KR101395933B1 - Rapid isolation method of enterohaemorrhagic escherichia coli - Google Patents

Abstract

The present invention relates to a detection method of enterohaemorrhagic Escherichia coli, and more specifically, to a detection method using an antibody against verotoxin which is a toxin produced by the Escherichia coli. By using a detection method or a detection kit according to the present invention, enterohaemorrhagic Escherichia coli can be promptly and accurately detected from a sample and accordingly, determination of enterohaemorrhagic Escherichia coli infection can be promptly and accurately diagnosed thereby allowing prompt treatment for preventing contagion.

Description

TECHNICAL FIELD The present invention relates to a rapid isolation method of enterohaemorrhagic Escherichia coli using an antibody against berotoxin,

The present invention relates to a method for detecting intestinal hemorrhagic Escherichia coli. More specifically, the present invention relates to a method for quickly and accurately detecting intestinal hemorrhagic Escherichia coli from a sample using an antibody against berotoxin, a toxin produced by the Escherichia coli, and magnetic beads.

Because Enterohemorrhagic Escherichia coli (EHEC) produces verotoxin (VT), it is known to be a serious pathogenic strain causing hemolytic uremic syndrome during infection. In addition, it can be spread not only through skin contact but also through drinking water, etc., and the mortality rate during infection is 10% for infants and 50% for elderly people.

As is the case with most infectious infections, it is very important to quickly determine the infection and reduce the damage from subsequent infections. However, existing methods of diagnosing E. coli infection are time-consuming or less accurate. In particular, infection of these infectious pathogens requires isolation of the infected person in order to prevent further transmission. In case of misdiagnosis, there is a problem that the person who is not infected can be isolated, and development of rapid and accurate diagnosis method is required.

Traditionally, diarrheal feces were preincubated and cultured on a MacConkey agar medium to isolate individual colonies. Polymerase chain reaction (PCR) (Shiga toxin gene). Recently, a colony southern blot (colony southern blot) has been used to test 300 colonies at a time.

These methods require a minimum of 3 to 5 days of testing and are costly and labor-intensive to isolate enterohemorrhagic E. coli from a patient's sample. This time, labor, and cost are caused by the difficulty of distinguishing non-pathogenic Escherichia coli from pathogenic E. coli in stool specimens.

The present inventor has tried to develop a new method that is faster and more accurate by improving the problems of the conventional diagnosis method.

As a result, when the detection particles having a form in which the antibody against the berotoxin and magnetic particles are combined are used, only the intestinal hemorrhagic Escherichia coli can be rapidly and accurately separated from the sample. If PCR or the like is additionally applied thereto The present inventors have confirmed that it is possible to rapidly and accurately diagnose the intestinal hemorrhagic Escherichia coli infection by using this detection method, and have completed the present invention.

The main object of the present invention is to provide a method for rapidly and accurately detecting intestinal hemorrhagic Escherichia coli.

Another object of the present invention is to provide a kit for detecting intestinal hemorrhagic Escherichia coli which can detect intestinal hemorrhagic Escherichia coli rapidly and accurately.

According to one aspect of the present invention, there is provided a method for detecting enterohemorrhagic Escherichia coli by using an antigen-antibody binding reaction of an antibody against berotoxin with berotoxin of enterohemorrhagic Escherichia coli (EHEC) A method for detecting enterohemorrhagic E. coli.

Berotoxin is also known as shiga-like toxin because of its structural similarity to shiga toxin.

Previously, antibodies against berotoxin were mainly used for toxic neutralization. However, the present inventors confirmed that this verotoxin exists in the outer membrane of enterohemorrhagic Escherichia coli, and it was thought that using the antibody against it, not only the toxin but also the cell could be detected together. In addition, it was thought that it would be possible to detect the intestinal hemorrhagic Escherichia coli cells more easily by binding the magnetic particles to this antibody, and it was actually confirmed through experiments.

It is known that enterohemorrhagic Escherichia coli produces one or two protein toxins, either berotoxin 1 or berotoxin 2. Each berotoxin consists of two types of protein subunits (A, B).

In the case of berotoxin 1, the subunit A has the amino acid sequence of SEQ ID NO: 1, the subunit B has the amino acid sequence of SEQ ID NO: 2, and the subunit B has the amino acid sequence of SEQ ID NO: And their gene sequences can be represented by SEQ ID NOS: 3 and 4, respectively. In the case of berotoxin 2, the subunit A may have an amino acid sequence of SEQ ID NO: 5, the subunit B may have an amino acid sequence of SEQ ID NO: 6, and each gene sequence may be represented by SEQ ID NOs: 7 and 8.

The antibody to verotoxin used in the present invention can be prepared according to a method for producing an antibody using a conventional immune reaction. Or by administering berotoxin as an antigen to a mammal or a bird to induce an immune response and then purifying the antibody produced. In the present invention, it is preferable to use immunoglobulin G (IgG).

According to another aspect of the present invention, there is provided a method for detecting a hematopoietic cell, comprising the steps of: a) contacting an antibody against berotoxin of enterohemorrhagic Escherichia coli (EHEC) bound to magnetic particles with a sample; And b) obtaining a conjugate in the form of binding between the intestinal hemorrhagic Escherichia coli and the antibody of the detection particle, using a magnetic force, with berotoxin interposed therebetween. This is a method in which a magnetic particle system is introduced to more easily detect intestinal hemorrhagic Escherichia coli.

In the present invention, the magnetic particle means a micro- or nano-unit (diameter) particle having magnetism with a binding force with an antibody. Examples of such magnetic particles include magnetic core particles coated with a functional group such as amine (NH ₂ ), and various kinds of magnetic particles having different core particle components and surface functional groups, And these can be used. When the magnetic particles and the berootoxin antibody are combined with each other to prepare the detection particles, it is preferable to follow the manual of the manufacturer of the magnetic particles. In the case of using magnetic particles having amine functional groups, the binding reaction temperature is preferably 2 to 6 ° C 4 占 폚) and the time is preferably 8 to 24 hours (optimum 18 hours). The lower the reaction temperature is, the better the activity of the antibody is maintained, but the binding efficiency with the magnetic particles is lowered. The higher the antibody activity is, the more the activity can be lost. If the reaction time is too short, Even if the efficiency is low and the time is long, there is no efficiency increase effect or the efficiency can be lowered.

In the present invention, the sample is preferably suspended in a buffer solution (pH 6.5 to 8).

When a detection particle of the present invention is added to a sample in which the enterohemorrhagic Escherichia coli is present, a complex of the detection particle and the verotoxin is produced through an antigen (berotoxin) -binding reaction. In this case, .

The method of the present invention further comprises culturing in E. coli culture medium at 35 to 39 DEG C for 2 to 18 hours between steps (a) and (b) in order to further increase detection efficiency of enterohemorrhagic Escherichia coli . This is to increase the binding rate to the antibody by increasing the number of cells by culturing the intestinal hemorrhagic Escherichia coli that may be present in the sample. The incubation temperature is a temperature suitable for the growth of Escherichia coli. The incubation time is an increase of the number of Escherichia coli cells, Is a time considering the efficiency of the system. Optimum time conditions of VT1 and VT2 were slightly different from 8 hours and 4 hours, respectively. However, the more appropriate range for each is 2 to 8 hours for VT1 and 4 to 18 hours for VT2. TSB, LB and the like can be used as a medium for culturing E. coli.

In the detection method of the present invention, a polymerase chain reaction (PCR) is performed using a primer set capable of amplifying a part of the berotoxin gene of the intestinal hemorrhagic Escherichia coli against the intestinal hemorrhagic Escherichia coli of the aforementioned conjugate ; And analyzing the product amplified by the polymerase chain reaction. By further applying this PCR method, the detection of intestinal hemorrhagic E. coli can be confirmed more quickly and accurately.

Wherein the primer set comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 9 and a primer set (primer set for VT1) comprising an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 10; And a primer set (an primer set for VT2) comprising an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 11 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 12.

Further, when the intestinal hemorrhagic Escherichia coli of the conjugate is cultured in a culture medium for Escherichia coli culture (in particular, a solid medium), direct cells can be obtained.

According to still another aspect of the present invention, there is provided a kit for detecting enterohemorrhagic Escherichia coli (Enterohemorrhagic Escherichia coli , EHEC) comprising an antibody against berotoxin bound to magnetic particles . This kit is provided so as to make it possible to carry out the method of detecting intestinal hemorrhagic Escherichia coli of the present invention very easily.

It is preferable that the kit further comprises a primer set capable of amplifying a part of the berotoxin gene of enterohemorrhagic Escherichia coli, wherein the primer set comprises an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 9 and a nucleotide sequence of SEQ ID NO: A primer set comprising an oligonucleotide comprising a sequence; And a primer set comprising an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 11 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 12.

The use of the detection method or the detection kit according to the present invention enables rapid and accurate detection of enterohemorrhagic Escherichia coli from a sample and thus rapid and accurate diagnosis of intestinal hemorrhagic Escherichia coli infection can be made, .

1 is a schematic diagram illustrating a process for detecting intestinal hemorrhagic Escherichia coli according to an embodiment of the present invention.
FIG. 2 shows cross-reactivity of whole proteins of EHEC using antibodies against VT1 and VT2.
FIG. 3 is a graph showing the degree of attachment of antibodies to magnetic particles and VT1 or VT2 over time under the reaction conditions of 4 占 폚.
FIG. 4 is a graph showing the detection efficiency according to the incubation time by adding the detection particles to the sample and adding the LB medium.
FIG. 5 is a graph showing the results of an experiment of cross reaction with a non-EHEC strain. EHEC (VT1), EHEC (VT2), EHEC (VT1 & VT2), VT1 non-expressed EHEC and VT2 non-expressed EHEC and 9 non-pathogenic E. coli , Salmonella typhimurium , Vibrio Cholera O1 and Shigella shows the detection rate of EHEC strain intended for the sample a mixture of a non-EHEC strains, such as sonneri.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and thus the scope of the present invention is not construed as being limited by these embodiments.

Example 1. Preparation of Antibodies to Verotoxin

1-1. Antigen boosting in mice

VT1 and VT2 to be used as antigens were prepared using an E. coli expression system.

BALB / c mice were injected intraperitoneally (ip) with 6-week-old female BALB / c mice after the emulsion was prepared by mixing Vero toxin with the complete Freund's adjuvant (Sigma) Lt; / RTI > Six animals were injected with 50ng of antigen per bird.

The second immunization was performed two weeks later and was administered in the same manner as above. The third immunization was carried out in the same manner as the second immunization. Finally, after 2 weeks, the antigen (the same amount as in the third administration) was mixed with PBS and injected into the tail vein (intravenous injection, iv) Respectively. The last administration through the vein is to induce specific high B lymphocytes into the spleen. Cell fusion was performed 3 days after the last immunization.

1-2. Cell fusion of spleen cells and myeloma cells

Cell fusion was performed using PEG (polyethylene glycol, Sigma) as a fusogen according to the Kohler and Milstein method. When myeloma cells (myeloma, V653, number of cells is about 7 ~ 8 × 10 ⁵ / ㎖ are used for the experiment for the next day for 1/2 dilution system) and antibody titer is high Splenocytes of the mice were prepared in advance, mixed and washed with a cell culture medium to which no FBS was added, and then slowly stirred for 1 minute with 1 ml of pre-heated (37 ° C) PEG Fused. After the fusion, the fusion process was carried out while slowly adding 1X HAT medium (20% FBS, RPMI-1640) over several minutes. The whole process was carried out in a 37 ° C water bath and the cells were diluted with HAT supplemented to a concentration of 1 colony per well in a 96 well plate. The 96-well plates were incubated for 7 days at 37 ° C in a CO ₂ incubator. The incubator was not opened until entering the screening phase.

1-3. Selection of wells for specificity test

After 1 week (7 days) after cell fusion, each 96 well plate was taken out and placed on an inverted microscope to observe the formation of a cell colony and its degree (colony size). Among the indicated wells, only colony size, which occupies 25% of the whole well area, was selected for the specificity test. The morphological features of the formed colonies were classified by sorting them considering the cell density for each type since morphological features such as complete floating, clustering of staphylococci, partial adhesion, complete adhesion were appeared.

1-4. Specificity test using enzyme immunoassay (ELISA)

100 μl of the corresponding antigen solution was dispensed into a 96-well plate at a concentration of 10 μg / ml and reacted at 37 ° C for 60 minutes. 0.05 M sodium bicarbonate solution was used as a diluent. The reaction solution was removed, and 200 μl of the washing solution (phosphate buffer, 0.05% Tween 20) was added to each well and then removed again. After washing, 200 μl of blocking solution (phosphate buffer containing 1% BSA) was added to each well, followed by reaction at 37 ° C for 30 minutes. The blocking solution and the reaction solution were removed, and the washing solution was added in an amount of 200 μl per well and then removed again. 100 μl of the mAb solution was dispensed per well and 100 μl of the diluted solution was dispensed into the wells for negative control, and the mixture was reacted at 37 ° C for 30 minutes. The reaction solution was removed, 200 μl of the washing solution was added per well The process of removing again was repeated 3 times. 100 μl of each reagent fused with anti-mouse IgG (horse reddish peroxidase) was dispensed into each well and reacted at 37 ° C for 30 minutes. The reaction solution was removed, and 200 μl of the washing solution was added to each well. 100 μl of enzyme substrate solution (0.4 mg / ml in phosphate citrate buffer, pH 5.0) was added to each well and reacted at room temperature for 30 minutes. The absorbance value was confirmed at 492 nm (yellow), and the absorbance value at least three times the absorbance of the negative control group was judged to be negative and positive based on the minimum value of the positive reaction.

1-4. Specificity test using Western blotting

Purified recombinant proteins were electrophoresed on SDS-PAGE and electrotransferred recombinant proteins to nitrocellulose membrane (0.45 μm; Bio-Rad). Towbin et al. (1979), and the membrane was blocked with blocking buffer (0.01 M PBS, 3% skim milk, Sigma) overnight at room temperature. The antibody solution (hybridoma cell culture solution) And reacted at room temperature for 1 hour.

Each reaction step was washed 5 times with PBS-Tween 20 (0.05%) and Alkaline phosphatase-conjugated anti-mouse IgG (Sigma) was diluted to the appropriate concentration in the blocking solution for 1 hour. Fresh substrate solution (NBT / BCIP, Sigma) was prepared and reacted at room temperature for 10 minutes. To stop the reaction, distilled water was added and the results were visually read.

1-5. Management of seed cell lines and production cell lines

The fusion cell lines which were judged to secrete the desired antibody were subjected to 1 < st > and 2 < nd > cloning by a limiting dilution method so that the fusion cell group was induced to induce only clones derived from one cell. The established monoclonal antibody cell line was suspended in the culture medium and incubated in a CO ₂ cell incubator for 3 to 4 days at 37 ° C. The obtained cell suspension was centrifuged at 1,300 rpm for 10 minutes, and the precipitated cells were treated with anti-freezing agent (RPMI-1640 (1 × 10 ⁶ cells / ㎖) into the ampoules for cryopreservation, and record the cell line name, passage number, passage date, etc., and place in a freezing container. After storage overnight in deep freezer (-70 ° C), it was stored frozen in freezing at 196 ° C (liquid nitrogen) and used as a cell line.

Subsequently, the produced prokaryotic monoclonal antibody-secreting cell line was taken out and rapidly thawed in a constant temperature water bath at 37 ° C, suspended in a medium, and grown in a 37 ° C CO ₂ cell incubator for 3 to 4 days. The proliferated cell suspension was centrifuged at 1,300 rpm for 10 minutes (1 × 10 ⁶ cells / ㎖) into the ampoules for cryopreservation. After recording the cell name, passage number, passage date, etc., the cells were incubated at -196 ° C (liquid nitrogen) And used as a monoclonal antibody-producing cell line for production.

Example 2. Preparation of detection particles and detection of intestinal hemorrhagic E. coli using the same

2-1. Cross-reactivity of VT1 & VT2 monoclonal antibody with outer membrane protein

Cross-reactivity of antibodies to VT1 & VT2 with other proteins of EHEC was confirmed. As a result, as shown in FIG. 2, it was confirmed that only VT1 and VT2 among all the proteins of EHEC were reacted but not cross-reacted with other proteins.

2-2. Preparation of detection particles and confirmation of magnetic particle-antibody adhesion

The SiMAG-Protein A and SiMAG-Protein G products (magnetic particles with amine functional groups) from Chemicell were used as magnetic particles and the manuals provided by the manufacturer were followed.

100 μg of antibody and 500 μg of magnetic particles were reacted at 4 ° C for each hour to determine the optimal time for attaching the antibody to the magnetic particles, and the amount of the antibody that could not adhere to the magnetic particles was quantitated .

As a result, as shown in FIG. 3, the coupling efficiency was gradually decreased after 4 hours. The binding of SiMAG-Protein G was gentle until 4 hours, but after 4 hours, the binding force was 5 ~ 10% higher than that of SiMAG-Protein A. However, this difference is seen as an experimental error, and it can be used without distinguishing between two magnetic particles. These results suggest that the binding reaction between magnetic particles and antibody should be carried out at 4 ℃ for 18 hours. Further, it is judged that the ratio of the antibody to the magnetic particles in the binding reaction is preferably 1: 5 to 1:15 (by weight).

2-3. Detection of VT1 production strain and VT2 production strain

The detection efficiency of the detection particles by incubation time was confirmed by using LB medium mixed with non-pathogenic E. coli strains secreting VT1 and VT2 toxins.

Detection was performed by polymerase chain reaction (PCR) using the following primers.

VT1 primer F: ATAAATCGCCATTCGTTGACTAC

VT1 primer R: AGAACGCCCACTGAGATATCATC

VT2 primer F: GGCACTGTCTGAAACTGCTCC

VT2 primer R: TCGCCAGTTATCTGACATTCTG

The bacterial solution was suspended in sterilized water, boiled at 100 ° C for 5 minutes, and centrifuged at 15,000 g for 5 minutes to use 1 μl of the supernatant as a template. 1 [mu] l (10 pmole) of each of the above four primers and 1 [mu] l of a template were added to adjust the volume of the PCR reaction solution to 20 [mu] l in total. Taq polymerase was a Maxime PCR PreMix (i-StarMAXII) Cat. No. 25281 from Intron. PCR conditions were 94 ° C for 5 minutes, 94 ° C for 30 seconds, 55 ° C for 60 seconds, and 72 ° C for 30 seconds, and the reaction was carried out for 30 minutes at 72 ° C for 5 minutes. After PCR, the product size of VT1 was 180bp and VT2 was 255bp by electrophoresis.

EHEC (VT1) showed the best detection rate when incubated for 8 hours, but EHEC (VT2) showed the best result at 4 hours incubation (see FIG. 4). Taken together, these results suggest that the incubation time should be 4 hours for the rapid and easy separation of EHEC.

2-4. Confirm detection limit

In order to confirm the detection limit of EHEC, EDL933 strain which secretes both VT1 and VT2 was used. 50 μl of the detection particles were added to the LB medium in which the non-pathogenic E. coli was in a concentration of 10 ⁸ CFU and the EDL933 was added to the concentration of 1 CFU to 10 ⁴ CFU. After incubation for 4 hours with shaking, . As a result, as shown in Table 1, the results of 1 CFU and 10 ¹ CFU resulted in an error due to the dilution of the cells, but the detection rate was more than 80% in 10 ² CFU.

1 CFU 10 ¹ CFU 10 ² CFU 10 ³ CFU 10 ⁴ CFU EDL933 68 189 1049 20066 38333 non-pathogenic E. coli 137 96 169 188 159 EHEC isolation% 33% 66% 86% 99% 99%

* Result: Number of colonies identified by culturing isolated bacteria in a solid medium.

* The number of colonies detected after the detection is larger than the number of cells before detection because the number of cells grows and the number of cells grows during shaking culture during the bacterial separation process.

2-5. Identification of cross-reactivity with normal bacterial flora and other pathogenic bacteria

We tried to confirm cross-reactivity with other non-EHEC bacteria. In general, stool specimens may contain various microorganisms including non-pathogenic Escherichia coli in addition to EHEC. Therefore, the detection rate should be high even if there are other microorganisms besides EHEC to be detected. In addition to Escherichia coli, Salmonella and Vibrio are relatively easy to identify, but non-pathogenic Escherichia coli is not. Therefore, cross-reactivity with non-pathogenic Escherichia coli is especially important.

Nine non-pathogenic E. coli , Salmonella typhimurium , Vibrio Cholera O1 , and Shigella sonneri , isolated from the Chungbuk Institute of Health and Environment were used as non-EHEC strains. In addition, strains of the EHEC VT1 and VT2 toxins that were negative for the RPLA method (designated VT1 non-expressed EHEC and VT2 non-expressed EHEC for convenience) Respectively.

EHEC (VT1), EHEC (VT2), EHEC (VT1 & VT2), VT1 non-expressed EHEC and VT2 non-expressed EHEC were prepared and the detection rate Was used.

As a result of cross-reaction confirmation, it was confirmed that the EHEC (VT1), EHEC (VT2) and EHEC (VT1 & VT2) had an average 80% or more of segregation rate with 9 non-pathogenic E. coli or other pathogenic bacteria, On the other hand, in the case of VT1 non-expressed EHEC or VT2 non-expressed EHEC instead of EHEC, the same cross-reaction was observed.

VT1 or VT2 non-expressed EHEC was thought not to produce verotoxin, but is still a deleterious strain. This strain showed a negative result in the RPLA method. On the other hand, in the case of using the detection particles of the present invention as confirmed by the present embodiment, detection was confirmed although the detection rate was relatively low as compared with EHEC.

This is because these VT1 or VT2 non-expressed EHEC are not produced at all but produce trace amounts of VT1 or VT2, and that the detection particles of the present invention are efficiently bound to the micro-produced VT1 or VT2.

Attach an electronic file to a sequence list

Claims (14)

An antibody-antibody binding reaction of an antibody to berotoxin with berotoxin present in the outer membrane of enterohemorrhagic Escherichia coli (EHEC) produces a complex in which enterohemorrhagic Escherichia coli (EHEC) binds to enterohemorrhagic Escherichia coli (EHEC) And separating the binding substance from the sample to obtain intestinal hemorrhagic Escherichia coli. The method according to claim 1,
Wherein the berotoxin is berotoxin 1 (VT1) or berotoxin 2 (VT2). 3. The method of claim 2,
The verotoxin 1 is composed of a subunit A represented by the amino acid sequence of SEQ ID NO: 1 and a subunit B represented by the amino acid sequence of SEQ ID NO: 2,
Wherein the verotoxin 2 comprises a subunit A represented by the amino acid sequence of SEQ ID NO: 5 and a subunit B represented by the amino acid sequence of SEQ ID NO: 6. delete delete delete delete delete delete A kit for isolating enterohemorrhagic Escherichia coli (EHEC), comprising an intestinal hemorrhagic Escherichia coli (EHEC) antibody against berotoxin bound to magnetic particles. 11. The method of claim 10,
Wherein said berotoxin is berotoxin 1 (VT1) or berotoxin 2 (VT2). 12. The method of claim 11,
The verotoxin 1 is composed of a subunit A represented by the amino acid sequence of SEQ ID NO: 1 and a subunit B represented by the amino acid sequence of SEQ ID NO: 2,
Wherein the verotoxin 2 comprises a subunit A represented by the amino acid sequence of SEQ ID NO: 5 and a subunit B represented by the amino acid sequence of SEQ ID NO: 6. 11. The method of claim 10,
The kit
A kit for isolating enterohemorrhagic Escherichia coli, which further comprises a primer set capable of amplifying a part of a berotoxin gene of enterohemorrhagic Escherichia coli. 14. The method of claim 13,
The primer set
A primer set consisting of an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 9 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 10; And
A primer set comprising an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 11 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 12.

Images