctata ccttgtctgc ctccccgcgt 1500 tgcgtcgcgg tgcatggagc cgggccacct cgacctgaat ggaagccggc ggcacctcgc 1560 taacggattc accactccaa gaattggagc caatcaattc ttgcggagaa ctgtgaatgc 1620 gcaaaccaac ccttggcaga acatatccat cgcgtccgcc atctccagca gccgcacgcg 1680 gcgcatctcg ggcagcgttg ggtcctggcc acgagctc 1718 <210> 12 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> ribo-tetA-F primer <400> 12 ctcttccctt gtgccaaggc tgaaaatgga tcccctgaca cgaggtagtt atgaaatcta 60 acaatgcgct catcg 75 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> tetA-R primer <400> 13 agagctcgtg gccaggaccc aacgctgccc ga 32 <210> 14 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> P-dapA-F primer <400> 14 ggaaagcata aaaaaaacat gcatacaaca atcagaacgg ttctgtctgc atgggaatta 60 gccatggtcc atatg 75 <210> 15 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> P-dapA-R primer <400> 15 atcgcgacaa tacttcccgt gaacatgggc catcctctgt gcaaacaagt gctagcactg 60 tacctaggac tgagc 75 <210> 16 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> P-dapB-F primer <400> 16 gtaacctgtc acatgttatt ggcatgcagt cattcatcga ctcatgccat gggaattagc 60 catggtcc 68 <210> 17 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> P-dapB-R primer <400> 17 ggatgtttgc atcatgcata gctattctct tttgttaatt tgcatagacc gctagcactg 60 tacctaggac tgagc 75 <210> 18 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> P-lysA-F primer <400> 18 gccattagcg ctctctcgca atccggtaat ccatatcatt tttgcataga gaatatcctc 60 cttagttcct attccgaag 79 <210> 19 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> P-lysA-R primer <400> 19 agattttcgg cggtgagatc ggtatcggtg ctgaacagtg aatgtggcat atgatatat 60 ccttcttaaa gttaaacaa 79 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> S-ddH-F primer <400> 20 acatatgacc aacatccgcg tagctatcgt gg 32 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> S-ddH-R primer <400> 21 actcgagcta aattagacgt cgcgtg 26 <210> 22 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> P-ddH-F primer <400> 22 ttaaactgac gattcaactt tataatcttt gaaataatag tgcttatccc gtctatttcg 60 ttcatccgaa tatcctcc 78 <210> 23 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> P-ddH-R primer <400> 23 gcggtatggc atgatagcgc ccggaagaga gtcaattcag ggtggtgaat gagctccaaa 60 aaacccctca agac 74 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S-ppc-F primer <400> 24 agacgacgaa aagcaaagcc cgagc 25 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> S-ppc-R primer <400> 25 gcagacagaa atatattgaa aacgagggtg 30 <210> 26 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> J23series-ppc-F primer <400> 26 agagnnnnnn gctagctcag tcctaggnnn nnngctagca gacgacgaaa agcaaagccc 60 gagc 64 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ppc-lib-R primer <400> 27 gcagacagaa atatattgaa aacgagggtg 30 <210> 28 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> D-ppc-F primer <400> 28 ccagtgccgc aataatgtcg gatgcgatac ttgcgcatct tatccgaccg ttagcccgtc 60 tgtcccaa 68 <210> 29 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> D-ppc-R primer <400> 29 gcagacagaa atatattgaa aacgagggtg ttagaacaga agtatcatac tcgctcttgg 60 gtcgg 65 <210> 30 <211> 144 <212> DNA <213> Artificial Sequence <220> <223> promoter of ppc gene <400> 30 agagttgtca gctagctcag tcctaggttc caggctagca gacgacgaaa agcaaagccc 60 gagcatattc gcgccaatgc gacgtgaagg atacagggct atcaaacgat aagatggggt 120 gtctggggta atatgaacga acaa 144 <210> 31 <211> 1191 <212> DNA <213> Artificial Sequence <220> <223> The TetA gene <400> 31 atgaaatcta acaatgcgct catcgtcatc ctcggcaccg tcaccctgga tgctgtaggc 60 ataggcttgg ttatgccggt actgccgggc ctcttgcggg atatcgtcca ttccgacagc 120 atcgccagtc actatggcgt gctgctagcg ctatatgcgt tgatgcaatt tctatgcgca 180 cccgttctcg gagcactgtc cgaccgcttt ggccgccgcc cagtcctgct cgcttcgcta 240 cttggagcca ctatcgacta cgcgatcatg gcgaccacac ccgtcctgtg gatcctctac 300 gccggacgca tcgtggccgg catcaccggc gccacaggtg cggttgctgg cgcctatatc 360 gccgacatca ccgatgggga agatcgggct cgccacttcg ggctcatgag cgcttgtttc 420 ggcgtgggta tggtggcagg ccccgtggcc gggggactgt tgggcgccat ctccttgcat 480 gcaccattcc ttgcggcggc ggtgctcaac ggcctcaacc tactactggg ctgcttccta 540 atgcaggagt cgcataaggg agagcgtcga ccgatgccct tgagagcctt caacccagtc 600 agctccttcc ggtgggcgcg gggcatgact atcgtcgccg cacttatgac tgtcttcttt 660 atcatgcaac tcgtaggaca ggtgccggca gcgctctggg tcattttcgg cgaggaccgc 720 tttcgctgga gcgcgacgat gatcggcctg tcgcttgcgg tattcggaat cttgcacgcc 780 ctcgctcaag ccttcgtcac tggtcccgcc accaaacgtt tcggcgagaa gcaggccatt 840 atcgccggca tggcggccga cgcgctgggc tacgtcttgc tggcgttcgc gacgcgaggc 900 tggatggcct tccccattat gattcttctc gcttccggcg gcatcgggat gcccgcgttg 960 caggccatgc tgtccaggca ggtagatgac gaccatcagg gacagcttca aggatcgctc 1020 gcggctctta ccagcctaac ttcgatcact ggaccgctga tcgtcacggc gatttatgcc 1080 gcctcggcga gcacatggaa cgggttggca tggattgtag gcgccgccct ataccttgtc 1140 tgcctccccg cgttgcgtcg cggtgcatgg agccgggcca cctcgacctg a 1191 <210> 32 <211> 1063 <212> DNA <213> Artificial Sequence <220> <223> ddh gene <400> 32 ggtaccttga cggctagctc agtcctaggt acagtgctag cgaccacaac ggtttccctc 60 tagaaataat tttgtttaac tttaagaagg agatatacat atgaccaaca tccgcgtagc 120 tatcgtgggc tacggaaacc tgggacgcag cgtcgaaaag cttattgcca agcagcccga 180 catggacctt gtaggaatct tctcgcgccg ggccaccctc gacacaaaga cgccagtctt 240 tgatgtcgcc gacgtggaca agcacgccga cgacgtggac gtgctgttcc tgtgcatggg 300 ctccgccacc gacatccctg agcaggcacc aaagttcgcg cagttcgcct gcaccgtaga 360 cacctacgac aaccaccgcg acatcccacg ccaccgccag gtcatgaacg aagccgccac 420 cgcagccggc aacgttgcac tggtctctac cggctgggat ccaggaatgt tctccatcaa 480 ccgcgtctac gcagcggcag tcttagccga gcaccagcag cacaccttct ggggcccagg 540 tttgtcacag ggccactccg atgctttgcg acgcatccct ggcgttcaaa aggcagtcca 600 gtacaccctc ccatccgaag acgccctgga aaaggcccgc cgcggcgaag ccggcgacct 660 taccggaaag caaacccaca agcgccaatg cttcgtggtt gccgacgcgg ccgatcacga 720 gcgcatcgaa aacgacatcc gcaccatgcc tgattacttc gttggctacg aagtcgaagt 780 caacttcatc gacgaagcaa ccttcgactc cgagcacacc ggcatgccac acggtggcca 840 cgtgattacc accggcgaca ccggtggctt caaccacacc gtggaataca tcctcaagct 900 ggaccgaaac ccagatttca ccgcttcctc acagatcgct ttcggtcgcg cagctcaccg 960 catgaagcag cagggccaaa gcggagcttt caccgtcctc gaagttgctc catacctgct 1020 ctccccagag aacttggacg atctgatcgc acgcgacgtc taa 1063 <210> 33 <211> 2652 <212> DNA <213> Artificial Sequence <220> <223> ppc gene <400> 33 atgaacgaac aatattccgc attgcgtagt aatgtcagta tgctcggcaa agtgctggga 60 gaaaccatca aggatgcgtt gggagaacac attcttgaac gcgtagaaac tatccgtaag 120 ttgtcgaaat cttcacgcgc tggcaatgat gctaaccgcc aggagttgct caccacctta 180 caaaatttgt cgaacgacga gctgctgccc gttgcgcgtg cgtttagtca gttcctgaac 240 ctggccaaca ccgccgagca ataccacagc atttcgccga aaggcgaagc tgccagcaac 300 ccggaagtga tcgcccgcac cctgcgtaaa ctgaaaaacc agccggaact gagcgaagac 360 accatcaaaa aagcagtgga atcgctgtcg ctggaactgg tcctcacggc tcacccaacc 420 gaaattaccc gtcgtacact gatccacaaa atggtggaag tgaacgcctg tttaaaacag 480 ctcgataaca aagatatcgc tgactacgaa cacaaccagc tgatgcgtcg cctgcgccag 540 ttgatcgccc agtcatggca taccgatgaa atccgtaagc tgcgtccaag cccggtagat 600 gaagccaaat ggggctttgc cgtagtggaa aacagcctgt ggcaaggcgt accaaattac 660 ctgcgcgaac tgaacgaaca actggaagag aacctcggct acaaactgcc cgtcgaattt 720 gttccggtcc gttttacttc gtggatgggc ggcgaccgcg acggcaaccc gaacgtcact 780 gccgatatca cccgccacgt cctgctactc agccgctgga aagccaccga tttgttcctg 840 aaagatattc aggtgctggt ttctgaactg tcgatggttg aagcgacccc tgaactgctg 900 gcgctggttg gcgaagaagg tgccgcagaa ccgtatcgct atctgatgaa aaacctgcgt 960 tctcgcctga tggcgacaca ggcatggctg gaagcgcgcc tgaaaggcga agaactgcca 1020 aaaccagaag gcctgctgac acaaaacgaa gaactgtggg aaccgctcta cgcttgctac 1080 cagtcacttc aggcgtgtgg catgggtatt atcgccaacg gcgatctgct cgacaccctg 1140 cgccgcgtga aatgtttcgg cgtaccgctg gtccgtattg atatccgtca ggagagcacg 1200 cgtcataccg aagcgctggg cgagctgacc cgctacctcg gtatcggcga ctacgaaagc 1260 tggtcagagg ccgacaaaca ggcgttcctg atccgcgaac tgaactccaa acgtccgctt 1320 ctgccgcgca actggcaacc aagcgccgaa acgcgcgaag tgctcgatac ctgccaggtg 1380 attgccgaag caccgcaagg ctccattgcc gcctacgtga tctcgatggc gaaaacgccg 1440 tccgacgtac tggctgtcca cctgctgctg aaagaagcgg gtatcgggtt tgcgatgccg 1500 gttgctccgc tgtttgaaac cctcgatgat ctgaacaacg ccaacgatgt catgacccag 1560 ctgctcaata ttgactggta tcgtggcctg attcagggca aacagatggt gatgattggc 1620 tattccgact cagcaaaaga tgcgggagtg atggcagctt cctgggcgca atatcaggca 1680 caggatgcat taatcaaaac ctgcgaaaaa gcgggtattg agctgacgtt gttccacggt 1740 cgcggcggtt ccattggtcg cggcggcgca cctgctcatg cggcgctgct gtcacaaccg 1800 ccaggaagcc tgaaaggcgg cctgcgcgta accgaacagg gcgagatgat ccgctttaaa 1860 tatggtctgc cagaaatcac cgtcagcagc ctgtcgcttt ataccggggc gattctggaa 1920 gccaacctgc tgccaccgcc ggagccgaaa gagagctggc gtcgcattat ggatgaactg 1980 tcagtcatct cctgcgatgt ctaccgcggc tacgtacgtg aaaacaaaga ttttgtgcct 2040 tacttccgct ccgctacgcc ggaacaagaa ctgggcaaac tgccgttggg ttcacgtccg 2100 gcgaaacgtc gcccaaccgg cggcgtcgag tcactacgcg ccattccgtg gatcttcgcc 2160 tggacgcaaa accgtctgat gctccccgcc tggctgggtg caggtacggc gctgcaaaaa 2220 gtggtcgaag acggcaaaca gagcgagctg gaggctatgt gccgcgattg gccattcttc 2280 tcgacgcgtc tcggcatgct ggagatggtc ttcgccaaag cagacctgtg gctggcggaa 2340 tactatgacc aacgcctggt agacaaagca ctgtggccgt taggtaaaga gttacgcaac 2400 ctgcaagaag aagacatcaa agtggtgctg gcgattgcca acgattccca tctgatggcc 2460 gatctgccgt ggattgcaga gtctattcag ctacggaata tttacaccga cccgctgaac 2520 gtattgcagg ccgagttgct gcaccgctcc cgccaggcag aaaaagaagg ccaggaaccg 2580 gatcctcgcg tcgaacaagc gttaatggtc actattgccg ggattgcggc aggtatgcgt 2640 aataccggct aa 2652

Claims (9)

1. A lysine-producing strain screening vector, comprising a lysine riboswitch and a TetA gene, wherein the lysine riboswitch gene comprises the nucleotide sequence of SEQ ID NO: 1. delete The method according to claim 1,
Wherein the TetA gene comprises the nucleotide sequence of SEQ ID NO: 31. The method according to claim 1,
Wherein the lysine-producing strain screening vector comprises the nucleotide sequence shown in SEQ ID NO: 11. An Escherichia coli transformed with the vector of claim 1 coli KCTC12184BP. Transforming a vector comprising a lysine riboswitch and a TetA gene into a strain library; And
A method for screening a lysine-producing strain comprising culturing the transformed strain in a culture medium containing tetramycin,
Wherein the lysine riboswitch gene comprises the nucleotide sequence of SEQ ID NO: 1. Transforming a vector comprising a lysine riboswitch and a TetA gene into a strain library; And
And culturing the transformed strain in a medium containing nickel. A promoter comprising the nucleotide sequence of SEQ ID NO: 30, and a phosphoenolpyruvate carboxylase (ppc) gene. 9. The method of claim 8,
Wherein the phosphoenolpyruvate carboxylase gene is the nucleotide sequence of SEQ ID NO: 33.

Images