WO2021256582A1 - Biosensor for detecting tryptophan, comprising transcription activation factor and toehold switch - Google Patents

Biosensor for detecting tryptophan, comprising transcription activation factor and toehold switch Download PDF

Info

Publication number
WO2021256582A1
WO2021256582A1 PCT/KR2020/007828 KR2020007828W WO2021256582A1 WO 2021256582 A1 WO2021256582 A1 WO 2021256582A1 KR 2020007828 W KR2020007828 W KR 2020007828W WO 2021256582 A1 WO2021256582 A1 WO 2021256582A1
Authority
WO
WIPO (PCT)
Prior art keywords
tryptophan
biosensor
trpribo
gfp
seq
Prior art date
Application number
PCT/KR2020/007828
Other languages
French (fr)
Korean (ko)
Inventor
정규열
황윤희
석주연
Original Assignee
포항공과대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 포항공과대학교 산학협력단 filed Critical 포항공과대학교 산학협력단
Priority to PCT/KR2020/007828 priority Critical patent/WO2021256582A1/en
Publication of WO2021256582A1 publication Critical patent/WO2021256582A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Definitions

  • the present invention relates to a biosensor for detecting tryptophan, and more particularly, to a biosensor for detecting tryptophan comprising a transcriptional activator and a toehold switch, and a use thereof.
  • the previously developed assay methods include liquid/gas chromatography (LC/GC), an assay using a multi-well plate, and an assay using a biosensor.
  • LC/GC liquid/gas chromatography
  • Liquid/gas chromatography is a method of culturing an individual strain and then analyzing the concentration of metabolites in the culture medium and the strain. This method can detect most metabolites and quantitative analysis is possible if a standard calibration curve can be obtained. However, since it can measure only one mutated strain at a time, it is inefficient to analyze a library of strains larger than a certain size due to low throughput.
  • the analysis method using multiwell plates analyzes changes in the concentration of metabolites in the sample by measuring changes in color development, absorbance, or fluorescence of a small sample after putting the mutant strain into a separate well. way. Since a small amount of sample is used and a multi-plate is used, a relatively large number of mutant strains can be analyzed simultaneously. However, the processing capacity is low to analyze the large-sized strain library made by the above-described manufacturing method. In addition, the range of application is narrow because it is applicable only to metabolites that can react with metabolites as substrates or can measure changes in absorbance or fluorescence.
  • FACS fluorescence activated cell sorting
  • Screening using a selection method is a technology that makes only the strain that produces the target metabolite in a high concentration in the strain library survive and selects this strain.
  • This method has a very high throughput and can effectively select only high-producing strains from a large strain library.
  • this technique can be applied only when the concentration of the target metabolite is involved in the growth or survival of the strain.
  • the method of screening a production strain using a genetic biosensor converts the concentration of the synthesized target metabolite into a signal that can be detected immediately and detects it.
  • screening may be performed by FACS or a selection method, respectively. Therefore, it becomes possible to screen the library with high throughput. That is, if a biosensor specific to the target metabolite is developed and applied, a change in the concentration of the target metabolite that cannot be visually detected can be observed by using a suitable detector.
  • tryptophan is an aromatic amino acid widely used as a supplement for pharmaceuticals and animal feed, and can be made from microorganisms through biological processes. At this time, since the performance of the microbial strain determines the efficiency of the production process, it is essential to secure microorganisms with excellent performance in order to pursue an economical process.
  • the present inventors have completed the present invention by developing a tryptophan biosensor including a transcriptional activator and a toehold switch, and confirming that its operating range can be controlled.
  • an object of the present invention is to provide a biosensor for detecting tryptophan comprising a riboswitch and a transcriptional activator represented by the nucleotide sequence of SEQ ID NO: 1.
  • Another object of the present invention is to provide a transformant strain for detecting tryptophan into which the biosensor for detecting tryptophan is introduced.
  • Another object of the present invention is to provide a method for screening tryptophan high-producing bacteria comprising the step of culturing the transformant and candidate strains for detecting the tryptophan.
  • the present invention provides a biosensor for detecting tryptophan comprising a riboswitch and a transcriptional activator represented by the nucleotide sequence of SEQ ID NO: 1.
  • the present invention also provides a transformant strain for detecting tryptophan into which the biosensor for detecting tryptophan is introduced.
  • the present invention also provides a method for screening tryptophan high-producing bacteria, comprising the step of culturing the transformant strain and the candidate strain for detecting the tryptophan.
  • the biosensor for detecting tryptophan comprising the transcriptional activator and toehold switch of the present invention can specifically and sensitively recognize tryptophan, and can quickly and easily select strains that produce tryptophan at a high concentration.
  • the present invention confirmed that the tryptophan operating range and fold change of the biosensor for detecting tryptophan can be adjusted. Therefore, the biosensor for detecting tryptophan according to the present invention can be used in various ways in the field of industrial strain screening.
  • 1 is a diagram illustrating a dose-response curve exemplarily prepared to confirm the performance of a tryptophan biosensor.
  • FIG. 2 is a diagram illustrating a tryptophan detection mechanism of a tryptophan biosensor into which a transcriptional activator is introduced (a: in the absence of tryptophan, b: in the presence of tryptophan).
  • Trpribo-TF16-GFP Trpribo-TF16-GFP
  • Trpribo-TF32-GFP Trpribo-TF32-GFP
  • FIG. 4 is a diagram illustrating a tryptophan detection mechanism of a biosensor into which a transcriptional activator and a toehold switch are introduced (a: no tryptophan, b: tryptophan present).
  • Figure 5 is a transgenic strain Trpribo-TF-P T7 -TSN1-GFP and Trpribo-TF-P T7 -TSN3-GFP containing a biosensor introduced with a transcriptional activator and a toehold switch dose-response curves for tryptophan.
  • Trpribo-TF-P T7- TSN1-GFP Trpribo-TF-P T7- TSN3-GFP.
  • FIG. 6 is a diagram showing a dose-response curve for tryptophan of a transformed strain containing a tryptophan biosensor in which the strength of the toehold switch promoter is regulated (a: Trpribo-TF-J23100-TSN1-GFP and Trpribo-TF- J23106-TSN1-GFP, b: Trpribo-TF-J23100-TSN3-GFP and Trpribo-TF-J23106-TSN3-GFP, c: Trpribo-TF-P tac- TSN3-GFP).
  • FIG. 7 is a diagram illustrating a tryptophan detection mechanism of a tryptophan biosensor into which a transcriptional activator, a toehold switch, and a selection marker TetA are introduced (a: in the absence of tryptophan, b: in the presence of tryptophan).
  • FIG. 8 is a diagram showing the cell growth rate of a transformed strain including a tryptophan biosensor into which the selection marker TetA is introduced according to the concentration of tetracycline.
  • a biosensor for detecting tryptophan comprising a riboswitch and a transcriptional activator represented by the nucleotide sequence of SEQ ID NO: 1.
  • a biosensor refers to a sensor that measures the state and concentration of a substance, particularly an organic compound, using the function of an organism.
  • a riboswitch refers to a regulatory region to which a low molecular weight substance such as a metabolite can specifically bind. Depending on whether a specific substance is bound to the riboswitch, the degree of protein synthesis from this mRNA is regulated.
  • Regulatory RNAs that act as trans (trans) act in the form of base pairing with a complementary region or sequestering an RNA-binding protein. Riboswitches act in cis, unlike regulatory RNAs that act in trans, and exist in some form of regulatory RNA.
  • the riboswitch is preferably represented by the nucleotide sequence of SEQ ID NO: 1.
  • the gene is 70% or more, more preferably 80% or more, even more preferably 90% or more, and most preferably 95% or more sequence homology with the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: It refers to a sequence that exhibits substantially the same physiological activity as the nucleotide sequence represented by 1.
  • the % of sequence homology to a polynucleotide is determined by comparing two optimally aligned sequences with a comparison region, wherein a portion of the polynucleotide sequence in the comparison region is a reference sequence (including additions or deletions) to the optimal alignment of the two sequences. It may contain additions or deletions (ie, gaps) compared to not).
  • a transcriptional activator refers to a protein that increases the transcription of a gene or a set of genes.
  • the transcriptional activator is usually a DNA-binding protein, and binds to an enhancer or a promoter.
  • the transcriptional activator is preferably an ECF sigma factor (extra-cytoplasmic function sigma factor) or a LysR type transcriptional regulatory factor.
  • the ECF sigma factor may be an ECF16 sigma factor represented by the nucleotide sequence of SEQ ID NO: 2 or an ECF32 sigma factor represented by the nucleotide sequence of SEQ ID NO: 3.
  • the biosensor may further include a toe hold switch.
  • the toehold switch is a trigger RNA that is trN1 represented by the nucleotide sequence of SEQ ID NO: 4 or trN3 represented by the nucleotide sequence of SEQ ID NO: 6; and a switch RNA that is swN1 represented by the nucleotide sequence of SEQ ID NO: 5 or swN3 represented by the nucleotide sequence of SEQ ID NO: 7; preferably, (i) trN1 and the sequence represented by the nucleotide sequence of SEQ ID NO: 4 swN1 represented by the nucleotide sequence of number 5; or (ii) trN3 represented by the nucleotide sequence of SEQ ID NO: 6 and swN3 represented by the nucleotide sequence of SEQ ID NO: 7.
  • the biosensor may further include a promoter.
  • the promoter is promoter T7 represented by the nucleotide sequence of SEQ ID NO: 8
  • promoter BBa_J23100 represented by the nucleotide sequence of SEQ ID NO: 9
  • promoter BBa_J23106 and SEQ ID NO: 11 represented by the nucleotide sequence of SEQ ID NO: 10
  • It may be one or more selected from the group consisting of promoter Tac represented by the nucleotide sequence of
  • the biosensor may further include a selection marker gene.
  • the selection marker gene is preferably a fluorescent protein gene or an antibiotic resistance gene, but any gene for labeling may be used without limitation.
  • the fluorescent protein is a group consisting of green fluorescent protein (GFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), and red fluorescent protein (RFP). It may be one or more selected from.
  • the antibiotic resistance gene is an ampicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, a streptomycin resistance gene, a tetracycline resistance gene, a gentamicin resistance gene, and a carbenicillin resistance gene. It may be one or more selected from, but is not limited thereto.
  • a riboswitch and a transcriptional activator are operatively linked.
  • operably linked means linked in a manner that enables gene expression when an appropriate molecule binds to an expression control sequence.
  • the tryptophan sensor has an operating range of 0.001 to 1 g/L, and there is a limit in scale-up due to a low operating range.
  • the present invention has adjusted the operating range of the tryptophan biosensor.
  • the tryptophan biosensor according to the present invention can be scaled-up and used for screening of industrial strains.
  • a transformed strain for detecting tryptophan into which the biosensor for detecting tryptophan is introduced.
  • the transformed strain means a strain transformed with the recombinant vector of the present invention.
  • transformation means introducing the vector containing the promoter or target gene according to the present invention into a host cell.
  • the transformed target gene may be inserted into the chromosome of the host cell or located outside the chromosome.
  • one or a plurality of recombinant vectors may be introduced into the transformant strain for detecting tryptophan, and the one or a plurality of recombinant vectors may be introduced, respectively.
  • the recombinant vector may be introduced into the microorganism at the same time or at the same time, may be introduced sequentially, may be introduced in a mutually changed order.
  • the transformant strain for detecting tryptophan may be characterized in that it is selected from the group consisting of bacteria, yeast, and mold, and may preferably be a microorganism of the genus Escherichia, more Preferably, it may be Escherichia coli.
  • the transformant strain for detecting tryptophan may be Escherichia coli BL21 (Escherichia coli BL21) lacking a major protease encoded by the lon gene.
  • the present invention provides a method for screening tryptophan high-producing bacteria comprising the step of culturing the transformant and candidate strains for detecting tryptophan.
  • the selection marker gene is expressed when tryptophan is present. Incubated with the transformant and candidate strains for detection of tryptophan, and when the candidate strain produces tryptophan, the selection marker gene is expressed, so tryptophan high-producing bacteria can be screened by confirming the expression of the selection marker gene.
  • the method for screening tryptophan high-producing bacteria uses a transformant strain for detecting tryptophan that can be scaled-up by controlling the operating range, so it is possible to screen tryptophan high-producing bacteria at an industrial level.
  • strains and plasmids used in Examples to be described later are shown in Table 1 below, and the sequences of the primers used are shown in Table 2.
  • the primers disclosed in Table 2 were synthesized by Cosmogenetech (Seoul, Korea), and the interaction sequences between the primers are underlined.
  • a transcriptional activator was inserted into the tryptophan biosensor including the tryptophan riboswitch (SEQ ID NO: 1) and the reporter gene GFP (SEQ ID NO: 12).
  • the transcriptional activator ECF sigma factor (extra-cytoplasmic function sigma factor) recognizes a specific promoter sequence and activates gene expression.
  • two types of transcriptional activators were used using the transcriptional activator ECF16 sigma factor (SEQ ID NO: 2) derived from Caulobacter crescentus and the transcriptional activator ECF32 sigma factor (SEQ ID NO: 3) derived from plant pathogens. .
  • the performance of the constructed tryptophan biosensor was confirmed through a dose-response curve.
  • 1 shows a dose-response curve as an example, from which (i) expression level change (ie, fold change) and (ii) an operating range of the output module according to the concentration of metabolites, and (ii) the interval in which the expression level change appears. can be checked.
  • the fold activation is a value calculated as the ratio of the maximum expression level to the minimum expression level (maximum expression level/minimum expression level).
  • a plasmid pACYC-Trpribo-ECF16-GFP which is a tryptophan biosensor operating without a toehold switch, was constructed, and a transformed strain Trpribo-TF16-GFP introduced thereto was constructed.
  • the plasmid pACYC-Trpribo-ECF16-GFP was constructed by amplifying and ligating a part of the plasmid pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP containing the toehold switch and promoter.
  • a tryptophan sensor including trigger RNA trN1 (SEQ ID NO: 4), switch RNA swN1 (SEQ ID NO: 5) and promoter T7 (SEQ ID NO: 8) was constructed. Specifically, to construct the plasmid pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP, the plasmid pACYC-Trpribo-ECF16-trN1 was constructed. Specifically, three types of amplification products 1 to 3 were prepared using Q5 High-Fidelity DNA Polymerase (New England Biolabs (NEB), Ipswich, MA, USA).
  • Amplification product 1 contains a tryptophan riboswitch sequence and was obtained by amplifying plasmid pAC108_TR585 using the primer Gib-Trpribo-Homo-F/R.
  • Amplification product 2 includes a transcriptional activator sequence and a part of a promoter sequence and a trigger sequence regulated by the transcription factor.
  • the amplification product 2 is a product obtained by amplifying plasmid pVRa16-3622 using primers Gib-TF16-over-Trpribo-In-F and TF16-over-P16-1-R, which was obtained by amplifying the primer Gib-TF16-over-Trpribo.
  • -In-F and Gib-P16-over-trN1-R were amplified to obtain an amplification product, that is, amplification product 2.
  • Amplification product 3 was obtained by amplifying plasmid pACYC-B12ribo-PhlF-trN1 using primers Gib-trN1-F and Gib-over-Trpribo-R.
  • the amplification products 1 to 3 were ligated in the Gibson assembly method using NEBuilder® HiFi DNA Assembly Master Mix (NEB) to construct plasmid pACYC-Trpribo-ECF16-trN1. Also, (i) the product of amplification of the plasmid pACYC-Trpribo-ECF16-trN1 using the primers Gib-Vec-F/R; and (ii) a product of amplification of plasmid pCOLA-swN1-GFP using primers Gib-In-F/R (including a toehold switch and a fluorescent protein sequence); pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP was constructed.
  • NEB NEBuilder® HiFi DNA Assembly Master Mix
  • the 5' ends of primers Gib-del-F and Gib-del-R were phosphorylated using T4 Polynucleotide Kinase (Takara, Shiga, Japan).
  • the plasmid pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP was amplified using Gib-del-F/R, a primer with phosphorylated 5' end.
  • the amplification product was ligated by blunt-end ligation using Quick Ligase (NEB) to construct a plasmid pACYC-Trpribo-ECF16-GFP.
  • E. coli BL21 Star (DE3) was transformed with the plasmid pACYC-Trpribo-ECF16-GFP, and the transformed strain was named Trpribo-TF16-GFP.
  • a plasmid pACYC-Trpribo-ECF32-GFP a tryptophan biosensor operating without a toehold switch, was constructed, and a transformed strain Trpribo-TF32-GFP introduced thereto was constructed.
  • the plasmid pACYC-Trpribo-ECF32-GFP was constructed by amplifying and ligating a part of the plasmid pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP containing the toehold switch and promoter.
  • a tryptophan sensor including trigger RNA trN3 (SEQ ID NO: 6), switch RNA swN3 (SEQ ID NO: 7) and promoter T7 (SEQ ID NO: 8) was constructed. Specifically, in order to construct the tryptophan sensor plasmid pACYC-Trpribo-ECF32-trN3-P T7- swN3-GFP, amplification products 1 to 3 were prepared as follows.
  • Amplification product 1 includes a transcriptional activator sequence and a promoter sequence capable of reacting therewith.
  • plasmid pVRa32-1122 was amplified using primers Gib-TF32-over-Trpribo-ln-F/TF32-over-P32-1-R.
  • the amplification product was further amplified using primers Gib-TF32-over-Trpribo-In-F and Gib-P32-over-trN3-R to finally obtain amplification product 1.
  • plasmid pACYC-B12ribo-PhlF-trN3 was amplified using primers Gib-trN3-F and Gib-over-Trpribo-R to obtain amplification product 2 containing the remaining trigger sequences.
  • Amplification products 1 and 2 were ligated in the same manner as in Example 2-1 with the same Gibson assembly to construct plasmid pACYC-Trpribo-ECF32-trN3. Also, (i) the product of amplification of the plasmid pACYC-Trpribo-ECF32-trN3 using the primer Gib-Vec-F/R; and (ii) a product of amplification of plasmid pCOLA-swN3-GFP using primers Gib-In-F/R (including a threshold switch sequence and a fluorescent protein sequence); -ECF32-trN3-P T7 -swN3-GFP was constructed.
  • a part of the vector pACYC-Trpribo-ECF32-trN3-P T7- swN3-GFP was amplified and ligated in the same manner as in Example 1-1 to construct a plasmid pACYC-Trpribo-ECF32-GFP.
  • E. coli BL21 Star (DE3) was transformed with the plasmid pACYC-Trpribo-ECF32-GFP, and the transformed strain was named Trpribo-TF32-GFP.
  • the tryptophan detection mechanism of the tryptophan biosensor introduced with the transcriptional activator is shown in FIG. 2 , and the constructed plasmids pACYC-Trpribo-ECF16-GFP and pACYC-Trpribo-ECF32-GFP operate with the same mechanism as in FIG. 2 .
  • the plasmids pACYC-Trpribo-ECF16-GFP and pACYC-Trpribo-ECF32-GFP contain transcriptional activators, but do not include a toehold switch.
  • the two plasmids are not expressed in the absence of tryptophan ( FIG. 2A ), and are expressed in the presence of tryptophan to express GFP ( FIG. 2B ).
  • the culture experiment was performed in M9 medium containing glucose (4 g / L glucose, 6.78 g / L disodium phosphate (anhydrous), 3 g / L monopotassium phosphate, 0.5 g / L sodium chloride, 1 g / L ammonium chloride, 2 mM magnesium sulfate and 0.1 mM calcium chloride) were used, and chloramphenicol 34 mg/L was added as an antibiotic to maintain the plasmid.
  • the transformant strain constructed in Example 1-2 was inoculated in M9 medium and then cultured for 24 hours.
  • the cultured strain was diluted in fresh M9 medium so that the OD 600 value was 0.05, and when the OD 600 value reached 0.8, the OD 600 value was diluted to 0.05 in the new M9 medium.
  • the strain is transferred to a medium to which various concentrations of tryptophan (0, 0.01, 0.03, 0.1, 0.3, 1, 2, 4, 6 and 8 g/L) are added to the late exponential phase It was cultured until the late-exponential phase.
  • the cultured strain was washed once with PBS (phosphate-buffered saline), and then fluorescence was measured.
  • the fluorescence was measured using a 485 nm transfer filter, a 535 nm emission filter, and a VICTOR 3 1420 Multilabel Counter (PerkinElmer, Waltham, MA, USA), and the fluorescence intensity was measured for 0.1 second.
  • the value was corrected by subtracting the PBS measurement value from the measured fluorescence value, and autofluorescence of the strain was not subtracted from the measured fluorescence value.
  • VICTOR 3 1420 Multilabel Counter PerkinElmer
  • UV-1700 spectrophotometer Shiadzu, Japan
  • the tryptophan dose-response curves of the strains Trpribo-TF16-GFP and Trpribo-TF32-GFP transformed with the plasmid, respectively, are shown in FIGS. 3A and 3B , respectively.
  • the tryptophan concentration of 8 g/L is selected in consideration of the maximum solubility of tryptophan.
  • the operating ranges of the above-mentioned transforming strains Trpribo-TF16-GFP and Trpribo-TF32-GFP increased both the minimum and maximum values compared to the operating range (0.001 to 1 g/L) of the previously developed tryptophan biosensor. In particular, it was confirmed that the maximum value increased 8-fold from 1 g/L to 8 g/L.
  • the fold change of the transgenic strains Trpribo-TF16-GFP and Trpribo-TF32-GFP was increased by up to about 32% compared to the fold change (1.58 fold) of the conventionally developed tryptophan biosensor. This means that by introducing a transcriptional activator and a promoter sequence corresponding to the tryptophan biosensor, the operating range and fold change of the tryptophan biosensor can be controlled.
  • Example 1 From Example 1, it was confirmed that the introduction of the transcriptional activator can control the operating range and fold range of the tryptophan biosensor. Accordingly, a tryptophan biosensor into which a transcriptional activator and a toehold switch system were introduced was constructed, and its performance was evaluated.
  • Plasmid pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP was introduced to construct a transformant strain
  • the plasmid pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP constructed in Example 1-1 was introduced into E. coli BL21 Star (DE3), and the transformed strain was Trpribo-TF-P T7 -TSN1 -GFP was named.
  • Plasmid pACYC-Trpribo-ECF32-trN3-P T7- swN3-GFP was introduced to construct a transformant strain
  • the plasmid pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP constructed in Example 1-2 was introduced into E. coli BL21 Star (DE3), and the transformed strain was Trpribo-TF-P T7 -TSN3 -GFP was named.
  • the tryptophan detection mechanism of the biosensor into which the transcriptional activator and the toehold switch were introduced is shown in FIG. 4, and the constructed plasmids pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP operates with the same mechanism as in FIG. 4 .
  • the plasmids pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP contain transcriptional activators, triggers and toehold switches. do.
  • GFP when tryptophan is not present, GFP is not expressed (Fig. 4a), and when tryptophan is present, transcriptional activators are expressed to express trigger RNA, and the hairpin structure of the switch RNA is released by the expressed trigger RNA.
  • GFP is expressed (Fig. 4b).
  • the maximum value increased 8 times from 1 g/L to 8 g/L.
  • the fold change of the transformant strains Trpribo-TF-P T7- TSN1-GFP and Trpribo-TF-P T7- TSN3-GFP was confirmed to be about 2.0-fold and 1.8-fold, respectively, with respect to 8 g/L tryptophan. This is an increase of 27% and 14%, respectively, compared to the fold change (1.58 times) of the conventionally developed tryptophan biosensor.
  • Example 3 Construction and performance confirmation of tryptophan biosensor in which the strength of the toehold switch promoter is regulated
  • Example 2 From Example 2, it was confirmed that the introduction of the transcriptional activator and the toehold system can control the operating range and fold change of the tryptophan biosensor. Accordingly, a tryptophan biosensor including a transcriptional activator and a toehold switch system, in which the strength of the toehold switch promoter is regulated, was constructed, and its performance was evaluated.
  • the strength of the toehold switch promoter contained in the plasmids pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP constructed in Example 2 was adjusted.
  • BBa_J23100, BBa_J23106 and Tac promoters were inserted instead of the T7 promoter, respectively.
  • the BBa_J23106 is a promoter capable of expressing a gene at 1/2 level compared to BBa_J23100.
  • plasmids pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7- swN3-GFP was amplified.
  • the primers used to amplify the plasmid pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP were sw1-J23100-F and Change-promoter-R with phosphorylated 5' ends, and plasmid pACYC-Trpribo-ECF32-trN3-
  • the primers used for amplification of P T7- swN3-GFP were phosphorylated sw3-J23100-F and Change-promoter-R.
  • Each amplification product was blund-end ligated to construct plasmids pACYC-Trpribo-ECF16-trN1-J23100-swN1-GFP and pACYC-Trpribo-ECF32-trN3-J23100-swN3-GFP.
  • plasmids pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP were amplified, respectively.
  • Primers sw1-J23106-F/Change-promoter-R and sw3-J23106-F/Change-promoter-R were used for amplification of the two plasmids, respectively.
  • the amplification products were ligated, respectively, and the constructed plasmids were pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP and pACYC-Trpribo-ECF32-trN3-J23106-swN3-GFP.
  • the Tac promoter plasmids pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP were amplified, respectively.
  • Primers sw1-P tac -F/Change-promoter-R and sw3-P tac -F/Change-promoter-R were used for amplification of the two plasmids, respectively.
  • the amplification products were ligated, respectively, and the constructed plasmids were pACYC-Trpribo-ECF16-trN1-P tac -swN1-GFP and pACYC-Trpribo-ECF32-trN3-P tac -swN3-GFP.
  • Plasmids constructed from E. coli W3110 strain (pACYC-Trpribo-ECF16-trN1-J23100-swN1-GFP, pACYC-Trpribo-ECF32-trN3-J23100-swN3-GFP, pACYC-Trpribo-ECF16-trN1-J23106-swN1- Transformed with GFP, pACYC-Trpribo-ECF32-trN3-J23106-swN3-GFP, pACYC-Trpribo-ECF16-trN1-P tac- swN1-GFP and pACYC-Trpribo-ECF32-trN3-P tac- swN3-GFP, respectively.
  • Transformed strains are Trpribo-TF-J23100 - TSN1 - GFP, Trpribo-TF-23100-TSN3-GFP, Trpribo-TF-J23106-TSN1-GFP, Trpribo-TF-J23106-TSN3-GFP, Trpribo-TF, respectively. They were named -P tac - TSN1-GFP and Trpribo-TF-P tac - TSN3-GFP.
  • the transformed strain Trpribo-TF-J23100-TSN1-GFP, Trpribo-TF-J23100-TSN3-GFP, Trpribo-TF-J23106-TSN1-GFP of Example 3-1 Culture experiments were performed using Trpribo-TF-J23106-TSN3-GFP, Trpribo-TF-P tac - TSN1-GFP and Trpribo-TF-P tac -TSN3-GFP. The culture experiment was performed in the same manner as in Example 1-2.
  • Trpribo-TF-P tac - TSN3-GFP the tryptophan dose-response curve of Trpribo-TF-P tac - TSN3-GFP is shown in Fig. 6c, respectively.
  • Trpribo-TF-P tac- TSN1-GFP cell growth was severely inhibited, so it was not possible to proceed with the reaction experiment to tryptophan.
  • the transformant strain Trpribo-TF-P tac - TSN3-GFP containing the inducible promoter Tac promoter was treated with IPTG 0.1 ⁇ g/ml, the transformed strain Trpribo-TF-J23106-TSN3 - It was confirmed that the performance was similar to that of GFP. Since the Tac promoter can regulate the expression level by controlling the concentration of IPTG, the transformant strain Trpribo-TF-P tac - TSN3-GFP is also thought to be able to control the performance of the tryptophan biosensor by controlling the concentration of IPTG. .
  • the pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP (trN1-swN1 combination) has fold change and operating range compared to using the trN3-swN3 combination (TSN3). was confirmed similarly, but has the advantage of high reliability because the error range is narrow. Therefore, in the Examples to be described later, pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP was used.
  • the tryptophan biosensors constructed in Examples 1 to 3 have a mechanism in which the fluorescent protein GFP is expressed when tryptophan is present.
  • the fluorescent protein GFP was replaced with TetA (tetracycline/H + bidirectional transporter, encoded by the tetA gene), and BBa_J23106 and BBa_J23105 were used as promoters for TetA expression.
  • TetA tetracycline/H + bidirectional transporter, encoded by the tetA gene
  • BBa_J23106 and BBa_J23105 were used as promoters for TetA expression.
  • a tryptophan biosensor was constructed so that the growth rate of cells can be regulated according to the concentration of tryptophan.
  • the plasmid pCDF-3HPselector was amplified using primers TetA-In-F and TetA-In-R to obtain a first amplification product.
  • the plasmid pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP was amplified using primers Vec-F and Vec-R to obtain a second amplification product.
  • the obtained first and second amplification products were ligated in a Gibson assembly manner to construct a plasmid pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA.
  • the above plasmid pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA was amplified using 5' end phosphorylated primers sw1-J23105-F and Change-promoter-R.
  • the amplification product was blund-end ligated to construct a plasmid pACYC-Trpribo-ECF16-trN1-J23105-swN1-tetA.
  • the tryptophan detection mechanism of the tryptophan biosensor into which the transcriptional activator, the toehold switch and the selection marker TetA was introduced is shown in FIG. 7 , and the constructed plasmids pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA and pACYC-Trpribo-ECF16 -trN1-J23105-swN1-tetA operates with the same mechanism as in FIG. 7 .
  • the tryptophan biosensor constructed in this example does not respond when tryptophan is not present (FIG. 7a), and when tryptophan is present, TetA is expressed, and accordingly, it has resistance to the antibiotic tetracycline, thereby preventing cell growth. becomes advantageous (Fig. 7b).
  • E. coli W3110 strain was transformed with plasmids pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA and pACYC-Trpribo-ECF16-trN1-J23105-swN1-tetA, respectively, to transform strain Trpribo-TF-J23106-TSN1 -tetA and Trpribo-TF-J23105-TSN1-tetA were constructed.
  • the expression level of the promoter BBa_J23105 included in the constructed strain is 1/2 compared to that of BBa_J23106.
  • TetA in this experiment is a membrane protein inserted into the cell membrane. When overexpressed at a certain level or more, it can inhibit cell growth, so it must be expressed at an appropriate level. Accordingly, in order to maintain the expression of the membrane protein TetA lower than that of GFP, a transgenic strain Trpribo-TF-J23106-TSN1-tetA including a relatively low-strength promoter was used in the experiment described below.
  • the culture experiment for confirming the operation of the tryptophan biosensor into which TetA was introduced used the same medium as in Example 1-2.
  • the transformant strain constructed in Example 4-1 was inoculated into M9 medium and cultured for 24 hours.
  • the cultured strain was diluted in fresh M9 medium so that the OD 600 value was 0.05, and when the OD 600 value reached 0.8, it was again diluted in the new M9 medium so that the OD 600 value was 0.05.
  • the strains were transferred and cultured in a medium to which various concentrations of tryptophan (0 and 8 g/L) and tetracycline (0, 50 and 100 ⁇ g/mL) were added.
  • the OD 600 was measured a total of 5 times at 1 hour intervals to confirm the growth of the cells. The results of confirming the cell growth rate are shown in FIG. 8 .
  • the transformed strain Trpribo-TF-J23106-TSN1-tetA expresses TetA, and thus it was confirmed that it exhibits resistance to tetracycline.
  • the transformed strain Trpribo-TF-J23106-TSN1-tetA in the presence of tryptophan had a cell growth rate of about 8.7 times higher than when tryptophan was not present.
  • the above result means that the constructed tryptophan biosensor can regulate the expression of TetA by tryptophan.
  • the tryptophan-producing strain can be screened relatively simply.
  • the present inventors have developed a tryptophan biosensor including a transcriptional activator and a toehold switch, and confirmed that the operating range of the tryptophan biosensor can be controlled. This means that the tryptophan biosensor of the present invention is suitable for screening of industrial strains.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a biosensor for detecting tryptophan and, more specifically, to: a biosensor for detecting tryptophan, comprising a transcription activation factor and a toehold switch; and a use thereof. It has been identified that a biosensor for detecting tryptophan, comprising a transcription activation factor and a toehold switch, of the present invention, can specifically and sensitively recognize tryptophan and can rapidly and easily select a strain producing tryptophan at a high concentration. Additionally, it has been identified in the present invention that the operational range and fold change of the biosensor for detecting tryptophan can be controlled. Therefore, a biosensor for detecting tryptophan, according to the present invention, can be utilized in various ways in the field of industrial strain screening.

Description

전사 활성 인자 및 토홀드 스위치를 포함하는 트립토판 검출용 바이오센서Biosensor for detection of tryptophan including transcriptional activator and toehold switch
본 발명은 트립토판 검출용 바이오센서에 관한 것으로, 보다 상세하게는 전사 활성 인자 및 토홀드 스위치를 포함하는 트립토판 검출용 바이오센서 및 이의 용도에 관한 것이다.The present invention relates to a biosensor for detecting tryptophan, and more particularly, to a biosensor for detecting tryptophan comprising a transcriptional activator and a toehold switch, and a use thereof.
균주의 목적 물질 생산성을 파악하기 위해서 다양한 분석법이 쓰이고 있다. 기개발된 분석법은 액체/기체 크로마토그래피(LC/GC), 멀티웰 플레이트를 이용한 분석법 및 바이오센서를 이용한 분석법 등이 있다.Various analytical methods are used to determine the productivity of the target substance of the strain. The previously developed assay methods include liquid/gas chromatography (LC/GC), an assay using a multi-well plate, and an assay using a biosensor.
액체/기체 크로마토그래피(LC/GC)는 개별 균주를 배양한 후 배양액과 균주 내의 대사산물 농도를 분석하는 방법이다. 이 방법은 대부분의 대사산물을 검출할 수 있고 표준검정곡선을 얻을 수 있다면 정량적 분석이 가능하다. 하지만 한 번에 한 종의 변이 균주에 대해서만 측정할 수 있기 때문에 처리량(throughput)이 낮아서 일정 크기 이상의 균주 라이브러리를 분석하기에는 비효율적이다.Liquid/gas chromatography (LC/GC) is a method of culturing an individual strain and then analyzing the concentration of metabolites in the culture medium and the strain. This method can detect most metabolites and quantitative analysis is possible if a standard calibration curve can be obtained. However, since it can measure only one mutated strain at a time, it is inefficient to analyze a library of strains larger than a certain size due to low throughput.
멀티웰플레이트(multiwell plates)를 사용한 분석 방법은 변이 균주를 구분된 칸(well)에 투입한 뒤 소량 시료의 발색, 흡광도 또는 형광도 등의 변화를 측정하여 시료 안의 대사산물의 농도 변화를 분석하는 방법이다. 소량의 시료를 사용하고, 멀티플레이트를 사용하기 때문에 비교적 다수의 변이 균주들을 동시에 분석할 수 있다. 그러나 상기된 제조방법에 의해 만들어진 크기가 큰 균주 라이브러리를 분석하기에는 처리능이 낮다. 또한, 대사산물을 기질로 한 발색 반응이 가능하거나, 흡광도 또는 형광도의 변화를 측정할 수 있는 대사산물에 대해서만 적용 가능하기 때문에 활용범위가 좁다.The analysis method using multiwell plates analyzes changes in the concentration of metabolites in the sample by measuring changes in color development, absorbance, or fluorescence of a small sample after putting the mutant strain into a separate well. way. Since a small amount of sample is used and a multi-plate is used, a relatively large number of mutant strains can be analyzed simultaneously. However, the processing capacity is low to analyze the large-sized strain library made by the above-described manufacturing method. In addition, the range of application is narrow because it is applicable only to metabolites that can react with metabolites as substrates or can measure changes in absorbance or fluorescence.
FACS(fluorescence activated cell sorting)를 이용하는 스크리닝은 변이 균주를 검출기로 흘려보내면서 개별 균주에서 방출되는 형광을 검출한다. 대량의 세포들을 동시에 흘려보내며 매우 빠르게 형광검출을 할 수 있기 때문에, 처리능이 최대 10 9에 달한다. 목적 대사물질이 형광을 내는 경우, 큰 라이브러리를 비교적 빠르고 쉽게 분석할 수 있기 때문에 고생산균을 효율적으로 스크리닝 할 수 있다. 그러나 형광을 나타내는 대사산물에 대해서만 적용할 수 있다는 한계점이 있다.Screening using fluorescence activated cell sorting (FACS) detects fluorescence emitted from individual strains while flowing mutant strains to a detector. Since a large number of cells can be simultaneously flowed and fluorescence detection can be performed very quickly, the processing power reaches up to 10 9 . When the target metabolite emits fluorescence, high-producing bacteria can be efficiently screened because a large library can be analyzed relatively quickly and easily. However, there is a limitation in that it can be applied only to metabolites exhibiting fluorescence.
선별(selection) 방법을 사용하는 스크리닝은 균주 라이브러리에서 목적 대사산물을 고농도로 생산해내는 균주만 살아남도록 만들고, 이 균주를 선별하는 기술이다. 이 방법은 처리량이 매우 높아서 큰 균주 라이브러리로부터 고생산 균주만을 효과적으로 골라낼 수 있다. 그러나 목적 대사산물의 농도가 균주의 성장 혹은 생존에 관여하는 경우에만 이 기술을 적용할 수 있다는 한계가 있다.Screening using a selection method is a technology that makes only the strain that produces the target metabolite in a high concentration in the strain library survive and selects this strain. This method has a very high throughput and can effectively select only high-producing strains from a large strain library. However, there is a limitation that this technique can be applied only when the concentration of the target metabolite is involved in the growth or survival of the strain.
마지막으로, 유전적 바이오센서를 활용하여 생산 균주를 스크리닝하는 방법은 합성된 목적 대사산물의 농도를 즉각적으로 검출할 수 있는 신호로 전환시켜서 검출한다. 이때, 검출 신호를 형광 단백질 혹은 선별 마커(selection marker)등을 이용함으로써 각각 FACS 혹은 선별 방법 등으로 스크리닝을 수행할 수 있다. 따라서, 고 처리능으로 라이브러리를 스크리닝할 수 있게 된다. 즉, 목적 대사산물에 특이적인 바이오센서를 개발하여 적용한다면 적합한 검출기를 활용함으로써 시각적으로 검출할 수 없는 목적 대사산물의 농도 변화를 관찰할 수 있다.Finally, the method of screening a production strain using a genetic biosensor converts the concentration of the synthesized target metabolite into a signal that can be detected immediately and detects it. In this case, by using a fluorescent protein or a selection marker as the detection signal, screening may be performed by FACS or a selection method, respectively. Therefore, it becomes possible to screen the library with high throughput. That is, if a biosensor specific to the target metabolite is developed and applied, a change in the concentration of the target metabolite that cannot be visually detected can be observed by using a suitable detector.
한편, 트립토판은 의약품 및 동물 사료의 보충제로 널리 사용되는 방향족 아미노산이며, 미생물로부터 생물 공정을 통해 만들어질 수 있다. 이때, 미생물 균주의 성능이 생산 공정의 효율을 결정하기 때문에 경제적인 공정을 추구하기 위해서 우수한 성능의 미생물을 확보하는 것이 필수적이다. On the other hand, tryptophan is an aromatic amino acid widely used as a supplement for pharmaceuticals and animal feed, and can be made from microorganisms through biological processes. At this time, since the performance of the microbial strain determines the efficiency of the production process, it is essential to secure microorganisms with excellent performance in order to pursue an economical process.
이에 본 발명자들은 전사 활성인자 및 토홀드 스위치를 포함하는 트립토판 바이오센서를 개발하고, 이의 작동범위를 조절할 수 있음을 확인함으로써, 본 발명을 완성하게 되었다.Accordingly, the present inventors have completed the present invention by developing a tryptophan biosensor including a transcriptional activator and a toehold switch, and confirming that its operating range can be controlled.
따라서 본 발명의 목적은 서열번호 1의 염기서열로 표시되는 리보스위치 및 전사 활성 인자를 포함하는 트립토판 검출용 바이오센서를 제공하는 것이다.Accordingly, an object of the present invention is to provide a biosensor for detecting tryptophan comprising a riboswitch and a transcriptional activator represented by the nucleotide sequence of SEQ ID NO: 1.
본 발명의 다른 목적은 상기 트립토판 검출용 바이오센서가 도입된 트립토판 검출용 형질전환 균주를 제공하는 것이다.Another object of the present invention is to provide a transformant strain for detecting tryptophan into which the biosensor for detecting tryptophan is introduced.
본 발명의 또 다른 목적은 상기 트립토판 검출용 형질전환 균주 및 후보 균주를 배양하는 단계를 포함하는 트립토판 고생산균 스크리닝 방법을 제공하는 것이다.Another object of the present invention is to provide a method for screening tryptophan high-producing bacteria comprising the step of culturing the transformant and candidate strains for detecting the tryptophan.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1의 염기서열로 표시되는 리보스위치 및 전사 활성인자를 포함하는 트립토판 검출용 바이오센서를 제공한다.In order to achieve the above object, the present invention provides a biosensor for detecting tryptophan comprising a riboswitch and a transcriptional activator represented by the nucleotide sequence of SEQ ID NO: 1.
또한 본 발명은 상기 트립토판 검출용 바이오센서가 도입된 트립토판 검출용 형질전환 균주를 제공한다.The present invention also provides a transformant strain for detecting tryptophan into which the biosensor for detecting tryptophan is introduced.
또한 본 발명은 상기 트립토판 검출용 형질전환 균주 및 후보 균주를 배양하는 단계;를 포함하는 트립토판 고생산균 스크리닝 방법을 제공한다.The present invention also provides a method for screening tryptophan high-producing bacteria, comprising the step of culturing the transformant strain and the candidate strain for detecting the tryptophan.
본 발명의 전사 활성 인자 및 토홀드 스위치를 포함하는 트립토판 검출용 바이오센서는 트립토판을 특이적이고 민감하게 인지할 수 있고, 트립토판을 고농도로 생산하는 균주를 빠르고 쉽게 선별할 수 있음을 확인하였다. 또한 본 발명은 상기 트립토판 검출용 바이오센서의 트립토판 작동범위 및 배수 변화를 조절할 수 있음을 확인하였다. 따라서 본 발명에 따른 트립토판 검출용 바이오센서는 산업용 균주 스크리닝 분야에서 다양하게 활용될 수 있다.It was confirmed that the biosensor for detecting tryptophan comprising the transcriptional activator and toehold switch of the present invention can specifically and sensitively recognize tryptophan, and can quickly and easily select strains that produce tryptophan at a high concentration. In addition, the present invention confirmed that the tryptophan operating range and fold change of the biosensor for detecting tryptophan can be adjusted. Therefore, the biosensor for detecting tryptophan according to the present invention can be used in various ways in the field of industrial strain screening.
도 1은 트립토판 바이오센서의 성능을 확인하기 위해 예시적으로 작성된 용량-반응 곡선을 나타낸 도이다.1 is a diagram illustrating a dose-response curve exemplarily prepared to confirm the performance of a tryptophan biosensor.
도 2는 전사 활성 인자가 도입된 트립토판 바이오센서의 트립토판 검출 메커니즘을 나타낸 도이다(a : 트립토판이 없을 경우, b : 트립토판이 존재할 경우).2 is a diagram illustrating a tryptophan detection mechanism of a tryptophan biosensor into which a transcriptional activator is introduced (a: in the absence of tryptophan, b: in the presence of tryptophan).
도 3은 전사 활성 인자가 도입된 트립토판 바이오센서를 포함하는 형질전환 균주 Trpribo-TF16-GFP 및 Trpribo-TF32-GFP의 트립토판에 대한 용량-반응 곡선을 나타낸 도이다(a : Trpribo-TF16-GFP, b : Trpribo-TF32-GFP).3 is a diagram showing a dose-response curve for tryptophan of the transgenic strains Trpribo-TF16-GFP and Trpribo-TF32-GFP containing a tryptophan biosensor into which the transcriptional activator is introduced (a: Trpribo-TF16-GFP, b: Trpribo-TF32-GFP).
도 4는 전사 활성 인자 및 토홀드 스위치가 도입된 바이오센서의 트립토판 검출 메커니즘을 나타낸 도이다(a : 트립토판이 없을 경우, b : 트립토판이 존재할 경우).4 is a diagram illustrating a tryptophan detection mechanism of a biosensor into which a transcriptional activator and a toehold switch are introduced (a: no tryptophan, b: tryptophan present).
도 5는 전사 활성 인자 및 토홀드 스위치가 도입된 바이오센서를 포함하는 형질전환 균주 Trpribo-TF-P T7-TSN1-GFP 및 Trpribo-TF-P T7-TSN3-GFP의 트립토판에 대한 용량-반응 곡선을 나타낸 도이다(a : Trpribo-TF-P T7-TSN1-GFP, b : Trpribo-TF-P T7-TSN3-GFP). Figure 5 is a transgenic strain Trpribo-TF-P T7 -TSN1-GFP and Trpribo-TF-P T7 -TSN3-GFP containing a biosensor introduced with a transcriptional activator and a toehold switch dose-response curves for tryptophan. (a: Trpribo-TF-P T7- TSN1-GFP, b: Trpribo-TF-P T7- TSN3-GFP).
도 6은 토홀드 스위치 프로모터의 세기가 조절된 트립토판 바이오센서를 포함하는 형질전환 균주의 트립토판에 대한 용량-반응 곡선을 나타낸 도이다(a : Trpribo-TF-J23100-TSN1-GFP 및 Trpribo-TF-J23106-TSN1-GFP, b : Trpribo-TF-J23100-TSN3-GFP 및 Trpribo-TF-J23106-TSN3-GFP, c : Trpribo-TF-P tac-TSN3-GFP).6 is a diagram showing a dose-response curve for tryptophan of a transformed strain containing a tryptophan biosensor in which the strength of the toehold switch promoter is regulated (a: Trpribo-TF-J23100-TSN1-GFP and Trpribo-TF- J23106-TSN1-GFP, b: Trpribo-TF-J23100-TSN3-GFP and Trpribo-TF-J23106-TSN3-GFP, c: Trpribo-TF-P tac- TSN3-GFP).
도 7은 전사 활성 인자, 토홀드 스위치 및 선별 마커 TetA가 도입된 트립토판 바이오센서의 트립토판 검출 메커니즘을 나타낸 도이다(a : 트립토판이 없을 경우, b : 트립토판이 존재할 경우).7 is a diagram illustrating a tryptophan detection mechanism of a tryptophan biosensor into which a transcriptional activator, a toehold switch, and a selection marker TetA are introduced (a: in the absence of tryptophan, b: in the presence of tryptophan).
도 8은 테트라사이클린 농도에 따른 선별 마커 TetA가 도입된 트립토판 바이오센서를 포함하는 형질전환 균주의 세포 성장률을 나타낸 도이다.8 is a diagram showing the cell growth rate of a transformed strain including a tryptophan biosensor into which the selection marker TetA is introduced according to the concentration of tetracycline.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명의 양태에 따르면, 본 발명은 서열번호 1의 염기서열로 표시되는 리보스위치 및 전사 활성 인자를 포함하는 트립토판 검출용 바이오센서를 제공한다.According to an aspect of the present invention, there is provided a biosensor for detecting tryptophan comprising a riboswitch and a transcriptional activator represented by the nucleotide sequence of SEQ ID NO: 1.
본 발명에 있어서, 바이오센서(biosensor)는 생물이 가지고 있는 기능을 이용하여 물질, 특히 유기 화합물의 상태 및 농도를 측정하는 센서를 의미한다.In the present invention, a biosensor (biosensor) refers to a sensor that measures the state and concentration of a substance, particularly an organic compound, using the function of an organism.
본 발명에 있어서, 리보스위치(riboswitch)는 대사산물 등의 저분자 물질이 특이적으로 결합할 수 있는 조절부위를 의미한다. 상기 리보스위치에 특정 물질의 결합 여부에 따라 이 mRNA로부터 단백질이 합성되는 정도가 조절된다. 트랜스(trans)로 작용하는 조절 RNA들은 상보적인 부분과 염기 쌍을 형성하거나 RNA 결합 단백질을 격리시키는 형태로 작용을 한다. 리보스위치는 트랜스로 작용하는 조절 RNA와는 달리 시스(cis)로 작용을 하며 조절 대상 RNA의 일부 형태로 존재한다.In the present invention, a riboswitch refers to a regulatory region to which a low molecular weight substance such as a metabolite can specifically bind. Depending on whether a specific substance is bound to the riboswitch, the degree of protein synthesis from this mRNA is regulated. Regulatory RNAs that act as trans (trans) act in the form of base pairing with a complementary region or sequestering an RNA-binding protein. Riboswitches act in cis, unlike regulatory RNAs that act in trans, and exist in some form of regulatory RNA.
본 발명의 구체예에서, 상기 리보스위치는 서열번호 1의 염기서열로 표시되는 것이 바람직하다. 또한 상기 염기서열의 변이체가 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 1의 염기서열과 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 것으로, 서열번호 1로 표시되는 염기서열과 실질적으로 동질의 생리활성을 나타내는 서열을 의미한다. 폴리뉴클레오티드에 대한 서열 상동성의 %는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.In an embodiment of the present invention, the riboswitch is preferably represented by the nucleotide sequence of SEQ ID NO: 1. In addition, variants of the nucleotide sequence are included within the scope of the present invention. Specifically, the gene is 70% or more, more preferably 80% or more, even more preferably 90% or more, and most preferably 95% or more sequence homology with the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: It refers to a sequence that exhibits substantially the same physiological activity as the nucleotide sequence represented by 1. The % of sequence homology to a polynucleotide is determined by comparing two optimally aligned sequences with a comparison region, wherein a portion of the polynucleotide sequence in the comparison region is a reference sequence (including additions or deletions) to the optimal alignment of the two sequences. It may contain additions or deletions (ie, gaps) compared to not).
본 발명에 있어서, 전사 활성 인자(transcriptional activator)는 유전자 또는 유전자 집합의 전사를 증가시키는 단백질을 의미한다. 상기 전사 활성 인자는 보통 DNA 결합 단백질(DNA-binding protein)로, 인핸서(enhancer) 또는 프로모터(promoter)에 결합한다.In the present invention, a transcriptional activator refers to a protein that increases the transcription of a gene or a set of genes. The transcriptional activator is usually a DNA-binding protein, and binds to an enhancer or a promoter.
본 발명의 구체예에서, 상기 전사 활성 인자는 ECF 시그마 팩터(extra-cytoplasmic function sigma factor) 또는 LysR 유형의 전사 조절 인자인 것이 바람직하다.In an embodiment of the present invention, the transcriptional activator is preferably an ECF sigma factor (extra-cytoplasmic function sigma factor) or a LysR type transcriptional regulatory factor.
본 발명의 바람직한 구체예에서, 상기 ECF 시그마 팩터는 서열번호 2의 염기서열로 표시되는 ECF16 시그마 팩터 또는 서열번호 3의 염기서열로 표시되는 ECF32 시그마 팩터일 수 있다.In a preferred embodiment of the present invention, the ECF sigma factor may be an ECF16 sigma factor represented by the nucleotide sequence of SEQ ID NO: 2 or an ECF32 sigma factor represented by the nucleotide sequence of SEQ ID NO: 3.
본 발명의 구체예에서, 상기 바이오센서는 토홀드 스위치를 더 포함할 수 있다.In an embodiment of the present invention, the biosensor may further include a toe hold switch.
본 발명의 바람직한 구체예에서, 상기 토홀드 스위치는 서열번호 4의 염기서열로 표시되는 trN1 또는 서열번호 6의 염기서열로 표시되는 trN3인 트리거 RNA; 및 서열번호 5의 염기서열로 표시되는 swN1 또는 서열번호 7의 염기서열로 표시되는 swN3인 스위치 RNA;을 포함할 수 있으며, 바람직하게는 (i) 서열번호 4의 염기서열로 표시되는 trN1 및 서열번호 5의 염기서열로 표시되는 swN1; 또는 (ii) 서열번호 6의 염기서열로 표시되는 trN3 및 서열번호 7의 염기서열로 표시되는 swN3;을 포함할 수 있다.In a preferred embodiment of the present invention, the toehold switch is a trigger RNA that is trN1 represented by the nucleotide sequence of SEQ ID NO: 4 or trN3 represented by the nucleotide sequence of SEQ ID NO: 6; and a switch RNA that is swN1 represented by the nucleotide sequence of SEQ ID NO: 5 or swN3 represented by the nucleotide sequence of SEQ ID NO: 7; preferably, (i) trN1 and the sequence represented by the nucleotide sequence of SEQ ID NO: 4 swN1 represented by the nucleotide sequence of number 5; or (ii) trN3 represented by the nucleotide sequence of SEQ ID NO: 6 and swN3 represented by the nucleotide sequence of SEQ ID NO: 7.
본 발명의 구체예에서, 상기 바이오센서는 프로모터를 더 포함할 수 있다.In an embodiment of the present invention, the biosensor may further include a promoter.
본 발명의 바람직한 구체예에서, 상기 프로모터는 서열번호 8의 염기서열로 표시되는 프로모터 T7, 서열번호 9의 염기서열로 표시되는 프로모터 BBa_J23100, 서열번호 10의 염기서열로 표시되는 프로모터 BBa_J23106 및 서열번호 11의 염기서열로 표시되는 프로모터 Tac으로 이루어진 군에서 선택된 1종 이상일 수 있다.In a preferred embodiment of the present invention, the promoter is promoter T7 represented by the nucleotide sequence of SEQ ID NO: 8, promoter BBa_J23100 represented by the nucleotide sequence of SEQ ID NO: 9, promoter BBa_J23106 and SEQ ID NO: 11 represented by the nucleotide sequence of SEQ ID NO: 10 It may be one or more selected from the group consisting of promoter Tac represented by the nucleotide sequence of
본 발명의 구체예에서, 상기 바이오센서는 선택 표지 유전자를 더 포함할 수 있다.In an embodiment of the present invention, the biosensor may further include a selection marker gene.
본 발명의 바람직한 구체예에서, 상기 선택 표지 유전자는 형광 단백질 유전자 또는 항생제 저항성 유전자인 것이 바람직하나, 표지를 위한 유전자라면 제한없이 사용할 수 있다.In a preferred embodiment of the present invention, the selection marker gene is preferably a fluorescent protein gene or an antibiotic resistance gene, but any gene for labeling may be used without limitation.
본 발명의 보다 바람직한 구체예에서, 상기 형광 단백질은 GFP(green fluorescent protein), CFP(cyan fluorescent protein), BFP(blue fluorescent protein), YFP(yellow fluorescent protein) 및 RFP(red fluorescent protein)로 이루어진 군에서 선택되는 1 이상일 수 있다.In a more preferred embodiment of the present invention, the fluorescent protein is a group consisting of green fluorescent protein (GFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), and red fluorescent protein (RFP). It may be one or more selected from.
본 발명의 보다 바람직한 구체예에서, 상기 항생제 저항성 유전자는 앰피실린 저항성 유전자, 카나마이신 저항성 유전자, 클로람페니콜 저항성 유전자, 스트렙토마이신 저항성 유전자, 테트라사이클린 저항성 유전자, 겐타마이신 저항성 유전자 및 카베니실린 저항성 유전자로 이루어진 군에서 선택된 1 이상일 수 있으나, 이에 제한되지 않는다.In a more preferred embodiment of the present invention, the antibiotic resistance gene is an ampicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, a streptomycin resistance gene, a tetracycline resistance gene, a gentamicin resistance gene, and a carbenicillin resistance gene. It may be one or more selected from, but is not limited thereto.
본 발명에 따른 바이오센서는 리보스위치 및 전사 활성 인자가 작동가능하게 연결된 것이 바람직하다.In the biosensor according to the present invention, it is preferable that a riboswitch and a transcriptional activator are operatively linked.
본 발명에 있어서, 작동 가능하게 연결된다는 것은 적절한 분자가 발현 조절 서열에 결합할 때 유전자 발현을 가능하게 하는 방식으로 연결되는 것을 의미한다.In the present invention, operably linked means linked in a manner that enables gene expression when an appropriate molecule binds to an expression control sequence.
본 발명과 관련된 종래 기술(Jang, S.; Jung, G. Y. Systematic Optimization of L-Tryptophan Riboswitches for Efficient Monitoring of the Metabolite in Escherichia Coli. Biotechnol. Bioeng. 2018, 115 (1), 266-271.)에 개시된 트립토판 센서는 작동범위가 0.001 내지 1 g/L로, 작동범위가 낮아 스케일업(scale-up)에 한계가 있다. 전술한 종래 기술의 문제점을 해결하기 위하여, 본 발명은 트립토판 바이오센서의 작동범위를 조절하였다. 그 결과, 본 발명에 따른 트립토판 바이오센서의 작동범위는 트립토판의 최대 용해도를 고려하였을 때 0.01 내지 8 g/L임을 확인하였으며, 최대 용해도를 고려하지 않은 작동범위는 8 g/L 이상임을 확인하였다. 따라서 본 발명에 따른 트립토판 바이오센서는 스케일업이 가능한바, 산업용 균주의 스크리닝에 활용될 수 있다.disclosed in the prior art (Jang, S.; Jung, GY Systematic Optimization of L-Tryptophan Riboswitches for Efficient Monitoring of the Metabolite in Escherichia Coli . Biotechnol. Bioeng. 2018 , 115 (1), 266-271.) related to the present invention The tryptophan sensor has an operating range of 0.001 to 1 g/L, and there is a limit in scale-up due to a low operating range. In order to solve the problems of the prior art, the present invention has adjusted the operating range of the tryptophan biosensor. As a result, it was confirmed that the operating range of the tryptophan biosensor according to the present invention was 0.01 to 8 g/L when considering the maximum solubility of tryptophan, and it was confirmed that the operating range without considering the maximum solubility was 8 g/L or more. Therefore, the tryptophan biosensor according to the present invention can be scaled-up and used for screening of industrial strains.
본 발명의 다른 양태에 따르면, 본 발명은 상기 트립토판 검출용 바이오센서가 도입된 트립토판 검출용 형질전환 균주를 제공한다.According to another aspect of the present invention, there is provided a transformed strain for detecting tryptophan into which the biosensor for detecting tryptophan is introduced.
본 발명에 있어서, 형질전환 균주는 본 발명의 재조합 벡터로 형질전환된 균주를 의미한다.In the present invention, the transformed strain means a strain transformed with the recombinant vector of the present invention.
본 발명에 있어서, 형질전환은 본 발명에 따른 프로모터 또는 목적 유전자를 포함하는 벡터를 숙주세포 내에 도입하는 것을 의미한다. 또한, 형질전환된 목적 유전자는 숙주세포 내에 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치할 수 있다. In the present invention, transformation means introducing the vector containing the promoter or target gene according to the present invention into a host cell. In addition, as long as the transformed target gene can be expressed in the host cell, it may be inserted into the chromosome of the host cell or located outside the chromosome.
본 발명의 구체예에서, 상기 트립토판 검출용 형질전환 균주는 하나 또는 복수 개의 재조합 벡터가 도입될 수 있으며, 상기 하나 또는 복수 개의 재조합 벡터가 각각 도입될 수 있다. 또한, 상기 재조합 벡터는 미생물에 동시 또는 이시에 도입될 수 있고, 순차적으로 도입될 수도 있으며, 상호 간 순서가 바뀌어 도입될 수도 있다.In an embodiment of the present invention, one or a plurality of recombinant vectors may be introduced into the transformant strain for detecting tryptophan, and the one or a plurality of recombinant vectors may be introduced, respectively. In addition, the recombinant vector may be introduced into the microorganism at the same time or at the same time, may be introduced sequentially, may be introduced in a mutually changed order.
본 발명에 구체예에 있어서, 상기 트립토판 검출용 형질전환 균주는 박테리아, 효모, 곰팡이로 구성된 군에서 선택되는 것을 특징으로 할 수 있고, 바람직하게는 에스케리치아(Escherichia) 속 미생물일 수 있고, 더욱 바람직하게는 대장균( Escherichia coli)일 수 있다.In an embodiment of the present invention, the transformant strain for detecting tryptophan may be characterized in that it is selected from the group consisting of bacteria, yeast, and mold, and may preferably be a microorganism of the genus Escherichia, more Preferably, it may be Escherichia coli.
본 발명의 보다 바람직한 구체예에서, 상기 트립토판 검출용 형질전환 균주는 lon 유전자로 코딩되는 주요 프로테아제가 결핍된 대장균 BL21( Escherichia coli BL21)일 수 있다.In a more preferred embodiment of the present invention, the transformant strain for detecting tryptophan may be Escherichia coli BL21 (Escherichia coli BL21) lacking a major protease encoded by the lon gene.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 트립토판 검출용 형질전환 균주 및 후보 균주를 배양하는 단계를 포함하는 트립토판 고생산균 스크리닝 방법을 제공한다.According to another aspect of the present invention, the present invention provides a method for screening tryptophan high-producing bacteria comprising the step of culturing the transformant and candidate strains for detecting tryptophan.
본 발명에 따른 트립토판 검출용 형질전환 균주는 트립토판이 존재하면 선택 표지 유전자가 발현된다. 상기 트립토판 검출용 형질전환 균주 및 후보 균주와 함께 배양하고, 후보 균주가 트립토판을 생산할 경우 선택 표지 유전자가 발현되는바, 선택 표지 유전자의 발현 확인을 통해 트립토판 고생산균을 스크리닝할 수 있다.In the transformant strain for detecting tryptophan according to the present invention, the selection marker gene is expressed when tryptophan is present. Incubated with the transformant and candidate strains for detection of tryptophan, and when the candidate strain produces tryptophan, the selection marker gene is expressed, so tryptophan high-producing bacteria can be screened by confirming the expression of the selection marker gene.
또한 본 발명에 따른 트핍토판 고생산균 스크리닝 방법은 작동범위가 조절되어 스케일업이 가능한 트립토판 검출용 형질전환 균주를 이용하는바, 산업적 수준에서의 트립토판 고생산균을 스크리닝할 수 있다.In addition, the method for screening tryptophan high-producing bacteria according to the present invention uses a transformant strain for detecting tryptophan that can be scaled-up by controlling the operating range, so it is possible to screen tryptophan high-producing bacteria at an industrial level.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.
후술되는 실시예에서 이용한 균주 및 플라스미드는 하기 표 1 에 기재하였으며, 사용한 프라이머의 서열은 표 2에 나타내었다.The strains and plasmids used in Examples to be described later are shown in Table 1 below, and the sequences of the primers used are shown in Table 2.
상기 표 2에 개시된 프라이머는 Cosmogenetech(Seoul, Korea)에서 합성하였고, 프라이머 간의 상호작용 서열은 밑줄로 표시하였다.The primers disclosed in Table 2 were synthesized by Cosmogenetech (Seoul, Korea), and the interaction sequences between the primers are underlined.
관련 특성Related characteristics
균주strain
Mach-T1 R Mach-T1 R F -φ80(lacZ)ΔM15 ΔlacX74 hsdR(r K-mK+)ΔrecA1398 endA1 tonAF - φ80(lacZ)ΔM15 ΔlacX74 hsdR(r K -mK+)ΔrecA1398 endA1 tonA
BL21 Star (DE3)BL21 Star (DE3) F - ompT gal dcm hsdS B(r B -m B -)rne131 (DE3)F - ompT gal dcm hsdS B (r B - m B - )rne131 (DE3)
W3110W3110 F -λ -rph-1IN(rrnD, rrnE)F - λ - rph-1IN(rrnD, rrnE)
Trpribo-TF16-GFPTrpribo-TF16-GFP BL21 Star (DE3) / pACYC-Trpribo-ECF16-GFPBL21 Star (DE3) / pACYC-Trpribo-ECF16-GFP
Trpribo-TF-P T7-TSN1-GFPTrpribo-TF-P T7- TSN1-GFP BL21 Star (DE3) / pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFPBL21 Star (DE3) / pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP
Trpribo-TF32-GFPTrpribo-TF32-GFP BL21 Star (DE3) / pACYC-Trpribo-ECF32-GFPBL21 Star (DE3) / pACYC-Trpribo-ECF32-GFP
Trpribo-TF-P T7-TSN3-GFPTrpribo-TF-P T7- TSN3-GFP BL21 Star (DE3) / pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFPBL21 Star (DE3) / pACYC-Trpribo-ECF32-trN3-P T7- swN3-GFP
Trpribo-TF-J23100-TSN1-GFPTrpribo-TF-J23100-TSN1-GFP W3110 / pACYC-Trpribo-ECF16-trN1-J23100-swN1-GFPW3110/pACYC-Trpribo-ECF16-trN1-J23100-swN1-GFP
Trpribo-TF-J23100-TSN3-GFPTrpribo-TF-J23100-TSN3-GFP W3110 / pACYC-Trpribo-ECF32-trN3-J23100-swN3-GFPW3110/pACYC-Trpribo-ECF32-trN3-J23100-swN3-GFP
Trpribo-TF-J23106-TSN1-GFPTrpribo-TF-J23106-TSN1-GFP W3110 / pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFPW3110/pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP
Trpribo-TF-J23106-TSN3-GFPTrpribo-TF-J23106-TSN3-GFP W3110 / pACYC-Trpribo-ECF32-trN3-J23106-swN3-GFPW3110/pACYC-Trpribo-ECF32-trN3-J23106-swN3-GFP
Trpribo-TF-P tac-TSN1-GFPTrpribo-TF-P tac- TSN1-GFP W3110 / pACYC-Trpribo-ECF16-trN1-P tac-swN1-GFPW3110/pACYC-Trpribo-ECF16-trN1-P tac- swN1-GFP
Trpribo-TF-P tac-TSN3-GFPTrpribo-TF-P tac- TSN3-GFP W3110 / pACYC-Trpribo-ECF32-trN3-P tac-swN3-GFPW3110/pACYC-Trpribo-ECF32-trN3-P tac- swN3-GFP
Trpribo-TF-J23106-TSN1-tetATrpribo-TF-J23106-TSN1-tetA W3110 / pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetAW3110/pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA
Trpribo-TF-J23105-TSN1-tetATrpribo-TF-J23105-TSN1-tetA W3110 / pACYC-Trpribo-ECF16-trN1-J23105-swN1-tetAW3110/pACYC-Trpribo-ECF16-trN1-J23105-swN1-tetA
플라스미드plasmid
pACYC-B12ribo-PhlF-trN1pACYC-B12ribo-PhlF-trN1 pACYCDuet-P BBa_J23100-cbiA_rib-phlF-P PhlF-trigger_TypeII_N1pACYCDuet-P BBa_J23100 -cbiA_rib-phlF-P PhlF -trigger_TypeII_N1
pCOLA-swN1-GFPpCOLA-swN1-GFP pCOLA-P T7-switch_TypeII_N1-gfpmut3b-asvpCOLA-P T7 -switch_TypeII_N1-gfpmut3b-asv
pAC108_TR585pAC108_TR585 pACYCDuet-P J23108-TrpApt(585)-gtgtatttag-RBS-tetAsgfppACYCDuet-P J23108 -TrpApt(585)-gtgtatttag-RBS-tetAsgfp
pVRa16_3622pVRa16_3622 pVRa-P T7-ECF16_3622pVRa-P T7 -ECF16_3622
pVRa32_1122pVRa32_1122 pVRa-P T7-ECF32_1122pVRa-P T7 -ECF32_1122
pACYC-Trpribo-ECF16-trN1pACYC-Trpribo-ECF16-trN1 pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF16_3622-P ECF16_3622-trigger_TypeII_N1pACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF16_3622-P ECF16_3622 -trigger_TypeII_N1
pACYC-Trpribo-ECF16-GFPpACYC-Trpribo-ECF16-GFP pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF16_3622-P ECF16_3622- gfpmut3b-asvpACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF16_3622-P ECF16_3622 -gfpmut3b-asv
pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFPpACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF16_3622-P ECF16_3622-trigger_TypeII_N1-P T7-switch_TypeII_N1-gfpmut3b-asvpACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF16_3622-P ECF16_3622 -trigger_TypeII_N1-P T7 -switch_TypeII_N1-gfpmut3b-asv
pACYC-B12ribo-PhlF-trN3pACYC-B12ribo-PhlF-trN3 pACYCDuet-P BBa_J23100-cbiA_rib-phlF-P PhlF-trigger_TypeII_N3pACYCDuet-P BBa_J23100 -cbiA_rib-phlF-P PhlF -trigger_TypeII_N3
pCOLA-swN3-GFPpCOLA-swN3-GFP pCOLA-P T7-switch_TypeII_N3-gfpmut3b-asvpCOLA-P T7 -switch_TypeII_N3-gfpmut3b-asv
pACYC-Trpribo-ECF32-trN3pACYC-Trpribo-ECF32-trN3 pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122-trigger_TypeII_N3pACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122 -trigger_TypeII_N3
pACYC-Trpribo-ECF32-GFPpACYC-Trpribo-ECF32-GFP pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122- gfpmut3b-asvpACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122 -gfpmut3b-asv
pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFPpACYC-Trpribo-ECF32-trN3-P T7- swN3-GFP pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122-trigger_TypeII_N3-P T7-switch_TypeII_N3-gfpmut3b-asvpACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122 -trigger_TypeII_N3-P T7 -switch_TypeII_N3-gfpmut3b-asv
pACYC-Trpribo-ECF16-trN1-J23100-swN1-GFPpACYC-Trpribo-ECF16-trN1-J23100-swN1-GFP pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF16_1122-P ECF16_3622-trigger_TypeII_N1-P BBa_J23100-switch_TypeII_N1-gfpmut3b-asvpACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF16_1122-P ECF16_3622 -trigger_TypeII_N1-P BBa_J23100 -switch_TypeII_N1-gfpmut3b-asv
pACYC-Trpribo-ECF32-trN3-J23100-swN3-GFPpACYC-Trpribo-ECF32-trN3-J23100-swN3-GFP pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122-trigger_TypeII_N3-P BBa_J23100-switch_TypeII_N3-gfpmut3b-asvpACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122 -trigger_TypeII_N3-P BBa_J23100 -switch_TypeII_N3-gfpmut3b-asv
pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFPpACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF16_1122-P ECF16_3622-trigger_TypeII_N1-P BBa_J23106-switch_TypeII_N1-gfpmut3b-asvpACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF16_1122-P ECF16_3622 -trigger_TypeII_N1-P BBa_J23106 -switch_TypeII_N1-gfpmut3b-asv
pACYC-Trpribo-ECF32-trN3-J23106-swN3-GFPpACYC-Trpribo-ECF32-trN3-J23106-swN3-GFP pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122-trigger_TypeII_N3-P BBa_J23106-switch_TypeII_N3-gfpmut3b-asvpACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122 -trigger_TypeII_N3-P BBa_J23106 -switch_TypeII_N3-gfpmut3b-asv
pACYC-Trpribo-ECF16-trN1-P tac-swN1-GFPpACYC-Trpribo-ECF16-trN1-P tac- swN1-GFP pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF16_1122-P ECF16_3622-trigger_TypeII_N1-P tac-switch_TypeII_N1-gfpmut3b-asvpACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF16_1122-P ECF16_3622 -trigger_TypeII_N1-P tac -switch_TypeII_N1-gfpmut3b-asv
pACYC-Trpribo-ECF32-trN3-P tac-swN3-GFPpACYC-Trpribo-ECF32-trN3-P tac- swN3-GFP pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122-trigger_TypeII_N3-P tac-switch_TypeII_N3-gfpmut3b-asvpACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF32_1122-P ECF32_1122 -trigger_TypeII_N3-P tac -switch_TypeII_N3-gfpmut3b-asv
pCDF-3HPselectorpCDF-3HPselector pCDF-PBBa_J23106::synUTR C4lysR-C4lysR::terminator-P C4M::synUTR tetA-tetApCDF-PBBa_J23106::synUTR C4lysR -C4lysR::terminator-P C4M ::synUTR tetA -tetA
pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetApACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF16_1122-P ECF16_3622-trigger_TypeII_N1-P BBa_J23106-switch_TypeII_N1-tetApACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF16_1122-P ECF16_3622 -trigger_TypeII_N1-P BBa_J23106 -switch_TypeII_N1-tetA
pACYC-Trpribo-ECF16-trN1-J23105-swN1-tetApACYC-Trpribo-ECF16-trN1-J23105-swN1-tetA pACYCDuet-P BBa_J23108-TrpApt(585)-gtgtatttag-ECF16_1122-P ECF16_3622-trigger_TypeII_N1-P BBa_J23105-switch_TypeII_N1-tetApACYCDuet-P BBa_J23108 -TrpApt(585)-gtgtatttag-ECF16_1122-P ECF16_3622 -trigger_TypeII_N1-P BBa_J23105 -switch_TypeII_N1-tetA
명칭designation 서열 (5′-3′)sequence (5′-3′) 서열번호SEQ ID NO:
프라이머primer
Gib-trN1-FGib-trN1-F GCTCGATCACTAATCTGATCG GCTCGATCACTAATCTGATCG 1414
Gib-over-Trpribo-RGib-over-Trpribo-R AGGACTGAGCTAGCTGTCAGGAGCTCGAATTCGGATCCTGG AGGACTGAGCTAGCTGTCAG GAGCTCGAATTCGGATCCTGG 1515
Gib-Trpribo-Homo-FGib-Trpribo-Homo-F CTGACAGCTAGCTCAGTCCT CTGACAGCTAGCTCAGTCCT 1616
Gib-Trpribo-Homo-RGib-Trpribo-Homo-R AGATGCTCCTTCTAAATACACATC AGATGCTCCTTCTAAATACACATC 1717
Gib-TF16-over-Trpribo-In-FGib-TF16-over-Trpribo-In-F GATGTGTATTTAGAAGGAGCATCTATGCAGCGTACCAATAGCCAG GATGTGTATTTAGAAGGAGCATCT ATGCAGCGTACCAATAGCCAG 1818
TF16-over-P16-1-RTF16-over-P16-1-R GTTCGTTGCATCGGCCGCCAGGGTTACACCGTCGGTGGGTTTCTTTTCATCCAAGTTCAGGGCAGGGTCGTTAAATAGCCGCTGTTCGTTGCATCGGCCGCCAGGGTTACACCGTCGGTGGGTTTCTTTTCATCCAAGTTCAGGGCAGGGTCGTTAAATAGCCGCT 1919
Gib-P16-over-trN1-RGib-P16-over-trN1-R CTCGATCAGATTAGTGATCGAGCGGTGCTGAGCACGTCCTGTGAGTTAGTTCGTTGCATCGGCCGCCA CTCGATCAGATTAGTGATCGAG CGGTGCTGAGCACGTCCTGTGAGTTAGTTCGTTGCATCGGCCGCCA 2020
Gib-TF32-over-Trpribo-ln-FGib-TF32-over-Trpribo-ln-F GTGTATTTAGAAGGAGCATCTATGACCGAAATTCATCTGCAGACCACGTGTATTTAGAAGGAGCATCTATGACCGAAATTCATCTGCAGACCAC 2121
TF32-over-P32-1-RTF32-over-P32-1-R ATTGTGTGGTGCGATTGACGCATCGGTTCCCTGGCCATGCCGCTGTTAAATAAAGTCGCTTCAGGGCAGGGTCGTTAAATATTGTGTGGTGCGATTGACGCATCGGTTCCCTGGCCATGCCGCTGTAAATAAAGTCGCTTCAGGGCAGGGTCGTTAAAT 2222
Gib-P32-over-trN3-RGib-P32-over-trN3-R ATAGAAGTTTAGTA GTGTTATACACATGATTCTATGTGTATCTCAATGATGAGAGCAGTTGTCATTGTGTGGTGCGATTGACGATAGAAGTTTAGTA GTGTTATACACATGATTCTATGTGTATC TCAATGATGAGAGCAGTTGTCATTGTGTGGTGCGATTGACG 2323
Gib-trN3-FGib-trN3-F GATACACATAGAATCATGTGTATAACACGATACACATAGAATCATGTGTATAACAC 2424
Gib-Vec-FGib-Vec-F GTATCCGCTCATGAATTAATTCGTATCCGCTCATGAATTAATTC 2525
Gib-Vec-RGib-Vec-R CAGTTCGGCTTCTGGGTACCTCATCTTAAACGCCTGGTGCTACG CAGTTCGGCTTCTGGGTACCTCATC TTAAACGCCTGGTGCTACG 2626
Gib-In-FGib-In-F GATGAGGTACCCAGAAGCCGAACTGGAAGTCTAACGCTGCTCTG GATGAGGTACCCAGAAGCCGAACTG GAAGTCTAACGCTGCTCTG 2727
Gib-In-RGib-In-R GAATTAATTCATGAGCGGATACGAATTAATTCATGAGCGGATAC 2828
Change-promoter-RChange-promoter-R GCGCGACAGTTAGCCCAGAGGCGCGACAGTTAGCCCAGAG 2929
Sw1-J23100-FSw1-J23100-F TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCGAGTAAGATAATGAAGGTAGGTATGTTTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCGAGTAAGATAATGAAGGTAGGTATGTT 3030
Sw3-J23100-FSw3-J23100-F TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCGATTGAATATGATAGAAGTTTAGTAGTTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCGATTGAATATGATAGAAGTTTAGTAGT 3131
Sw1-J23106-FSw1-J23106-F TTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCGAGTAAGATAATGAAGGTAGGTATGTTTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCGAGTAAGATAATGAAGGTAGGTATGTT 3232
Sw3-J23106-FSw3-J23106-F TTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCGATTGAATATGATAGAAGTTTAGTAGTTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCGATTGAATATGATAGAAGTTTAGTAGT 3333
Sw1-P tac-FSw1-P tac -F TTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATT GAGTAAGATAATGAAGGTAGGTATGTTATTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATT GAGTAAGATAATGAAGGTAGGTATGTTA 3434
Sw3-P tac-FSw3-P tac -F TTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATT GATTGAATATGATAGAAGTTTAGTATTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATT GATTGAATATGATAGAAGTTTAGTA 3535
TetA-In-FTetA-In-F CTCATCGTCATCCTCGGCACCTCATCGTCATCCTCGGCAC 3636
TetA-In-RTetA-In-R GCCGTGCCGCTCTGGTTTATCAGCCTAGGTCAGGTCGAGGTGGCCCG GCCGTGCCGCTCTGGTTTATC AGCCTAGGTCAGGTCGAGGTGGCCCG 3737
Vec-FVec-F GATAAACCAGAGCGGCACGGCGATAAACCAGAGCGGCACGGC 3838
Vec-RVec-R GTGCCGAGGATGACGATGAGCGCATTGTTAGATTTCATCTTTTGCGCTGCCGCCAGGTTC GTGCCGAGGATGACGATGAG CGCATTGTTAGATTTCATCTTTTGCGCTGCCGCCAGGTTC 3939
Sw1-J23105-FSw1-J23105-F TTTACGGCTAGCTCAGTCCTAGGTACTATGCTAGCGAGTAAGATAATGAAGGTAGGTATGTTAAACTTTATTTACGGCTAGCTCAGTCCTAGGTACTATGCTAGCGAGTAAGATAATGAAGGTAGGTATGTTAAACTTTA 4040
실시예 1. 전사 활성 인자가 도입된 트립토판 바이오센서 구축 및 성능 확인Example 1. Construction of tryptophan biosensor introduced with transcriptional activator and confirmation of performance
전사 활성 인자가 도입된 트립토판 바이오센서를 구축하기 위하여, 트립토판 리보스위치(서열번호 1) 및 리포터 유전자 GFP(서열번호 12)를 포함하는 트립토판 바이오센서에 전사 활성 인자를 삽입하였다. 상기 전사 활성 인자인 ECF 시그마 팩터(extra-cytoplasmic function sigma factor)는 특정 프로모터 서열을 인식하여 유전자 발현을 활성화시킨다. 본 실시예에서는, Caulobacter crescentus 유래의 전사 활성 인자 ECF16 시그마 팩터(서열번호 2)와, plant pathogens 유래의 전사 활성 인자 ECF32 시그마 팩터(서열번호 3)를 이용하여 두 가지 종류의 전사 활성 인자를 이용하였다.In order to construct a tryptophan biosensor into which the transcriptional activator is introduced, a transcriptional activator was inserted into the tryptophan biosensor including the tryptophan riboswitch (SEQ ID NO: 1) and the reporter gene GFP (SEQ ID NO: 12). The transcriptional activator ECF sigma factor (extra-cytoplasmic function sigma factor) recognizes a specific promoter sequence and activates gene expression. In this example, two types of transcriptional activators were used using the transcriptional activator ECF16 sigma factor (SEQ ID NO: 2) derived from Caulobacter crescentus and the transcriptional activator ECF32 sigma factor (SEQ ID NO: 3) derived from plant pathogens. .
구축된 트립토판 바이오센서의 성능은 용량-반응 곡선을 통해 확인하였다. 도 1은 용량-반응 곡선을 예시로 나타낸 것인데, 이로부터 대사 산물의 농도에 따른 출력 모듈의 (i) 발현량 변화(즉, 배수 변화) 및 (ii) 상기 발현량 변화가 나타나는 구간인 작동 범위를 확인할 수 있다. 상기 배수 변화(fold activation)는 최대 발현량과 최소 발현량의 비율(최대 발현량/최소 발현량)으로 계산된 값이다. The performance of the constructed tryptophan biosensor was confirmed through a dose-response curve. 1 shows a dose-response curve as an example, from which (i) expression level change (ie, fold change) and (ii) an operating range of the output module according to the concentration of metabolites, and (ii) the interval in which the expression level change appears. can be checked. The fold activation is a value calculated as the ratio of the maximum expression level to the minimum expression level (maximum expression level/minimum expression level).
1-1. 플라스미드 pACYC-Trpribo-ECF16-GFP가 도입된 형질전환 균주 구축1-1. Plasmid pACYC-Trpribo-ECF16-GFP introduced transformed strain construction
토홀드 스위치 없이 작동하는 트립토판 바이오센서인 플라스미드 pACYC-Trpribo-ECF16-GFP를 구축하였고, 이를 도입한 형질전환 균주 Trpribo-TF16-GFP를 구축하였다. 상기 플라스미드 pACYC-Trpribo-ECF16-GFP는 토홀드 스위치 및 프로모터가 포함된 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP의 일부를 증폭 및 연결하여 구축하였다.A plasmid pACYC-Trpribo-ECF16-GFP, which is a tryptophan biosensor operating without a toehold switch, was constructed, and a transformed strain Trpribo-TF16-GFP introduced thereto was constructed. The plasmid pACYC-Trpribo-ECF16-GFP was constructed by amplifying and ligating a part of the plasmid pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP containing the toehold switch and promoter.
보다 상세한 방법은 다음과 같다.A more detailed method is as follows.
[pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP 구축][Construction of pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP]
트리거 RNA인 trN1(서열번호 4), 스위치 RNA인 swN1(서열번호 5) 및 프로모터 T7(서열번호 8)을 포함하는 트립토판 센서를 구축하였다. 구체적으로, 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP를 구축하기 위하여, 플라스미드 pACYC-Trpribo-ECF16-trN1를 구축하였다. 구체적으로, Q5 High-Fidelity DNA Polymerase(New England Biolabs (NEB), Ipswich, MA, USA)를 이용하여 3종의 증폭 산물 1 내지 3을 제조하였다. A tryptophan sensor including trigger RNA trN1 (SEQ ID NO: 4), switch RNA swN1 (SEQ ID NO: 5) and promoter T7 (SEQ ID NO: 8) was constructed. Specifically, to construct the plasmid pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP, the plasmid pACYC-Trpribo-ECF16-trN1 was constructed. Specifically, three types of amplification products 1 to 3 were prepared using Q5 High-Fidelity DNA Polymerase (New England Biolabs (NEB), Ipswich, MA, USA).
- 증폭 산물 1 : 증폭 산물 1은 트립토판 리보스위치 서열을 포함하는 것으로, 프라이머 Gib-Trpribo-Homo-F/R을 사용하여 플라스미드 pAC108_TR585를 증폭하여 얻은 것이다. - Amplification product 1: Amplification product 1 contains a tryptophan riboswitch sequence and was obtained by amplifying plasmid pAC108_TR585 using the primer Gib-Trpribo-Homo-F/R.
- 증폭 산물 2 : 증폭 산물 2는 전사 활성 인자(transcriptional activator) 서열 및 상기 전사 인자에 의해 조절되는 프로모터 서열 및 트리거(trigger) 서열 일부를 포함한다. 상기 증폭 산물 2는 프라이머 Gib-TF16-over-Trpribo-In-F 및 TF16-over-P16-1-R을 사용하여 플라스미드 pVRa16-3622를 증폭하여 얻은 산물이며, 이를 프라이머 Gib-TF16-over-Trpribo-In-F 및 Gib-P16-over-trN1-R로 증폭하여 증폭 산물, 즉 증폭 산물 2를 얻었다.- Amplification product 2: Amplification product 2 includes a transcriptional activator sequence and a part of a promoter sequence and a trigger sequence regulated by the transcription factor. The amplification product 2 is a product obtained by amplifying plasmid pVRa16-3622 using primers Gib-TF16-over-Trpribo-In-F and TF16-over-P16-1-R, which was obtained by amplifying the primer Gib-TF16-over-Trpribo. -In-F and Gib-P16-over-trN1-R were amplified to obtain an amplification product, that is, amplification product 2.
- 증폭 산물 3 : 프라이머 Gib-trN1-F 및 Gib-over-Trpribo-R를 사용하여 플라스미드 pACYC-B12ribo-PhlF-trN1를 증폭하여 증폭 산물 3을 얻었다.- Amplification product 3: Amplification product 3 was obtained by amplifying plasmid pACYC-B12ribo-PhlF-trN1 using primers Gib-trN1-F and Gib-over-Trpribo-R.
상기 증폭 산물 1 내지 3을 NEBuilder® HiFi DNA Assembly Master Mix(NEB)를 이용하여 깁슨 어셈블리 방식으로 연결하여, 플라스미드 pACYC-Trpribo-ECF16-trN1를 제작하였다. 또한 (i) 프라이머 Gib-Vec-F/R를 사용하여 상기 플라스미드 pACYC-Trpribo-ECF16-trN1을 증폭한 산물; 및 (ii) 프라이머 Gib-In-F/R를 사용하여 플라스미드 pCOLA-swN1-GFP를 증폭한 산물(토홀드 스위치(toehold switch) 및 형광 단백질 서열을 포함);을 깁슨 어셈블리 방식으로 연결하여, 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP를 구축하였다.The amplification products 1 to 3 were ligated in the Gibson assembly method using NEBuilder® HiFi DNA Assembly Master Mix (NEB) to construct plasmid pACYC-Trpribo-ECF16-trN1. Also, (i) the product of amplification of the plasmid pACYC-Trpribo-ECF16-trN1 using the primers Gib-Vec-F/R; and (ii) a product of amplification of plasmid pCOLA-swN1-GFP using primers Gib-In-F/R (including a toehold switch and a fluorescent protein sequence); pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP was constructed.
[pACYC-Trpribo-ECF16-GFP 구축][Construction of pACYC-Trpribo-ECF16-GFP]
T4 Polynucleotide Kinase(Takara, Shiga, Japan)를 사용하여 프라이머 Gib-del-F 및 Gib-del-R의 5‘ 말단을 인산화시켰다. 5’ 말단이 인산화된 프라이머인 Gib-del-F/R를 사용하여, 상기 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP를 증폭하였다. 증폭 산물을 Quick Ligase(NEB)를 이용하여 blunt-end ligation으로 연결하여, 플라스미드 pACYC-Trpribo-ECF16-GFP를 구축하였다. E. coli BL21 Star(DE3)를 상기 플라스미드 pACYC-Trpribo-ECF16-GFP로 형질전환시켰으며, 형질전환된 균주는 Trpribo-TF16-GFP로 명명하였다.The 5' ends of primers Gib-del-F and Gib-del-R were phosphorylated using T4 Polynucleotide Kinase (Takara, Shiga, Japan). The plasmid pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP was amplified using Gib-del-F/R, a primer with phosphorylated 5' end. The amplification product was ligated by blunt-end ligation using Quick Ligase (NEB) to construct a plasmid pACYC-Trpribo-ECF16-GFP. E. coli BL21 Star (DE3) was transformed with the plasmid pACYC-Trpribo-ECF16-GFP, and the transformed strain was named Trpribo-TF16-GFP.
1-2. 플라스미드 pACYC-Trpribo-ECF32-GFP가 도입된 형질전환 균주 구축1-2. Plasmid pACYC-Trpribo-ECF32-GFP introduced transformed strain construction
토홀드 스위치 없이 작동하는 트립토판 바이오센서인 플라스미드 pACYC-Trpribo-ECF32-GFP를 구축하였고, 이를 도입한 형질전환 균주 Trpribo-TF32-GFP를 구축하였다. 상기 플라스미드 pACYC-Trpribo-ECF32-GFP는 토홀드 스위치 및 프로모터가 포함된 플라스미드 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP의 일부를 증폭 및 연결하여 구축하였다.A plasmid pACYC-Trpribo-ECF32-GFP, a tryptophan biosensor operating without a toehold switch, was constructed, and a transformed strain Trpribo-TF32-GFP introduced thereto was constructed. The plasmid pACYC-Trpribo-ECF32-GFP was constructed by amplifying and ligating a part of the plasmid pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP containing the toehold switch and promoter.
보다 상세한 방법은 다음과 같다.A more detailed method is as follows.
[pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP 구축][Construction of pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP]
트리거 RNA인 trN3(서열번호 6), 스위치 RNA인 swN3(서열번호 7) 및 프로모터 T7(서열번호 8)을 포함하는 트립토판 센서를 구축하였다. 구체적으로, 트립토판 센서인 플라스미드 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP를 구축하기 위하여, 다음과 같이 증폭 산물 1 내지 3을 제조하였다.A tryptophan sensor including trigger RNA trN3 (SEQ ID NO: 6), switch RNA swN3 (SEQ ID NO: 7) and promoter T7 (SEQ ID NO: 8) was constructed. Specifically, in order to construct the tryptophan sensor plasmid pACYC-Trpribo-ECF32-trN3-P T7- swN3-GFP, amplification products 1 to 3 were prepared as follows.
- 증폭 산물 1 : 증폭 산물 1은 전사 활성 인자 서열과 이에 반응할 수 있는 프로모터 서열을 포함하는 것이다. 증폭 산물 1을 얻기 위해, 프라이머 Gib-TF32-over-Trpribo-ln-F/TF32-over-P32-1-R을 사용하여 플라스미드 pVRa32-1122를 증폭하였다. 상기 증폭 산물을 프라이머 Gib-TF32-over-Trpribo-In-F 및 Gib-P32-over-trN3-R를 사용하여 추가 증폭하여, 최종적으로 증폭 산물 1을 얻었다.- Amplification product 1: Amplification product 1 includes a transcriptional activator sequence and a promoter sequence capable of reacting therewith. To obtain amplification product 1, plasmid pVRa32-1122 was amplified using primers Gib-TF32-over-Trpribo-ln-F/TF32-over-P32-1-R. The amplification product was further amplified using primers Gib-TF32-over-Trpribo-In-F and Gib-P32-over-trN3-R to finally obtain amplification product 1.
- 증폭 산물 2 : 프라이머 Gib-trN3-F 및 Gib-over-Trpribo-R를 사용하여 플라스미드 pACYC-B12ribo-PhlF-trN3를 증폭하여, 나머지 트리거 서열을 포함하는 증폭 산물 2를 얻었다. - Amplification product 2: plasmid pACYC-B12ribo-PhlF-trN3 was amplified using primers Gib-trN3-F and Gib-over-Trpribo-R to obtain amplification product 2 containing the remaining trigger sequences.
증폭 산물 1 및 2를 실시예 2-1과 동일한 깁슨 어셈블리를 방식으로 연결하여, 플라스미드 pACYC-Trpribo-ECF32-trN3를 구축하였다. 또한 (i) 프라이머 Gib-Vec-F/R를 사용하여 상기 플라스미드 pACYC-Trpribo-ECF32-trN3을 증폭한 산물; 및 (ii) 프라이머 Gib-In-F/R를 사용하여 플라스미드 pCOLA-swN3-GFP를 증폭한 산물(토홀드 스위치 서열 및 형광 단백질 서열을 포함);을 깁슨 어셈블리 방식으로 연결하여, 플라스미드 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP를 구축하였다. Amplification products 1 and 2 were ligated in the same manner as in Example 2-1 with the same Gibson assembly to construct plasmid pACYC-Trpribo-ECF32-trN3. Also, (i) the product of amplification of the plasmid pACYC-Trpribo-ECF32-trN3 using the primer Gib-Vec-F/R; and (ii) a product of amplification of plasmid pCOLA-swN3-GFP using primers Gib-In-F/R (including a threshold switch sequence and a fluorescent protein sequence); -ECF32-trN3-P T7 -swN3-GFP was constructed.
[pACYC-Trpribo-ECF32-GFP 구축][Construction of pACYC-Trpribo-ECF32-GFP]
또한 상기 실시예 1-1과 같은 방법으로 벡터 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP의 일부를 증폭 및 연결하여, 플라스미드 pACYC-Trpribo-ECF32-GFP를 구축하였다. E. coli BL21 Star(DE3)를 상기 플라스미드 pACYC-Trpribo-ECF32-GFP로 형질전환시켰으며, 형질전환된 균주는 Trpribo-TF32-GFP로 명명하였다.In addition, a part of the vector pACYC-Trpribo-ECF32-trN3-P T7- swN3-GFP was amplified and ligated in the same manner as in Example 1-1 to construct a plasmid pACYC-Trpribo-ECF32-GFP. E. coli BL21 Star (DE3) was transformed with the plasmid pACYC-Trpribo-ECF32-GFP, and the transformed strain was named Trpribo-TF32-GFP.
전사 활성 인자가 도입된 트립토판 바이오센서의 트립토판 검출 메커니즘은 도 2에 나타내었으며, 구축된 플라스미드 pACYC-Trpribo-ECF16-GFP 및 pACYC-Trpribo-ECF32-GFP는 도 2와 같은 메커니즘으로 작동한다.The tryptophan detection mechanism of the tryptophan biosensor introduced with the transcriptional activator is shown in FIG. 2 , and the constructed plasmids pACYC-Trpribo-ECF16-GFP and pACYC-Trpribo-ECF32-GFP operate with the same mechanism as in FIG. 2 .
도 2에 나타낸 바와 같이, 상기 플라스미드 pACYC-Trpribo-ECF16-GFP 및 pACYC-Trpribo-ECF32-GFP는 전사 활성 인자는 포함하나, 토홀드 스위치는 포함하지 않는다. 상기 두 플라스미드는 트립토판이 존재하지 않을 경우 발현되지 않으며(도 2a), 트립토판이 존재할 경우 발현되어 GFP를 발현한다(도 2b).As shown in FIG. 2 , the plasmids pACYC-Trpribo-ECF16-GFP and pACYC-Trpribo-ECF32-GFP contain transcriptional activators, but do not include a toehold switch. The two plasmids are not expressed in the absence of tryptophan ( FIG. 2A ), and are expressed in the presence of tryptophan to express GFP ( FIG. 2B ).
1-3. 형광 측정을 통한 전사 활성 인자가 도입된 트립토판 바이오센서의 성능 확인1-3. Confirmation of performance of tryptophan biosensor introduced with transcriptional activator through fluorescence measurement
트립토판 바이오센서의 성능을 확인하기 위하여, 배양 실험을 수행하였다.In order to confirm the performance of the tryptophan biosensor, a culture experiment was performed.
상기 배양 실험은 포도당이 포함된 M9 배지(4 g/L glucose, 6.78 g/L disodium phosphate(anhydrous), 3 g/L monopotassium phosphate, 0.5 g/L sodium chloride, 1 g/L ammonium chloride, 2 mM magnesium sulfate 및 0.1 mM calcium chloride)를 사용하였고, 플라스미드를 유지하기 위한 항생제로 클로람페니콜 34 mg/L를 첨가했다. 상기 실시예 1-2에서 구축된 형질전환 균주를 M9 배지에 접종한 후 24시간 동안 배양하였다. 배양된 균주는 OD 600 값이 0.05가 되도록 새로운 M9 배지에 희석하였고, OD 600 값이 0.8에 도달하였을 때, 새로운 M9 배지에 OD 600 값이 0.05가 되도록 희석하였다. 그 후 지수성장기(exponential phase)에 도달하였을 때 다양한 농도의 트립토판(0, 0.01, 0.03, 0.1, 0.3, 1, 2, 4, 6 및 8 g/L)이 첨가된 배지로 균주를 옮겨 후기 지수성장기(late-exponential phase)까지 배양하였다. The culture experiment was performed in M9 medium containing glucose (4 g / L glucose, 6.78 g / L disodium phosphate (anhydrous), 3 g / L monopotassium phosphate, 0.5 g / L sodium chloride, 1 g / L ammonium chloride, 2 mM magnesium sulfate and 0.1 mM calcium chloride) were used, and chloramphenicol 34 mg/L was added as an antibiotic to maintain the plasmid. The transformant strain constructed in Example 1-2 was inoculated in M9 medium and then cultured for 24 hours. The cultured strain was diluted in fresh M9 medium so that the OD 600 value was 0.05, and when the OD 600 value reached 0.8, the OD 600 value was diluted to 0.05 in the new M9 medium. After that, when the exponential phase is reached, the strain is transferred to a medium to which various concentrations of tryptophan (0, 0.01, 0.03, 0.1, 0.3, 1, 2, 4, 6 and 8 g/L) are added to the late exponential phase It was cultured until the late-exponential phase.
배양된 균주를 PBS(phosphate-buffered saline)로 1 회 세척 후 형광을 측정하였다. 상기 형광 측정은 485 nm의 전이 필터, 535 nm의 발광 필터 및 VICTOR 3 1420 Multilabel Counter(PerkinElmer, Waltham, MA, USA)를 이용하였고, 형광 세기는 0.1 초 동안 측정하였다. 측정된 형광 값에서 PBS 측정 값을 빼서 값을 보정하였고, 균주의 자발발광(autofluorescence)은 측정된 형광 값에서 빼지 않았다. The cultured strain was washed once with PBS (phosphate-buffered saline), and then fluorescence was measured. The fluorescence was measured using a 485 nm transfer filter, a 535 nm emission filter, and a VICTOR 3 1420 Multilabel Counter (PerkinElmer, Waltham, MA, USA), and the fluorescence intensity was measured for 0.1 second. The value was corrected by subtracting the PBS measurement value from the measured fluorescence value, and autofluorescence of the strain was not subtracted from the measured fluorescence value.
특이적 형광(specific fluorescence)을 계산하기 위해, 각각 1, 0.8, 0.5, 0.25 및 0.125배로 희석된 균주 배양액을 VICTOR 3 1420 Multilabel Counter(PerkinElmer) 및 UV-1700 spectrophotometer(Shimadzu, japan)로 각각 측정한 후 보정 곡선을 작성하였다. 그 후 보정 곡선에 기초하여 VICTOR 3 1420 Multilabel Counter로 측정한 각 샘플의 OD 600을 UV-1700 값으로 변환하였다. 특이적 형광(specific fluorescence)은 보정된 형광 값을 보정된 OD 600값으로 나누어 계산하였다. 계산 값은 배수 변화로 변환하여 표시하였다.To calculate specific fluorescence, strain cultures diluted 1, 0.8, 0.5, 0.25, and 0.125 times , respectively, were measured with a VICTOR 3 1420 Multilabel Counter (PerkinElmer) and a UV-1700 spectrophotometer (Shimadzu, Japan), respectively. Afterwards, a calibration curve was prepared. Then, based on the calibration curve, the OD 600 of each sample measured with the VICTOR 3 1420 Multilabel Counter was converted into a UV-1700 value. Specific fluorescence was calculated by dividing the corrected fluorescence value by the corrected OD 600 value. The calculated value was converted to fold change and displayed.
상기 플라스미드로 각각 형질전환된 균주 Trpribo-TF16-GFP 및 Trpribo-TF32-GFP의 트립토판 용량-반응 곡선은 도 3a 및 b에 각각 나타내었다.The tryptophan dose-response curves of the strains Trpribo-TF16-GFP and Trpribo-TF32-GFP transformed with the plasmid, respectively, are shown in FIGS. 3A and 3B , respectively.
도 3a에 나타낸 바와 같이, 트립토판을 다양한 농도로 포함하는 배지에서 형질전환 균주 Trpribo-TF16-GFP를 배양한 결과, 이의 트립토판 바이오센서의 작동범위는 1 내지 8 g/L이고, 배수 변화는 2.08배임을 확인하였다.As shown in Figure 3a, as a result of culturing the transformant strain Trpribo-TF16-GFP in a medium containing tryptophan at various concentrations, the operating range of its tryptophan biosensor is 1 to 8 g / L, and the fold change is 2.08 times was confirmed.
도 3b에 나타낸 바와 같이, 트립토판을 다양한 농도로 포함하는 배지에서 형질전환 균주 Trpribo-TF32-GFP를 배양한 결과, 이의 트립토판 바이오센서의 작동범위는 0.01 내지 8 g/L이고, 배수 변화는 1.64배임을 확인하였다.As shown in Figure 3b, as a result of culturing the transformed strain Trpribo-TF32-GFP in a medium containing tryptophan at various concentrations, the operating range of its tryptophan biosensor is 0.01 to 8 g/L, and the fold change is 1.64 times was confirmed.
이 때 트립토판의 농도 8 g/L는 트립토판의 최대 용해도를 고려하여 선정된 것이다.At this time, the tryptophan concentration of 8 g/L is selected in consideration of the maximum solubility of tryptophan.
상기의 형질전환 균주 Trpribo-TF16-GFP 및 Trpribo-TF32-GFP의 작동 범위는 종래 개발된 트립토판 바이오센서의 작동범위(0.001 내지 1 g/L)와 비교했을 때 최소 및 최대값이 모두 증가했다. 특히, 최대값은 1g/L에서 8g/L로 8배 증가함을 확인했다. 또한 상기 형질전환 균주 Trpribo-TF16-GFP 및 Trpribo-TF32-GFP의 배수 변화는 종래 개발된 트립토판 바이오센서의 배수 변화(1.58배)에 비해 최대 약 32% 증가하였다. 이는 트립토판 바이오센서에 전사 활성 인자 및 이에 해당하는 프로모터 서열을 도입함으로써, 트립토판 바이오센서의 작동범위 및 배수 변화를 조절할 수 있다는 것을 의미한다.The operating ranges of the above-mentioned transforming strains Trpribo-TF16-GFP and Trpribo-TF32-GFP increased both the minimum and maximum values compared to the operating range (0.001 to 1 g/L) of the previously developed tryptophan biosensor. In particular, it was confirmed that the maximum value increased 8-fold from 1 g/L to 8 g/L. In addition, the fold change of the transgenic strains Trpribo-TF16-GFP and Trpribo-TF32-GFP was increased by up to about 32% compared to the fold change (1.58 fold) of the conventionally developed tryptophan biosensor. This means that by introducing a transcriptional activator and a promoter sequence corresponding to the tryptophan biosensor, the operating range and fold change of the tryptophan biosensor can be controlled.
실시예 2. 전사 활성 인자 및 토홀드 스위치 시스템이 도입된 트립토판 바이오센서 구축 및 성능 확인Example 2. Transcriptional activator and toehold switch system introduced tryptophan biosensor construction and performance confirmation
상기 실시예 1로부터 전사 활성 인자의 도입이 트립토판 바이오센서의 작동범위 및 배수 범위를 조절할 수 있다는 것을 확인하였다. 이에, 전사 활성 인자 및 토홀드 스위치 시스템이 도입된 트립토판 바이오센서를 구축하고, 이의 성능을 평가하였다. From Example 1, it was confirmed that the introduction of the transcriptional activator can control the operating range and fold range of the tryptophan biosensor. Accordingly, a tryptophan biosensor into which a transcriptional activator and a toehold switch system were introduced was constructed, and its performance was evaluated.
2-1. 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP가 도입된 형질전환 균주 구축2-1. Plasmid pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP was introduced to construct a transformant strain
상기 실시예 1-1에서 구축된 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP를 E. coli BL21 Star(DE3)에 도입하였으며, 형질전환된 균주는 Trpribo-TF-P T7-TSN1-GFP로 명명하였다.The plasmid pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP constructed in Example 1-1 was introduced into E. coli BL21 Star (DE3), and the transformed strain was Trpribo-TF-P T7 -TSN1 -GFP was named.
2-2. 플라스미드 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP가 도입된 형질전환 균주 구축2-2. Plasmid pACYC-Trpribo-ECF32-trN3-P T7- swN3-GFP was introduced to construct a transformant strain
상기 실시예 1-2에서 구축된 플라스미드 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP를 E. coli BL21 Star(DE3)에 도입하였고, 형질전환된 균주는 Trpribo-TF-P T7-TSN3-GFP로 명명하였다.The plasmid pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP constructed in Example 1-2 was introduced into E. coli BL21 Star (DE3), and the transformed strain was Trpribo-TF-P T7 -TSN3 -GFP was named.
전사 활성 인자 및 토홀드 스위치가 도입된 바이오센서의 트립토판 검출 메커니즘은 도 4에 나타내었으며, 구축된 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP 및 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP는 도 4와 같은 메커니즘으로 작동한다.The tryptophan detection mechanism of the biosensor into which the transcriptional activator and the toehold switch were introduced is shown in FIG. 4, and the constructed plasmids pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP operates with the same mechanism as in FIG. 4 .
도 4에 나타낸 바와 같이, 상기 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP 및 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP는 전사 활성 인자, 트리거 및 토홀드 스위치를 포함한다. 상기 두 플라스미드는 트립토판이 존재하지 않을 경우 GFP가 발현되지 않고(도 4a), 트립토판이 존재할 경우 전사 활성 인자가 발현되어 트리거 RNA를 발현시키고, 발현된 트리거 RNA에 의해 스위치 RNA의 헤어핀 구조가 풀리면서 GFP가 발현된다(도 4b).As shown in Figure 4, the plasmids pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP contain transcriptional activators, triggers and toehold switches. do. In the two plasmids, when tryptophan is not present, GFP is not expressed (Fig. 4a), and when tryptophan is present, transcriptional activators are expressed to express trigger RNA, and the hairpin structure of the switch RNA is released by the expressed trigger RNA. GFP is expressed (Fig. 4b).
2-3. 형광 측정을 통한 토홀드 스위치 시스템이 도입된 트립토판 바이오센서의 성능 확인2-3. Confirmation of performance of tryptophan biosensor with toehold switch system through fluorescence measurement
트립토판 바이오센서의 성능을 확인하기 위하여, 상기 실시예 2-1 및 2-2의 형질전환 균주 Trpribo-TF-P T7-TSN1-GFP 및 Trpribo-TF-P T7-TSN3-GFP를 이용하여 배양 실험을 실시하였다. 상기 배양 실험은 상기 실시예 1-2와 동일한 방법으로 수행하였다. 상기 플라스미드로 각각 형질전환된 균주 Trpribo-TF-P T7-TSN1-GFP 및 Trpribo-TF-P T7-TSN3-GFP의 트립토판 용량-반응 곡선은 도 5a 및 b에 각각 나타내었다.In order to confirm the performance of the tryptophan biosensor, culture experiments using the transformed strains Trpribo-TF-P T7- TSN1-GFP and Trpribo-TF-P T7-TSN3-GFP of Examples 2-1 and 2-2 was carried out. The culture experiment was performed in the same manner as in Example 1-2. Tryptophan dose-response curves of strains Trpribo-TF-P T7- TSN1-GFP and Trpribo-TF-P T7- TSN3-GFP transformed with the plasmid, respectively, are shown in FIGS. 5A and 5B , respectively.
도 5a 및 b에 나타낸 바와 같이, 트립토판을 포함하는 배지에서 형질전환 균주 Trpribo-TF-P T7-TSN1-GFP 및 Trpribo-TF-P T7-TSN3-GFP를 각각 배양한 결과, 상기 두 균주의 트립토판 바이오센서의 작동범위는 0.01 내지 8 g/L임을 확인하였다. 상기 결과로부터 형질전환 균주 Trpribo-TF-P T7-TSN1-GFP 및 Trpribo-TF-P T7-TSN3-GFP의 작동 범위가 종래 개발된 트립토판 바이오센서의 작동범위(0.001 내지 1 g/L)와 비교했을 때 최소 및 최대값이 모두 증가했음을 알 수 있다. 특히, 최대값은 1g/L에서 8g/L로 8배 증가함을 확인했다. 또한, 상기 형질전환 균주 Trpribo-TF-P T7-TSN1-GFP 및 Trpribo-TF-P T7-TSN3-GFP의 배수 변화는 8g/L 트립토판에 대해 각각 약 2.0배, 1.8배로 확인되었다. 이는 종래 개발된 트립토판 바이오센서의 배수 변화(1.58배)에 비해 각각 27%, 14% 증가한 수준이다. As shown in FIGS. 5A and 5B , as a result of culturing the transformed strains Trpribo-TF-P T7- TSN1-GFP and Trpribo-TF-P T7- TSN3-GFP in a medium containing tryptophan, respectively, tryptophan of the two strains It was confirmed that the operating range of the biosensor was 0.01 to 8 g/L. From the above results, the operating range of the transformant strains Trpribo-TF-P T7- TSN1-GFP and Trpribo-TF-P T7- TSN3-GFP was compared with that of the previously developed tryptophan biosensor (0.001 to 1 g/L) It can be seen that both the minimum and maximum values increased. In particular, it was confirmed that the maximum value increased 8 times from 1 g/L to 8 g/L. In addition, the fold change of the transformant strains Trpribo-TF-P T7- TSN1-GFP and Trpribo-TF-P T7- TSN3-GFP was confirmed to be about 2.0-fold and 1.8-fold, respectively, with respect to 8 g/L tryptophan. This is an increase of 27% and 14%, respectively, compared to the fold change (1.58 times) of the conventionally developed tryptophan biosensor.
실시예 3. 토홀드 스위치 프로모터의 세기가 조절된 트립토판 바이오센서 구축 및 성능 확인Example 3. Construction and performance confirmation of tryptophan biosensor in which the strength of the toehold switch promoter is regulated
상기 실시예 2로부터 전사 활성 인자 및 토홀드 시스템의 도입이 트립토판 바이오센서의 작동범위 및 배수 변화를 조절할 수 있다는 것을 확인하였다. 이에, 전사 활성 인자 및 토홀드 스위치 시스템을 포함하고, 토홀드 스위치 프로모터의 세기가 조절된 트립토판 바이오센서를 구축하고, 이의 성능을 평가하였다.From Example 2, it was confirmed that the introduction of the transcriptional activator and the toehold system can control the operating range and fold change of the tryptophan biosensor. Accordingly, a tryptophan biosensor including a transcriptional activator and a toehold switch system, in which the strength of the toehold switch promoter is regulated, was constructed, and its performance was evaluated.
3-1. 토홀드 스위치 프로모터의 세기가 조절된 트립토판 바이오센서 구축3-1. Construction of tryptophan biosensor in which the strength of the toehold switch promoter is regulated
상기 실시예 2에서 구축된 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP 및 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP에 포함된 토홀드 스위치 프로모터의 세기를 조절하였다. 본 실험에서는 T7 프로모터 대신 BBa_J23100, BBa_J23106 및 Tac 프로모터를 각각 삽입하였다. 상기 BBa_J23106는 BBa_J23100에 비해 유전자를 1/2 수준으로 발현시킬 수 있는 프로모터이다.The strength of the toehold switch promoter contained in the plasmids pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP constructed in Example 2 was adjusted. In this experiment, BBa_J23100, BBa_J23106 and Tac promoters were inserted instead of the T7 promoter, respectively. The BBa_J23106 is a promoter capable of expressing a gene at 1/2 level compared to BBa_J23100.
[BBa_J23100][BBa_J23100]
기존의 T7 프로모터를 BBa_J23100 프로모터(Anderson constitutive promoter collection: http://parts.igem.org/Promoters/Catalog/Anderson)로 교체하기 위하여, 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP 및 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP를 증폭하였다. 상기 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP의 증폭에 사용한 프라이머는 5’ 말단이 인산화된 sw1-J23100-F 및 Change-promoter-R이며, 플라스미드 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP의 증폭에 사용한 프라이머는 인산화된 sw3-J23100-F 및 Change-promoter-R이다. 각각의 증폭 산물을 blund-end ligation하여, 플라스미드 pACYC-Trpribo-ECF16-trN1-J23100-swN1-GFP 및 pACYC-Trpribo-ECF32-trN3-J23100-swN3-GFP을 구축했다.To replace the existing T7 promoter with the BBa_J23100 promoter (Anderson constitutive promoter collection: http://parts.igem.org/Promoters/Catalog/Anderson), plasmids pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7- swN3-GFP was amplified. The primers used to amplify the plasmid pACYC-Trpribo-ECF16-trN1-P T7- swN1-GFP were sw1-J23100-F and Change-promoter-R with phosphorylated 5' ends, and plasmid pACYC-Trpribo-ECF32-trN3- The primers used for amplification of P T7- swN3-GFP were phosphorylated sw3-J23100-F and Change-promoter-R. Each amplification product was blund-end ligated to construct plasmids pACYC-Trpribo-ECF16-trN1-J23100-swN1-GFP and pACYC-Trpribo-ECF32-trN3-J23100-swN3-GFP.
[BBa_J23106][BBa_J23106]
T7 프로모터를 BBa_J23106 프로모터로 교체하기 위하여, 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP 및 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP를 각각 증폭하였다. 상기 두 플라스미드의 증폭에는 각각 프라이머 sw1-J23106-F/Change-promoter-R 및 sw3-J23106-F/Change-promoter-R을 사용하였다. 증폭 산물을 각각 연결하였으며, 구축된 플라스미드는 pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP 및 pACYC-Trpribo-ECF32-trN3-J23106-swN3-GFP이다.To replace the T7 promoter with the BBa_J23106 promoter, plasmids pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP were amplified, respectively. Primers sw1-J23106-F/Change-promoter-R and sw3-J23106-F/Change-promoter-R were used for amplification of the two plasmids, respectively. The amplification products were ligated, respectively, and the constructed plasmids were pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP and pACYC-Trpribo-ECF32-trN3-J23106-swN3-GFP.
[Tac 프로모터][Tac promoter]
유도성 프로모터인 Tac 프로모터로 교체하기 위하여, 플라스미드 pACYC-Trpribo-ECF16-trN1-P T7-swN1-GFP 및 pACYC-Trpribo-ECF32-trN3-P T7-swN3-GFP를 각각 증폭하였다. 상기 두 플라스미드의 증폭에는 각각 프라이머 sw1-P tac-F/Change-promoter-R 및 sw3-P tac-F/Change-promoter-R을 사용하였다. 증폭 산물을 각각 연결하였으며, 구축된 플라스미드는 pACYC-Trpribo-ECF16-trN1-P tac-swN1-GFP 및 pACYC-Trpribo-ECF32-trN3-P tac-swN3-GFP이다.To replace the inducible promoter, the Tac promoter, plasmids pACYC-Trpribo-ECF16-trN1-P T7 -swN1-GFP and pACYC-Trpribo-ECF32-trN3-P T7 -swN3-GFP were amplified, respectively. Primers sw1-P tac -F/Change-promoter-R and sw3-P tac -F/Change-promoter-R were used for amplification of the two plasmids, respectively. The amplification products were ligated, respectively, and the constructed plasmids were pACYC-Trpribo-ECF16-trN1-P tac -swN1-GFP and pACYC-Trpribo-ECF32-trN3-P tac -swN3-GFP.
E. coli W3110 균주를 구축된 플라스미드( pACYC-Trpribo-ECF16-trN1-J23100-swN1-GFP, pACYC-Trpribo-ECF32-trN3-J23100-swN3-GFP, pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP, pACYC-Trpribo-ECF32-trN3-J23106-swN3-GFP, pACYC-Trpribo-ECF16-trN1-P tac-swN1-GFP 및 pACYC-Trpribo-ECF32-trN3-P tac-swN3-GFP로 각각 형질전환시켰다. 형질전환된 균주는 각각 Trpribo-TF-J23100 -TSN1 -GFP, Trpribo-TF-23100-TSN3-GFP, Trpribo-TF-J23106-TSN1-GFP, Trpribo-TF-J23106-TSN3-GFP, Trpribo-TF-P tac -TSN1-GFP 및 Trpribo-TF-P tac -TSN3-GFP로 명명하였다. Plasmids constructed from E. coli W3110 strain (pACYC-Trpribo-ECF16-trN1-J23100-swN1-GFP, pACYC-Trpribo-ECF32-trN3-J23100-swN3-GFP, pACYC-Trpribo-ECF16-trN1-J23106-swN1- Transformed with GFP, pACYC-Trpribo-ECF32-trN3-J23106-swN3-GFP, pACYC-Trpribo-ECF16-trN1-P tac- swN1-GFP and pACYC-Trpribo-ECF32-trN3-P tac- swN3-GFP, respectively. Transformed strains are Trpribo-TF-J23100 - TSN1 - GFP, Trpribo-TF-23100-TSN3-GFP, Trpribo-TF-J23106-TSN1-GFP, Trpribo-TF-J23106-TSN3-GFP, Trpribo-TF, respectively. They were named -P tac - TSN1-GFP and Trpribo-TF-P tac - TSN3-GFP.
3-2. 스위치 RNA의 프로모터에 따른 트립토판 바이오센서의 성능 확인3-2. Confirmation of the performance of the tryptophan biosensor according to the promoter of the switch RNA
트립토판 바이오센서의 성능을 확인하기 위하여, 상기 실시예 3-1의 형질전환 균주 Trpribo-TF-J23100-TSN1-GFP, Trpribo-TF-J23100-TSN3-GFP, Trpribo-TF-J23106-TSN1-GFP, Trpribo-TF-J23106-TSN3-GFP, Trpribo-TF-P tac -TSN1-GFP 및 Trpribo-TF-P tac -TSN3-GFP를 이용하여 배양 실험을 실시하였다. 상기 배양 실험은 상기 실시예 1-2와 동일한 방법으로 수행하였다. 형질전환 균주 Trpribo-TF-P tac-TSN1-GFP 및 Trpribo-TF-P tac -TSN3-GFP의 배양 실험에는 인듀서(inducer)인 IPTG(Isopropyl β- D -1-thiogalactopyranoside)를 0.1 μg/ml의 농도로 처리하였다. 상기 형질전환 균주 Trpribo-TF-J23100-TSN1-GFP 및 Trpribo-TF-J23106 -TSN1-GFP의 트립토판 용량-반응 곡선은 도 6a에, Trpribo-TF-J23100 -TSN3-GFP 및 Trpribo-TF-J23106 -TSN3-GFP의 트립토판 용량-반응 곡선은 도 6b에, Trpribo-TF-P tac -TSN3-GFP의 트립토판 용량-반응 곡선은 도 6c에 각각 나타냈다. Trpribo-TF-P tac-TSN1-GFP의 경우, 세포 성장이 심각하게 저해되어 트립토판에 대한 반응 실험을 진행하지 못했다. In order to confirm the performance of the tryptophan biosensor, the transformed strain Trpribo-TF-J23100-TSN1-GFP, Trpribo-TF-J23100-TSN3-GFP, Trpribo-TF-J23106-TSN1-GFP of Example 3-1, Culture experiments were performed using Trpribo-TF-J23106-TSN3-GFP, Trpribo-TF-P tac - TSN1-GFP and Trpribo-TF-P tac -TSN3-GFP. The culture experiment was performed in the same manner as in Example 1-2. In the culture experiment of the transformant strains Trpribo-TF-P tac- TSN1-GFP and Trpribo-TF-P tac - TSN3-GFP, Isopropyl β-D -1-thiogalactopyranoside (IPTG) as an inducer was added at 0.1 μg/ml was treated with a concentration of The transformed strain Trpribo-TF-J23100-TSN1- GFP and Trpribo-TF-J23106-TSN1-GFP tryptophan dose-response curves in Figure 6a, Trpribo-TF-J23100 - TSN3-GFP and Trpribo-TF-J23106 - The tryptophan dose-response curve of TSN3-GFP is shown in Fig. 6b, and the tryptophan dose-response curve of Trpribo-TF-P tac - TSN3-GFP is shown in Fig. 6c, respectively. In the case of Trpribo-TF-P tac- TSN1-GFP, cell growth was severely inhibited, so it was not possible to proceed with the reaction experiment to tryptophan.
도 6a 및 b에 나타낸 바와 같이, 스위치 RNA의 프로모터의 세기를 달리한 트립토판 바이오센서들의 용량-반응 곡선이 조절되는 것을 확인하였다. 특히, 형질전환 균주 Trpribo-TF-J23100-TSN1-GFP(도 6a, 흰색) 및 Trpribo-TF-J23106-TSN3-GFP(도 6b, 흑색)는 다른 트립토판 바이오센서와 달리 각각 6 g/L 및 8 g/L에서 형광 단백질의 발현이 급격히 증가하는 것을 관찰하였다. 상기 결과는 Trpribo-TF-J23100-TSN1-GFP 및 Trpribo-TF-J23106-TSN3-GFP의 작동범위는 8 g/L 이상일 수 있음을 의미한다.As shown in Figures 6a and b, it was confirmed that the dose-response curve of the tryptophan biosensors of which the promoter strength of the switch RNA is varied is regulated. In particular, the transgenic strains Trpribo-TF-J23100-TSN1-GFP (Fig. 6a, white) and Trpribo-TF-J23106-TSN3-GFP (Fig. 6b, black) were 6 g/L and 8 g/L, respectively, unlike other tryptophan biosensors. It was observed that the expression of the fluorescent protein rapidly increased at g/L. The above result means that the working range of Trpribo-TF-J23100-TSN1-GFP and Trpribo-TF-J23106-TSN3-GFP may be 8 g/L or more.
도 6c에 나타낸 바와 같이, 유도성 프로모터인 Tac 프로모터를 포함하는 형질전환 균주 Trpribo-TF-P tac -TSN3-GFP는 IPTG 0.1 μg/ml을 처리한 경우 상기 형질전환 균주 Trpribo-TF-J23106-TSN3-GFP와 유사한 성능을 나타내는 것을 확인하였다. Tac 프로모터는 IPTG의 농도 조절을 통해 발현량을 조절할 수 있는바, 상기 형질전환 균주 Trpribo-TF-P tac -TSN3-GFP도 IPTG의 농도 조절을 통해 트립토판 바이오센서의 성능을 조절할 수 있을 것으로 사료된다.As shown in FIG. 6c , the transformant strain Trpribo-TF-P tac - TSN3-GFP containing the inducible promoter Tac promoter was treated with IPTG 0.1 μg/ml, the transformed strain Trpribo-TF-J23106-TSN3 - It was confirmed that the performance was similar to that of GFP. Since the Tac promoter can regulate the expression level by controlling the concentration of IPTG, the transformant strain Trpribo-TF-P tac - TSN3-GFP is also thought to be able to control the performance of the tryptophan biosensor by controlling the concentration of IPTG. .
상기 실시예 2 및 3의 결과로부터, 상기 pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP(trN1-swN1 조합)는 trN3-swN3 조합(TSN3)을 사용하는 것과 비교하였을 때 배수 변화와 작동범위는 비슷하게 확인되었지만, 오차 범위가 좁기 때문에 신뢰도가 높다는 장점이 있다. 이에, 후술되는 실시예에서는 pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP을 이용하였다.From the results of Examples 2 and 3, the pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP (trN1-swN1 combination) has fold change and operating range compared to using the trN3-swN3 combination (TSN3). was confirmed similarly, but has the advantage of high reliability because the error range is narrow. Therefore, in the Examples to be described later, pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP was used.
실시예 4. 선별 마커 TetA가 도입된 트립토판 바이오센서의 구축 및 성능 확인Example 4. Construction and performance confirmation of a tryptophan biosensor incorporating the selection marker TetA
상기 실시예 1 내지 3에서 구축된 트립토판 바이오센서는 트립토판이 존재할 경우 형광 단백질 GFP가 발현되는 메커니즘을 가진다. 본 실시예에서는 형광 단백질 GFP를 TetA(tetracycline/H + 양방향 수송체, tetA 유전자에 의해 암호화됨)로 교체하고, TetA의 발현을 위한 프로모터로 BBa_J23106 및 BBa_J23105를 이용하였다. 트립토판의 농도에 따라 세포의 성장 속도가 조절될 수 있도록 하는 트립토판 바이오센서를 구축하였다. The tryptophan biosensors constructed in Examples 1 to 3 have a mechanism in which the fluorescent protein GFP is expressed when tryptophan is present. In this example, the fluorescent protein GFP was replaced with TetA (tetracycline/H + bidirectional transporter, encoded by the tetA gene), and BBa_J23106 and BBa_J23105 were used as promoters for TetA expression. A tryptophan biosensor was constructed so that the growth rate of cells can be regulated according to the concentration of tryptophan.
4-1. TetA가 도입된 트립토판 바이오센서의 구축4-1. Construction of tryptophan biosensor incorporating TetA
TetA를 증폭하기 위하여, 프라이머 TetA-In-F 및 TetA-In-R을 이용하여 플라스미드 pCDF-3HPselector를 증폭시켜 제1 증폭 산물을 수득하였다. 또한 프라이머 Vec-F 및 Vec-R를 이용하여 플라스미드 pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP를 증폭시켜 제2 증폭 산물을 수득하였다. 수득된 제1 및 제2 증폭 산물을 깁슨 어셈블리 방식으로 연결하여, 플라스미드 pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA를 구축하였다.To amplify TetA, the plasmid pCDF-3HPselector was amplified using primers TetA-In-F and TetA-In-R to obtain a first amplification product. In addition, the plasmid pACYC-Trpribo-ECF16-trN1-J23106-swN1-GFP was amplified using primers Vec-F and Vec-R to obtain a second amplification product. The obtained first and second amplification products were ligated in a Gibson assembly manner to construct a plasmid pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA.
5’ 말단이 인산화된 프라이머 sw1-J23105-F 및 Change-promoter-R을 사용하여 상기 플라스미드 pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA를 증폭하였다. 상기 증폭 산물을 blund-end ligation하여, 플라스미드 pACYC-Trpribo-ECF16-trN1-J23105-swN1-tetA를 구축하였다. The above plasmid pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA was amplified using 5' end phosphorylated primers sw1-J23105-F and Change-promoter-R. The amplification product was blund-end ligated to construct a plasmid pACYC-Trpribo-ECF16-trN1-J23105-swN1-tetA.
전사 활성 인자, 토홀드 스위치 및 선별 마커 TetA가 도입된 트립토판 바이오센서의 트립토판 검출 메커니즘은 도 7에 나타내었으며, 구축된 플라스미드 pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA 및 pACYC-Trpribo-ECF16-trN1-J23105-swN1-tetA는 도 7과 같은 메커니즘으로 작동한다. 본 실시예에서 구축된 트립토판 바이오센서는 트립토판이 존재하지 않을 경우 반응하지 않으며(도 7a), 트립토판이 존재할 경우 TetA가 발현되며, 이에 따라 항생제 테트라사이클린(tetracycline)에 대한 저항성을 갖게되어 세포 성장에 유리해진다(도 7b).The tryptophan detection mechanism of the tryptophan biosensor into which the transcriptional activator, the toehold switch and the selection marker TetA was introduced is shown in FIG. 7 , and the constructed plasmids pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA and pACYC-Trpribo-ECF16 -trN1-J23105-swN1-tetA operates with the same mechanism as in FIG. 7 . The tryptophan biosensor constructed in this example does not respond when tryptophan is not present (FIG. 7a), and when tryptophan is present, TetA is expressed, and accordingly, it has resistance to the antibiotic tetracycline, thereby preventing cell growth. becomes advantageous (Fig. 7b).
E. coli W3110 균주를 플라스미드 pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA 및 pACYC-Trpribo-ECF16-trN1-J23105-swN1-tetA로 각각 형질전환시켜, 형질전환 균주 Trpribo-TF-J23106-TSN1-tetA 및 Trpribo-TF-J23105-TSN1-tetA을 구축하였다. E. coli W3110 strain was transformed with plasmids pACYC-Trpribo-ECF16-trN1-J23106-swN1-tetA and pACYC-Trpribo-ECF16-trN1-J23105-swN1-tetA, respectively, to transform strain Trpribo-TF-J23106-TSN1 -tetA and Trpribo-TF-J23105-TSN1-tetA were constructed.
구축된 균주에 포함된 상기 프로모터 BBa_J23105는 BBa_J23106에 비해 발현량이 1/2 수준이다. 본 실험의 TetA는 세포의 막에 삽입되는 막 단백질로서, 일정 수준 이상으로 과발현될 경우에는 세포 성장을 저해할 수 있는바, 적절한 수준으로 발현되어야 한다. 이에, 막 단백질인 TetA의 발현을 GFP에 비해 낮게 유지하기 위하여, 상대적으로 낮은 세기의 프로모터를 포함하는 형질전환 균주 Trpribo-TF-J23106-TSN1-tetA를 후술되는 실험에 이용하였다.The expression level of the promoter BBa_J23105 included in the constructed strain is 1/2 compared to that of BBa_J23106. TetA in this experiment is a membrane protein inserted into the cell membrane. When overexpressed at a certain level or more, it can inhibit cell growth, so it must be expressed at an appropriate level. Accordingly, in order to maintain the expression of the membrane protein TetA lower than that of GFP, a transgenic strain Trpribo-TF-J23106-TSN1-tetA including a relatively low-strength promoter was used in the experiment described below.
4-2. TetA가 도입된 트립토판 바이오센서의 성능 확인4-2. Check the performance of tryptophan biosensor with TetA
TetA가 도입된 트립토판 바이오센서의 작동을 확인하기 위한 배양 실험은 실시예 1-2와 같은 배지를 이용했다. 상기 실시예 4-1에서 구축된 형질전환 균주를 M9 배지에 접종하여 24시간 동안 배양하였다. 배양된 균주는 OD 600 값이 0.05가 되도록 새로운 M9 배지에 희석하였고, OD 600 값이 0.8에 도달하였을 때 다시 새로운 M9 배지에 OD 600 값이 0.05가 되도록 희석하였다. 그 후 OD 600 값이 0.4에 도달하였을 때, 다양한 농도의 트립토판(0 및 8 g/L) 및 테트라사이클린(0, 50 및 100 μg/mL)이 첨가된 배지에 균주를 옮겨 배양하였다. 균주를 옮긴 후 1시간 간격으로 총 5회에 걸쳐 OD 600을 측정하여, 세포의 성장을 확인하였다. 세포 성장률을 확인한 결과는 도 8에 나타내었다.The culture experiment for confirming the operation of the tryptophan biosensor into which TetA was introduced used the same medium as in Example 1-2. The transformant strain constructed in Example 4-1 was inoculated into M9 medium and cultured for 24 hours. The cultured strain was diluted in fresh M9 medium so that the OD 600 value was 0.05, and when the OD 600 value reached 0.8, it was again diluted in the new M9 medium so that the OD 600 value was 0.05. Then, when the OD 600 value reached 0.4, the strains were transferred and cultured in a medium to which various concentrations of tryptophan (0 and 8 g/L) and tetracycline (0, 50 and 100 μg/mL) were added. After transferring the strain, the OD 600 was measured a total of 5 times at 1 hour intervals to confirm the growth of the cells. The results of confirming the cell growth rate are shown in FIG. 8 .
도 8에 나타낸 바와 같이, 트립토판이 존재할 경우 형질전환 균주 Trpribo-TF-J23106-TSN1-tetA는 TetA가 발현되며, 이에 따라 테트라사이클린에 대한 저항성을 보이는 것을 확인하였다. 특히, 테트라사이클린 100 μg/ml을 처리하였을 때, 트립토판 존재 하에서 형질전환 균주 Trpribo-TF-J23106-TSN1-tetA는 트립토판이 존재하지 않을 때에 비해 세포 성장률이 약 8.7배 높은 것을 확인하였다. 상기 결과는 구축된 트립토판 바이오센서가 트립토판에 의해 TetA의 발현이 조절될 수 있음을 의미한다. 또한 상기 TetA의 발현 조절에 따른 균주의 성장 속도의 차이를 이용하여, 트립토판 생산 균주를 비교적 간단하게 스크리닝할 수 있음을 의미한다.As shown in FIG. 8, when tryptophan is present, the transformed strain Trpribo-TF-J23106-TSN1-tetA expresses TetA, and thus it was confirmed that it exhibits resistance to tetracycline. In particular, when 100 μg/ml of tetracycline was treated, the transformed strain Trpribo-TF-J23106-TSN1-tetA in the presence of tryptophan had a cell growth rate of about 8.7 times higher than when tryptophan was not present. The above result means that the constructed tryptophan biosensor can regulate the expression of TetA by tryptophan. In addition, by using the difference in the growth rate of the strain according to the regulation of TetA expression, it means that the tryptophan-producing strain can be screened relatively simply.
종합적으로 본 발명자들은 전사 활성 인자 및 토홀드 스위치를 포함하는 트립토판 바이오센서를 개발하고, 상기 트립토판 바이오센서의 작동범위를 조절할 수 있음을 확인하였다. 이는 본 발명의 트립토판 바이오센서가 산업용 균주의 스크리닝에 적합하다는 것을 의미한다.Overall, the present inventors have developed a tryptophan biosensor including a transcriptional activator and a toehold switch, and confirmed that the operating range of the tryptophan biosensor can be controlled. This means that the tryptophan biosensor of the present invention is suitable for screening of industrial strains.
이상, 본 발명내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적인 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의해 정의된다고 할 것이다. Above, specific parts of the present invention have been described in detail, for those of ordinary skill in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

Claims (12)

  1. 서열번호 1의 염기서열로 표시되는 리보스위치 및 전사 활성 인자를 포함하는, 트립토판 검출용 바이오센서.A biosensor for detecting tryptophan, comprising a riboswitch and a transcriptional activator represented by the nucleotide sequence of SEQ ID NO: 1.
  2. 제1항에 있어서,According to claim 1,
    상기 전사 활성 인자는 ECF 시그마 팩터(extra-cytoplasmic function sigma factor) 또는 LysR 유형의 전사 조절 인자인, 트립토판 검출용 바이오센서.The transcriptional activator is an ECF sigma factor (extra-cytoplasmic function sigma factor) or a LysR-type transcriptional regulatory factor, a biosensor for detecting tryptophan.
  3. 제2항에 있어서,3. The method of claim 2,
    상기 ECF 시그마 팩터는 서열번호 2의 염기서열로 표시되는 ECF16 시그마 팩터 또는 서열번호 3의 염기서열로 표시되는 ECF32 시그마 팩터인, 트립토판 검출용 바이오센서.The ECF sigma factor is an ECF16 sigma factor represented by the nucleotide sequence of SEQ ID NO: 2 or an ECF32 sigma factor represented by the nucleotide sequence of SEQ ID NO: 3, a biosensor for detecting tryptophan.
  4. 제1항에 있어서,According to claim 1,
    상기 바이오센서는 토홀드 스위치를 더 포함하는, 트립토판 검출용 바이오센서.The biosensor further comprises a toehold switch, a biosensor for detecting tryptophan.
  5. 제4항에 있어서,5. The method of claim 4,
    상기 토홀드 스위치는 The toehold switch is
    서열번호 4의 염기서열로 표시되는 trN1 또는 서열번호 6의 염기서열로 표시되는 trN3인 트리거 RNA; 및Trigger RNA which is trN1 represented by the nucleotide sequence of SEQ ID NO: 4 or trN3 represented by the nucleotide sequence of SEQ ID NO: 6; and
    서열번호 5의 염기서열로 표시되는 swN1 또는 서열번호 7의 염기서열로 표시되는 swN3인 스위치 RNA;을 포함하는, 트립토판 검출용 바이오센서.A biosensor for detecting tryptophan comprising a;
  6. 제4항에 있어서,5. The method of claim 4,
    상기 바이오센서는 프로모터를 더 포함하는, 트립토판 검출용 바이오센서.The biosensor further comprises a promoter, a biosensor for detecting tryptophan.
  7. 제6항에 있어서,7. The method of claim 6,
    상기 프로모터는The promoter is
    서열번호 8의 염기서열로 표시되는 프로모터 T7,Promoter T7 represented by the nucleotide sequence of SEQ ID NO: 8;
    서열번호 9의 염기서열로 표시되는 프로모터 BBa_J23100,Promoter BBa_J23100 represented by the nucleotide sequence of SEQ ID NO: 9;
    서열번호 10의 염기서열로 표시되는 프로모터 BBa_J23106 및Promoter BBa_J23106 represented by the nucleotide sequence of SEQ ID NO: 10 and
    서열번호 11의 염기서열로 표시되는 프로모터 Tac으로 이루어진 군에서 선택된 1종 이상인, 트립토판 검출용 바이오센서.At least one selected from the group consisting of promoter Tac represented by the nucleotide sequence of SEQ ID NO: 11, a biosensor for detecting tryptophan.
  8. 제1항에 있어서,The method of claim 1,
    상기 바이오센서는 선택 표지 유전자를 더 포함하는, 트립토판 검출용 바이오센서.The biosensor further comprises a selection marker gene, a biosensor for detecting tryptophan.
  9. 제8항에 있어서,9. The method of claim 8,
    상기 선택 표지 유전자는 GFP(green fluorescent protein), CFP(cyan fluorescent protein), BFP(blue fluorescent protein), YFP(yellow fluorescent protein) 및 RFP(red fluorescent protein)로 이루어진 군에서 선택되는 1 이상의 형광 단백질 유전자인, 트립토판 검출용 바이오센서.The selection marker gene is one or more fluorescent protein genes selected from the group consisting of green fluorescent protein (GFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), and red fluorescent protein (RFP). A biosensor for the detection of phosphorus and tryptophan.
  10. 제8항에 있어서,9. The method of claim 8,
    상기 선택 표지 유전자는 항생제 저항성 유전자인, 트립토판 검출용 바이오센서.The selection marker gene is an antibiotic resistance gene, a biosensor for detecting tryptophan.
  11. 제1항 내지 제10항 중 어느 한 항에 따른 트립토판 검출용 바이오센서가 도입된 트립토판 검출용 형질전환 균주.A transformant strain for detecting tryptophan into which the biosensor for detecting tryptophan according to any one of claims 1 to 10 is introduced.
  12. 제11항의 트립토판 검출용 형질전환 균주 및 후보 균주를 배양하는 단계;를 포함하는, 트립토판 고생산균 스크리닝 방법.A method for screening tryptophan high-producing bacteria, including; culturing the transformant and candidate strains for detecting the tryptophan of claim 11 .
PCT/KR2020/007828 2020-06-17 2020-06-17 Biosensor for detecting tryptophan, comprising transcription activation factor and toehold switch WO2021256582A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2020/007828 WO2021256582A1 (en) 2020-06-17 2020-06-17 Biosensor for detecting tryptophan, comprising transcription activation factor and toehold switch

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2020/007828 WO2021256582A1 (en) 2020-06-17 2020-06-17 Biosensor for detecting tryptophan, comprising transcription activation factor and toehold switch

Publications (1)

Publication Number Publication Date
WO2021256582A1 true WO2021256582A1 (en) 2021-12-23

Family

ID=79268112

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/007828 WO2021256582A1 (en) 2020-06-17 2020-06-17 Biosensor for detecting tryptophan, comprising transcription activation factor and toehold switch

Country Status (1)

Country Link
WO (1) WO2021256582A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112941088A (en) * 2021-02-04 2021-06-11 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） Gene related to brucella virulence and application thereof in evaluation of brucella virulence and preparation of attenuated brucella

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130142635A (en) * 2012-06-20 2013-12-30 포항공과대학교 산학협력단 Method for screening microorganism with high lysine productivity using riboswitch
KR20130142942A (en) * 2012-06-20 2013-12-30 포항공과대학교 산학협력단 Method for screening microorganism with high l-tryptophan productivity using riboswitch
WO2016168182A1 (en) * 2015-04-13 2016-10-20 President And Fellows Of Harvard College Production and monitoring of metabolites in cells
WO2018111745A1 (en) * 2016-12-12 2018-06-21 The Regents Of The University Of Colorado, A Body Corporate Use of biological rna scaffolds with in vitro selection to generate robust small molecule binding aptamers for genetically encodable biosensors

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130142635A (en) * 2012-06-20 2013-12-30 포항공과대학교 산학협력단 Method for screening microorganism with high lysine productivity using riboswitch
KR20130142942A (en) * 2012-06-20 2013-12-30 포항공과대학교 산학협력단 Method for screening microorganism with high l-tryptophan productivity using riboswitch
WO2016168182A1 (en) * 2015-04-13 2016-10-20 President And Fellows Of Harvard College Production and monitoring of metabolites in cells
WO2018111745A1 (en) * 2016-12-12 2018-06-21 The Regents Of The University Of Colorado, A Body Corporate Use of biological rna scaffolds with in vitro selection to generate robust small molecule binding aptamers for genetically encodable biosensors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SERGANOV, A.: "Amino acid recognition and gene regulation by riboswitches", BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1789, 2009, pages 592 - 611, XP026737889, DOI: 10.1016/j.bbagrm.2009.07.002 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112941088A (en) * 2021-02-04 2021-06-11 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） Gene related to brucella virulence and application thereof in evaluation of brucella virulence and preparation of attenuated brucella
CN112941088B (en) * 2021-02-04 2023-06-16 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） Genes related to brucella virulence and application thereof in brucella virulence evaluation and preparation of attenuated brucella

Similar Documents

Publication Publication Date Title
Hamoen et al. SepF, a novel FtsZ‐interacting protein required for a late step in cell division
Andersen et al. New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria
Overkamp et al. Benchmarking various green fluorescent protein variants in Bacillus subtilis, Streptococcus pneumoniae, and Lactococcus lactis for live cell imaging
Billard et al. Bioluminescence-based assays for detection and characterization of bacteria and chemicals in clinical laboratories
Hakkila et al. Reporter genes lucFF, luxCDABE, gfp, and dsred have different characteristics in whole-cell bacterial sensors
Westerhausen et al. A NanoLuc luciferase‐based assay enabling the real‐time analysis of protein secretion and injection by bacterial type III secretion systems
Uliczka et al. Monitoring of gene expression in bacteria during infections using an adaptable set of bioluminescent, fluorescent and colorigenic fusion vectors
Dammeyer et al. Engineered fluorescent proteins illuminate the bacterial periplasm
WO2021256582A1 (en) Biosensor for detecting tryptophan, comprising transcription activation factor and toehold switch
Molière et al. Chaperone-protease systems in regulation and protein quality control in Bacillus subtilis
WO2022165917A1 (en) Transcriptional regulation factor specifically responsive to d-2-hydroxyglutaric acid and application thereof
Beilharz et al. Red fluorescent proteins for gene expression and protein localization studies in Streptococcus pneumoniae and efficient transformation with DNA assembled via the Gibson assembly method
Kirstein et al. Localization of general and regulatory proteolysis in Bacillus subtilis cells
Qazi et al. Development of gfp vectors for expression in Listeria monocytogenes and other low G+ C gram positive bacteria
Wasilko et al. Sulfur availability for Vibrio fischeri growth during symbiosis establishment depends on biogeography within the squid light organ
Okada et al. Targeting two‐component signal transduction: a novel drug discovery system
Streett et al. Anaerobic fluorescent reporters for cell identification, microbial cell biology and high-throughput screening of microbiota and genomic libraries
Shapiro et al. Stress-activated bioluminescent Escherichia coli sensors for antimicrobial agents detection
Hinz et al. Golden gate assembly of aerobic and anaerobic microbial bioreporters
FI88309B (en) NY BIOTEST
WO2018169317A1 (en) Mutant gaussia princeps luciferase having amplified bioluminescence intensity
Vollmer et al. Role of the Streptomyces spore wall synthesizing complex SSSC in differentiation of Streptomyces coelicolor A3 (2)
Renzoni et al. Identification by genomic and genetic analysis of two new genes playing a key role in intermediate glycopeptide resistance in Staphylococcus aureus
WO2015072776A1 (en) Method for sensing and quantifying ε-caprolactam by using redesigned gene circuit
Vannini et al. A convenient and robust in vivo reporter system to monitor gene expression in the human pathogen Helicobacter pylori

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20940723

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20940723

Country of ref document: EP

Kind code of ref document: A1