KR101370942B1 - Novel Bacillus subtilis - Google Patents

Abstract

The present invention relates to a probiotic preparation comprising the novel Bacillus subtilis (Bacillus subtilis) CJMPB957 (KCCM11271P) strain, and this, the method for preventing or treating a disease of cattle to use them.

Description

New Bacillus subtilis {Novel Bacillus subtilis}

The present invention relates to a probiotic preparation containing novel Bacillus subtilis (Bacillus subtilis) CJMPB957 (KCCM11271P) strain, and this, the method for preventing or treating a disease of cattle to use them.

Livestock infections significantly reduce the value of a commodity, such as losing weight or causing a variety of bed conditions. Bacterial diseases causing livestock infections include Enteroxigenic Escherichia (ETEC). diarrheal disease caused by coli ), avian pathogenic Escherichia coli ), sepsis, Salmonellosis causing acute acute enteritis, and necrotic enteritis caused by Clostridium sp.

In addition, aspergillosis caused by Aspergillus sp., Which grows on cereals, is a fungal disease that causes anorexia, fever, shortness of breath, diarrhea and cramps. .

Many antibiotics have been developed to treat and prevent these diseases. However, as the incidence of resistant bacteria increases due to the indiscriminate use of antibiotics, the use of antibiotics added to feeds for the purpose of disease prevention and growth promotion in addition to disease treatment is completely prohibited or regulated. According to the regulations on the use of antibiotics, the productivity of livestock can be reduced and the mortality rate can increase. Therefore, it is very urgent to develop antibiotic substitutes that can compensate for these problems.

Recently, researches are underway to develop probiotics that can replace antibiotics. Prior art regarding probiotics include the following.

Republic of Korea Patent Publication No. 2010-0076263 discloses a Lactobacillus momentum spread (Lactobacillus with E. coli, Salmonella inhibitory effects in the prevention calf diarrhea Fermentum ) discloses BLAB19 .

Republic of Korea Patent No. 10-0878799 discloses an antibiotics-resistant pathogenic microorganisms or enteropathogenic microorganisms ed woji Ella the tar (Edwardsiella tarda ), E. coli, Staphylococcus to inhibit the growth of Bacillus amyl Lori epidermidis) kwipe sieon's (Bacillus amyloliquefaciens ) K37.

Korean Laid-Open Patent No. 2006-0026371 is a lactic acid bacterium ( Lactobacillus) that inhibits Escherichia coli that causes pig diarrhea. Fermentum 12-1, KACC91135).

However, the prior art discloses a strain having an antimicrobial activity against Escherichia coli, Salmonella or Clostridium, which are a problem in poultry or swine, and aflatoxin poisoning in livestock fed to grains that are feed ingredients. No strains have been reported with antifungal activity against Aspergillus.

Republic of Korea Patent Application Publication No. 10-2010-0076263 (published Jul. 6, 2010) Republic of Korea Patent Publication B1 No. 10-0878799 (January 14, 2009) Republic of Korea Patent Application Publication No. 10-2006-0026371 (published on Mar. 23, 2006)

An object of the present invention is to provide a Bacillus subtilis CJMPB957 (KCCM11271P) excellent in antibacterial and antifungal activity, excellent in complex digestive enzyme production capacity, acid resistance and bile resistance.

In addition, an object of the present invention is to provide a culture of the Bacillus subtilis CJMPB957 (KCCM11271P) strain,

In addition, an object of the present invention is to provide a probiotic formulation, feed additives and feed comprising the Bacillus subtilis CJMPB957 (KCCM11271P) strain or its culture.

In addition, an object of the present invention is to provide a method for preventing or treating bacterial or fungal diseases of livestock by administering the Bacillus subtilis CJMPB957 (KCCM11271P) strain or its culture to livestock.

The present invention relates to a process for the probiotic preparation comprising a novel separation Bacillus subtilis (Bacillus subtilis) CJMPB957 (KCCM11271P) strain, and this, to take advantage of this, the prevention or treatment of diseases of livestock.

One aspect of the present invention provides a novel Bacillus subtilis CJMPB957 (KCCM11271P) strain having antibacterial and antifungal activity and having complex digestive enzyme production ability, acid resistance and bile resistance.

According to another aspect of the present invention, there is provided a culture of the Bacillus subtilis CJMPB957 (KCCM11271P) strain.

According to another aspect of the present invention, there is provided a Probiotics formulation comprising the Bacillus subtilis CJMPB957 (KCCM11271P) strain or a culture of the strain.

According to another aspect of the present invention, there is provided a feed additive comprising the probiotic formulation.

According to another aspect of the present invention, there is provided a feed comprising the feed additive.

According to another aspect of the present invention,

It provides a method for preventing or treating a bacterial or fungal disease of a livestock, comprising administering to the livestock one or more selected from the group consisting of the above probiotic formulations, feed additives and feed.

The present invention provides probiotics, feed additives and feed comprising a Bacillus subtilis CJMPB957 (KCCM11271P) strain or a culture thereof having excellent antibacterial and antifungal activity and excellent complex digestive enzyme production ability, acid resistance and bile resistance. It provides a method of preventing or treating bacterial or fungal diseases of animals by administering it to livestock, thereby improving disease management and digestion of livestock, as well as maintaining the balance of intestinal microorganisms and improving the efficiency of livestock feed. Has the effect of contributing to.

1 is a Bacillus subtilis of the present invention ( Bacillus) subtillis ) electron micrograph of CJMPB957 (KCCM11271P) strain.
Figure 2a is a graph showing the in vitro antibacterial activity against the enterotoxic E. coli O122 of three candidate strains of Example 2.
Figure 2b is a graph showing the in vitro antimicrobial activity against three enterococci E. coli O149 of the candidate strain of Example 2.
Figure 3 is a photograph showing the antimicrobial activity of Bacillus subtilis CJMPB957 (KCCM11271P) of the present invention.
Figure 4 is a photograph showing the antifungal activity of Aspergillus flavus of Bacillus subtilis CJMPB957 (KCCM11271P) of the present invention.
Figure 5 is a photograph showing the complex digestive enzyme activity of Bacillus subtilis CJMPB957 (KCCM11271P) of the present invention.
6 is a graph showing survival rate when Bacillus subtilis CJMPB957 (KCCM11271P) of the present invention was treated with artificial gastric juice or artificial bile.
Figure 7 is a photograph showing the presence or absence of hemolytic Bacillus subtilis CJMPB957 (KCCM11271P) of the present invention.
Figure 8 shows the 16s rDNA base sequence of Bacillus subtilis CJMPB957 (KCCM11271P) of the present invention.

Hereinafter, the present invention will be described in more detail. Those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims.

One aspect of the present invention provides a novel separating a Bacillus subtilis (Bacillus subtilis) CJMPB957 (KCCM11271P) ( hereinafter, 'CJMPB957') strain.

The CJMPB957 morphologically corresponds to Gram-positive bacilli (see FIG. 1), and has a homology of 98% to Bacillus subtilis as a result of analysis of the 16s rDNA nucleotide sequence (SEQ ID NO: 1, FIG. 8).

The CJMPB957 was deposited on March 22, 2012 at the Korean Culture Center of Microorganisms (361-221, Hongje 1-dong, Seodaemun-gu, Seoul) under the accession number KCCM11271P.

The CJMPB957 has complex antibacterial and antifungal activity.

As a target bacterium of the antibacterial or antifungal activity of the CJMPB957 ( Aspergillus genus) sp.), enterotoxigenic Escherichia (ETEC) coli ), avian pathogenic Escherichia coli (APEC), Salmonella sp. and Clostridium sp.

The CJMPB957 may preferably exhibit antimicrobial or antifungal activity against all of the genus Aspergillus, enterococci E. coli, algae Escherichia coli, Salmonella and Clostridium.

The CJMPB957 has a complex digestive enzyme production capacity.

Digestive enzyme having a production capacity of the CJMPB957 is a protease (Protease), Cellulase (Cellulase), Amylase (Amylase), Xylanase (Xylanase), Mannanase (Lipase) and phytase (Phytase) It may include one or more selected from the group.

The CJMPB957 may more preferably produce all of protease, cellulase, amylase, xylanase, mannanase, lipase and phytase.

The CJMPB957 has excellent heat resistance.

More specifically, the CJMPB957 is incubated for 24 hours at 37 ℃, 200 rpm condition, then the endogenous spore formation rate after heat treatment at 95 ℃ 10 minutes may be preferably 95% or more, more preferably 100% day Can be.

The endogenous spores are resistant to extreme environments such as UV, low temperature, drying and / or high pressure, as well as high temperature conditions, and the higher the endogenous spore formation rate, the higher the survival rate of the strain.

The CJMPB957 has excellent acid resistance.

More specifically, the CJMPB957 is a survival rate after incubation for 3 hours in a medium containing artificial gastric juice prepared by adding 1% (w / v) of pepsin (Pepsin) to a solution adjusted to pH 2.5 is preferably 95 It may be at least%, more preferably 100%.

The CJMPB957 has excellent bile resistance.

More specifically, the CJMPB957 may preferably have a survival rate of 95% or more after incubating for 3 hours in a medium containing artificial bile containing 1% (w / v) Pancreatin. May be 100%.

The novel isolated strain CJMPB957 of the present invention can be cultured through a conventional method for culturing Bacillus strains. The CJMPB957 is preferably obtained by incubating for 12 hours to 4 days at a culture temperature in the range of 20 to 40 ℃.

According to another aspect of the present invention, there is provided a culture of the CJMPB957.

The culture is a concept including a culture medium or culture medium in which the CJMPB957 strain is cultured, and the resultant cultured in the culture medium or culture medium, and the culture may or may not include the CJMPB957 strain.

The culture is not particularly limited in its dosage form, and may be a dosage form commonly used in the art. For example, the culture may be liquid or solid, and may be in a circular state of the culture, or in its concentrated form or dried form.

Culture medium

As a medium for culturing CJMPB957 of the present invention, a natural medium or a synthetic medium can be used.

The carbon source of the medium is not particularly limited, and any known in the art may be used. Non-limiting examples of the carbon source include glucose, sucrose, dextrin, glycerol or starch. These may be used alone or in combination of two or more.

The nitrogen source of the medium is not particularly limited, and any known in the art may be used. Non-limiting examples of such nitrogen sources include peptone, meat extract, yeast extract, dried yeast, soybean, ammonium salt, nitrate and other organic or inorganic nitrogen containing compounds. These may be used alone or in combination of two or more.

The inorganic salt contained in the medium is not particularly limited and may be any known in the art. Non-limiting examples of the inorganic salts include magnesium, manganese, calcium, iron, potassium and the like. These may be used alone or in combination of two or more.

In addition to the carbon source, nitrogen source, and inorganic salt components, the medium for culturing CJMPB957 of the present invention may be added with amino acids, vitamins, nucleic acids, and / or other components that may be contained in the culture medium.

Culture solution

The culture solution of the CJMPB957 strain of the present invention may be a culture stock solution, and may be a solution from which the culture supernatant is removed from the culture stock solution and / or a solution thereof. The culture medium may contain the CJMPB957 strain.

The composition of the culture solution is not particularly limited, and may include not only components known to be necessary for culturing Bacillus strains, but also components that synergistically act on the growth of Bacillus, and the composition thereof is conventional in the art. It can be easily chosen by one with knowledge.

The culture solution may be in a liquid state or a dry state.

The method of drying the culture solution is not particularly limited and may be a method commonly used in the art. Non-limiting examples of the drying method include ventilation drying, natural drying, spray drying or freeze drying. These may be used alone or in combination of two or more methods.

According to another aspect of the present invention, there is provided a probiotic formulation comprising the CJMPB957 strain or a culture of the strain.

Probiotics (Probiotics) means a microorganism or a component that exhibits a beneficial effect on the health of the host, such as humans and animals, and settles on the gut wall of the host intestine and serves to inhibit the settlement of other harmful bacteria and the growth of pathogens. The beneficial digestive enzymes produced by probiotics are known to facilitate the absorption and utilization of nutrients.

Probiotic formulations of the present invention may be one comprising the CJMPB957 strain and / or culture of the strain.

Probiotics of the present invention may preferably comprise the CJMPB957 strain 5 x 10 ⁴ to 5 x 10 ¹⁰ CFU / ㎖, more preferably 1 x 10 ⁶ to 1 x 10 ⁹ CFU / ㎖ have.

The probiotic formulation may further include a pharmaceutically acceptable carrier, and may be provided in combination with the carrier.

The pharmaceutically acceptable carrier refers to a carrier or diluent that does not stimulate an organism and does not inhibit the biological activity and properties of the administered compound.

In the carrier, carriers usable in probiotic formulations that are formulated as liquid solutions are suitable for sterilization and living bodies, such as saline solution, sterile water, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution or glycerol. Can be. These can be used individually or in mixture of 2 or more types, and can add other conventional additives, such as antioxidant, buffer, and / or bacteriostatic agent, as needed.

Diluents, dispersants, surfactants, binders and / or lubricants may also be added in addition to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.

Formulations for oral administration comprising the probiotic formulations of the present invention as an active ingredient are not particularly limited and may be used as formulations known in the art. Non-limiting examples of such oral dosage forms include tablets, troches, lozenges, water-soluble or oily suspensions, preparation powders or granules, emulsions, hard or soft capsules, syrups or elixirs, and the like.

For formulation into such tablets or capsules, lactose, saccharose, sorbitol, mannitol, starch, amylopectin, binders such as cellulose or gelatin, excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch, stearic acid Lubricating oils such as magnesium, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax and the like, and the capsule formulation may further contain a liquid carrier such as fatty oil in addition to the above-mentioned materials.

According to another aspect of the present invention, there is provided a feed additive comprising the probiotic formulation.

Probiotic formulations comprising the CJMPB957 strain of the present invention and / or cultures thereof may be separately prepared in the form of feed additives and mixed into the livestock feed, or may be mixed in such a manner as to directly add the probiotic preparations during feed preparation.

The form of the feed additive is not particularly limited and may be preferably in the liquid or dry state, more preferably in the form of dry powder.

The drying method of the dry powdered probiotic formulation is not particularly limited and may be a method known in the art. Non-limiting examples of the drying method include ventilation drying, natural drying, spray drying or freeze drying. These may be used alone or in combination of two or more methods.

The feed additive may further include other additives that can increase the shelf life of the feed in addition to the probiotic formulations comprising CJMPB957 of the present invention and / or its culture.

Additives that may be additionally included in the feed additives of the present invention are not particularly limited and may be those known in the art. Non-limiting examples of the additives include, but are not limited to, binders, emulsifiers, preservatives, and the like, which prevent degradation of feed additives; Amino acids, vitamins, enzymes, flavors, non-protein nitrogen compounds, silicates, buffers, extractants, oligosaccharides, etc., which increase their utility. It may include. These may be used alone or in combination of two or more.

The probiotic formulations or feed additives of the present invention may be administered to an animal alone or in combination with other feed additives in an edible carrier. It may also be administered directly to top dressings, livestock feed, oral formulations separate from the feed, or in combination with other ingredients.

According to another aspect of the present invention, there is provided a feed comprising the feed additive.

The feed of the present invention may include the feed additive preferably 0.05 to 10 parts by weight with respect to 100 parts by weight of feed, more preferably 0.1 to 1 part by weight. Within this range, it is possible to effectively increase the digestibility of the livestock, thereby increasing the efficiency of the feed.

The components of the feed of the present invention are not particularly limited and may be known in the art. Non-limiting examples of the feed ingredients include, but are not limited to, cereals, fruits, food processing by-products, algae, fibres, oils, starches, gourds, grain by-products, etc .; Animals include proteins, inorganic substances, fats and oils, minerals, fats and oils, single cell proteins, zooplankton, fish meal and the like. These may be used alone or in combination of two or more.

Livestocks which can use the probiotic formulations, feed additives or feed comprising the feed additives of the present invention include, for example, edible cows, cows, calves, pigs, piglets, sheep, goats, horses, rabbits, dogs, cats and the like. Such as, but not limited to livestock and poultry such as chicks, chickens, domestic chickens, roosters, ducks, geese, turkeys, quails and the like.

According to another aspect of the present invention,

Administering at least one species selected from the group consisting of the CJMPB957 strain of the present invention and / or a probiotic formulation comprising a culture of said strain, a feed additive comprising said probiotic formulation and a feed comprising said feed additive It includes a, provides a method for preventing or treating bacterial or fungal diseases of the livestock.

The term "prevention" means any action that inhibits or delays the disease by providing the CJMPB957 strain and / or a culture of the strain to a target animal in the form of a pharmaceutical preparation or in an ingestible form such as a feed additive. it means.

The term "treatment" means that the CJMPB957 strain and / or the culture of the strain is provided to a subject animal in the form of a pharmaceutical preparation or in a feedable form such as a feed additive to improve the pathological condition of the pre-infected disease. It means all actions.

The bacterial diseases include, for example, diarrheal disease caused by enterocoliform Escherichia coli, colibailosis caused by avian pathogenic E. coli, sepsis, Salmonellosis causing acute acute enteritis, Salmonellosis caused by Clostridium (Gangrenous enteritis) And the like, but is not limited thereto.

The fungal disease may include, but is not limited to, aflatoxin poisoning (Aspergillosis) that causes, for example, decreased appetite, fever, shortness of breath, diarrhea, and convulsions caused by the genus Aspergillus.

The probiotic formulations may be administered to animals in the form of pharmaceutical preparations, or mixed with animal feed or drinking water and fed to them, and more preferably, mixed with feeds in the form of feed additives. .

The route of administration of the probiotic agent may be administered through various routes of oral or parenteral without particular limitation as long as it can reach the target tissue, and specifically, oral, rectal, topical, intravenous, intraperitoneal, intramuscular, arterial It may be administered in a conventional manner through intradermal, transdermal, nasal, inhalation, and the like.

Hereinafter, the present invention will be described in more detail by describing Examples. However, the following embodiments are only examples of the present invention and should not be construed as limiting the scope of the present invention.

Example  One

Bacillus Subtilis ( Bacillus subtilis ) CJMBP957  Isolation of strain

(1) Sample acquisition and strain isolation

Meju and various enteric samples, which are traditional fermented foods, were obtained, and the obtained samples were gradually diluted and incubated in BHI solid medium (Difco, USA) added with 3% sodium chloride (Difco, USA) for 24 hours at 37 ° C.

Strains isolated from each sample were grouped according to colony observation to isolate strains. Selected colonies were purely separated by culturing in a new medium over three times, and the pure cultured cells were stored in a medium added with 20% glycerol (glycerol) and stored below minus 70 ° C.

(2) Selection of strains with excellent combined antibacterial activity

Enteric coliform (ETEC), avian pathogenic E. coli (APEC), Salmonella typhimu are isolated against the enteric strains isolated for the primary selection of strains with the antimicrobial activity against Escherichia coli and Salmonella, the representative pathogenic bacteria in chicken and pig Antimicrobial evaluation was performed on three species of Salmonella typhimurium (ST). The antimicrobial evaluation was evaluated through the clear zone analysis of pathogenic bacteria.

In the preparation of the YM (Difco, USA) solid medium, an antimicrobial evaluation medium was prepared by mixing 0.4% of each of the three pathogenic bacteria shaking cultures. 1.5 μl of the enteric-derived bacteria culture medium was dropped on the prepared evaluation medium, followed by incubation at 37 ° C. for 18 hours, and the presence or absence of growth inhibition ring formed around the selected strain was observed. Among the enterobacteria derived bacteria, 13 strains showing antimicrobial activity against the three pathogenic bacteria were selected first.

The 13 primary strains with excellent combined antimicrobial activity were evaluated for antimicrobial activity against three enterococci E. coli and Clostridium perfringens . E. coli used ETECO149 to produce K88 adherence pili, ETECO122 to produce K88 and 987p, and ETEC2617 to produce K99. In the evaluation of Clostridium perfringens, the culture supernatant of the selected strain was used, and the culture was carried out in the same manner as above except that the culture supernatant was cultured at 37 ° C under anaerobic conditions.

As a result, as shown in Table 1, three strains (739, 823, 957) with excellent antibacterial activity were selected as candidate strains.

ETEC APEC ST Clostridium
perfringens 0122 0149 2617 739 +++ +++ ++ +++++ +++++ - 823 +++ +++ ++ ++++ ++++ ++ 957 +++ +++ ++ +++ +++ +++

Example  2

Toxicity  In vitro for E. coli in vitro Antimicrobial Activity Assessment

The inhibitory effect of two enterocoliform Escherichia coli strains on the three candidate strains with excellent antibacterial activity was measured in vitro.

Three kinds of candidate strains, ETECO122, and ETECO149 were respectively inoculated in BHI liquid medium at 0.1%, and incubated at 37 ° C. and 200 rpm for 15 hours. One candidate strain and one ETEC were inoculated simultaneously at about 1 × 10 ⁵ CFU / mL in 1/2 BHI liquid medium and incubated at 37 ° C. and 200 rpm. The culture medium for each time period was plated on BHI solid medium and MacConkey (Difco, USA) solid medium to determine the number of candidate strains and ETEC.

The results are shown in Table 2 and FIGS. 2A and 2B, and it was confirmed that the 957 strain had a better growth inhibitory effect on ETEC O122 and ETEC O149 when incubated for 24 hours or more. Accordingly, 957 was finally selected as an excellent antimicrobial activity strain, which was named CJMPB957.

The final selected CJMPB957 was shown to have excellent antimicrobial activity against enterococci E. coli, avian pathogenic E. coli, Salmonella typhimurium, Clostridium perfringens, the antimicrobial activity results are shown in FIG.

Example  3

CJMPB957  Investigation and Identification of Morphological and Biochemical Properties of Strains

(1) Morphological and biochemical characterization

In order to identify the CJMPB957 strain finally selected as an excellent strain of complex digestive enzyme activity, morphological and biochemical investigations were performed primarily. The morphological characteristics were confirmed to be Gram-positive bacillus (FIG. 1), and the sugar fermentation pattern of CJMPB957 strain was analyzed by API 50 CHB system (biomerieux, France) to analyze biochemical properties.

Table 3 below shows the results of analyzing the sugar release pattern of the CJMPB957 strain.

In Table 3, '+' is positive, '-' is negative, and the control is an experimental group without a substrate.

According to the results of Table 3, CJMPB957 strain was confirmed that the Bacillus subtilis (Bacillus subtilis) and a homology of 92.2%.

(2) Identification of CJMPB957 Strains

For more accurate identification of CJMPB957 strains, molecular phylogenetic methods based on DNA sequences were performed.

Sequencing was performed to amplify the gene of 16s rDNA using PCR premix (Bionia, South Korea) and Universal Primer 27F (5'AGAGTTTGATCCTGGCTCAG3 ': SEQ ID NO: 2) and 1492R (5'GGTTACCTTGTTACGACTT 3': SEQ ID NO: 3). In the amplification of the gene, the total reaction solution was adjusted to 20 μl, and a total of 30 times of 94 ° C 1 minute, 56 ° C 1 minute, and 72 ° C 1 minute was repeated, and the amplified DNA sequences were analyzed. The base sequence of the analyzed 16s rDNA of the CJMPB957 strain is shown in SEQ ID NO: 1 (FIG. 8).

As a result of the analysis, it was identified as a microorganism having 98% homology with Bacillus subtilis.

The novel microorganism Bacillus subtilis (Bacillus subtilis) CJMPB957 of the present invention are identified in the same way as the Korea Culture Center of Microorganisms on March 22, 2012 (Korean Culture Center of Microorganisms, Seodaemun-gu, Seoul 361-221 Hongje 1 East Deposited as KCCM11271P.

Example  4

CJMPB957  Antifungal Activity of Strains

To investigate the antimicrobial activity superior strain CJMPB957 antifungal activity of the antifungal activity were evaluated for Aspergillus Plastic bus (Aspergillus flavus) in question in the feed.

Aspergillus was used by incubation at 30 ° C. for 72 hours in a PDA (Difco, USA) solid medium. Aspergillus incubated in solid medium was cut into 5 mm × 5 mm (horizontal × vertical) sizes and inoculated in the center of fresh PDA solid medium and incubated for 24 hours.

10 μl of activated CJMPB957 was dispensed into a solid medium in which Aspergillus was cultured and cultured at 30 ° C. for 48 hours to observe the formation of inhibited growth ring of Aspergillus.

As shown in Figure 4, by confirming that Bacillus subtilis CJMPB957 inhibits the growth of Aspergillus, it was confirmed that the strain has antifungal activity.

Example  5

CJMPB957  Digestive Enzyme Activity of Strains

Digestive enzyme activity was evaluated for protease, cellulase, amylase, xylanase, metase, lipase and phytase to determine the digestive enzyme production capacity of the Bacillus subtilis CJMPB957.

In the enzyme activity evaluation, the enzyme activity ability was measured according to the degree of clear ring formation using a medium containing a substrate for each enzyme.

1) Collection of crude enzyme solution

The culture supernatant of CJMPB957 strain was cultured in BHI liquid medium for 24 hours and 48 hours, centrifuged at 4 ° C and 13,000 rpm for 5 minutes, and the final supernatant was used as crude enzyme solution for enzyme activity analysis. The degree of substrate degradation was determined using a medium containing each substrate of each enzyme.

2) protease activity

YM (Yeast extract 3g / L, Malt extract 3g / L, Peptone 5g / L, Dextrose 10g / L, Agar 20g / L) with 2% skim milk (Skim milk, Sigma, USA); Difco, USA, 'YM medium') media were prepared. 1.5 μl of the crude enzyme solution collected above was dispensed into a substrate medium, and then reacted at 30 ° C. for 15 hours, and then enzyme activity was measured according to the degree of formation of a transparent ring.

3) cellulase activity

YM medium to which 1% CMC (carboxyl methyl cellulose) substrate was added was prepared. 1.5 μl of the coenzyme solution collected above was dispensed into a substrate medium, and then reacted at 37 ° C. for 15 hours, and then stained with 0.2% Congo red aqueous solution for 30 minutes and decolorized with 1M aqueous NaCl solution. The activity of the enzyme was measured according to the degree of formation of the clear ring formed by decomposition of the substrate around the crude enzyme solution.

4) amylase activity

YM medium was prepared to which 1% soluble starch substrate was added. 1.5 μl of the coenzyme solution collected above was dispensed into the substrate medium, and then reacted at 37 ° C. for 15 hours. After dyeing with an aqueous solution containing 0.1% and 2% of I ₂ and KI, respectively, the activity of the enzyme was measured according to the degree of formation of a transparent ring formed by decomposition of the substrate around the crude enzyme solution.

5) xylanase activity

YM medium was prepared with 1% xylan added. 1.5 μl of the crude enzyme solution was dispensed into the substrate medium, reacted at 37 ° C. for 15 hours, and then stained with 0.2% aqueous solution of Congo Red for 30 minutes, and decolorized with 1M aqueous NaCl solution. Then, the enzyme activity was measured according to the degree of transparent ring formation.

6) metase activity

Substrate medium (Yeast extract 3g / l, Peptone 5g / l, KH ₂ PO ₄ 1g / l, Agar 20g / l, pH 5) added with 1% mannan (logust bean gum, sigma, USA) was prepared. 1.5 μl of the crude enzyme solution was dispensed into the substrate medium, and then reacted at 37 ° C. for 24 hours, and then enzyme activity was measured according to the degree of transparent ring formation.

7) Lipase Activity

YM medium was prepared to which 1% tricaprylin was added. 1.5 μl of the crude enzyme solution was dispensed into a substrate medium, and then reacted at 37 ° C. for 15 hours, and then enzyme activity was measured according to the degree of formation of a clear ring.

8) phytase activity

Substrate medium (Glucose 15g / l, NH ₄ NO ₃ 5g / l, MgSO ₄ 7H ₂ O 0.5g / l, KCl 0.5g / l, with 1% phytic acid, sigma, USA) 0.01 g / L FeSO ₄ 7H ₂ O, 0.01 g / L MnSO ₄ 4H ₂ O, 20 μl of Agar, pH5.5). 1.5 μl of the crude enzyme solution was dispensed into the substrate medium, and then reacted at 37 ° C. for 24 hours, and then enzyme activity was measured according to the degree of formation of the transparent ring.

Digestive enzyme activity of the CJMPB957 is shown in Table 4 and FIG.

Protease Cellulase Amylase Xylanase Mannanase Lipase Phytase CJMPB957 ++ +++ ++ ++ +++++ + +

In Table 4 and Figure 5 above As shown, Bacillus subtilis CJMPB957 was confirmed to be excellent in complex digestive enzyme activity as well as antibacterial and antifungal activity.

Example  6

CJMPB957  Endogenous Spores of Strains Formability

Bacillus forms endogenous spores to survive when stressed, such as depletion of one or more of the essential nutrients. Endogenous spores are resistant to extreme environments such as ultraviolet light, high temperature, low temperature drying and high pressure, so formation of endogenous spores is very important in maintaining the viability of Bacillus. For this reason, Bacillus subtilis CJMPB957 was cultured for a long time to confirm the endogenous spore forming ability.

0.1% of the bacteria was inoculated into the BHI liquid medium, and cultured at 37 ° C. and 200 rpm for 24 hours and 48 hours. The total bacterial count was measured by smearing the culture medium in each time zone in BHI solid medium, and the culture solution heat-treated at 95 ° C. for 10 minutes was smeared in BHI Agar medium to determine the number of endogenous spores.

Table 5 below shows the measurement results of the endogenous spores.

Incubation time (h) gun Number of bacteria ( CFU / Ml) Endogenous Spore Count ( CFU / Ml) Spore Formation rate (%) 24 1.4 × 10 ⁹ 1.4 × 10 ⁹ 100 48 1.9 × 10 ⁹ 1.9 × 10 ⁹ 100

As shown in Table 5, 100% endogenous spores were formed when CJMPB957 was incubated for 24 hours or longer.

Therefore, Bacillus subtilis CJMPB957 of the present invention has a high endogenous spore forming ability when cultured for more than 24 hours, it is determined that it can maintain a high survival rate in the digestive organs of animals when used as probiotics.

Example  7

CJMPB957  Strain Acid resistance  And My bile

Probiotic strains must be resistant to strongly acidic gastric juice and bile fluid in order to survive and reach the intestine, the final target site. For this reason, in order to confirm the application of Bacillus subtilis CJMPB957 as a probiotic strain of the present invention, acid resistance and bile resistance were confirmed.

(1) acid and artificial gastric juice resistance

Artificial gastric juice was prepared by adding 1% (w / v) of pepsin (Pepsin; Sigma, USA) to a 0.05 M sodium phosphate solution adjusted to pH 2.5 using HCl.

After incubating the CJMPB957 strain for 24 hours at 37 ° C. and 200 rpm in a BHI liquid medium, the supernatant was discarded by centrifugation at 13,000 rpm for 5 minutes, and the cells were recovered, and artificial gastric juice was added in the same amount to the supernatant for 3 hours at 37 ° C. Incubated. After incubation, the BHI medium was plated to measure the number of bacteria to determine acid resistance and resistance to artificial gastric juice.

(2) artificial bile resistance

Artificial bile was sterilized by adding 1% (w / v) Pancreatin (Sigma, USA) to 0.05M sodium phosphate solution, and then sterilized with 10% (w / v) oxagall (Difco Co.) solution. Prepared by adding% (v / v) and adjusting the pH to 6.8.

CJMPB957 strain incubated for 3 hours in the artificial gastric juice of (1) was centrifuged at 13,000 rpm for 10 minutes to discard the supernatant, and the cells were recovered. . After incubation, the plate was plated on BHI medium to measure the number of bacteria to determine acid resistance and resistance to artificial bile.

The measurement results of the acid resistance and resistance to artificial gastric juice and artificial bile are shown in FIG. 6.

As shown in FIG. 6, CJMPB957 showed 100% survival rate when treated with artificial gastric juice of pH 2.5 for 2 hours, and 100% survival rate was maintained even after 24 hours of artificial bile treatment.

Therefore, Bacillus subtilis CJMPB957 of the present invention showed a high survival rate even after the chain treatment of artificial gastric juice and artificial bile, it could be confirmed that it can be usefully used as a probiotic strain.

Example  8

CJMPB957  Strain Stability

To determine the stability of CJMPB957, hemolysis (β-hemolysis) was investigated. β-hemolysis is the action of producing phospholipid enzymes in harmful bacteria to hydrolyze erythrocytes by hydrolyzing phospholipids supplied by red blood cells.

To determine the hemolytic properties of Bacillus subtilis CJMPB957, TSA (Difco, USA) containing 5% sheep blood (sheep blood, Kisan Biotech, Korea) was prepared. After linear inoculation (streaking) in the prepared blood agar medium, and cultured at 37 ℃ for 24 hours to confirm the hemolysis, as shown in Figure 7 it was confirmed that hemolysis is not shown.

Korea Microorganism Conservation Center (overseas) KCCM11271P 20120322

Attach an electronic file to a sequence list

Claims (8)

It has antimicrobial or antifungal activity against at least one of enterococci E. coli, avian pathogenic E. coli, Salmonella typhicurium, Clostridium perfringens and Asparagus plabus, and has proteases, cerulases, amylases, xylanases, and metases. A novel Bacillus subtilis CJMPB957 (KCCM11271P) strain having digestive enzyme production capacity, acid resistance and bile resistance of at least one of lipase, and phytase. A culture of the Bacillus subtilis CJMPB957 (KCCM11271P) strain according to claim 1. A probiotics preparation comprising the Bacillus subtilis CJMPB957 (KCCM11271P) strain of claim 1 or a culture of the strain of claim 2. A feed additive comprising the probiotic formulation of claim 3. A feed comprising the feed additive of claim 4. Preventing bacterial or fungal diseases of livestock, comprising administering to said livestock a composition comprising said Bacillus subtilis CJMPB957 (KCCM11271P) strain of claim 1 or a culture of said strain of claim 2 How to treat. 7. The method of claim 6, wherein the composition is at least one selected from the group consisting of probiotic agents, feed additives, and feed. The method of claim 6, wherein the bacterial or fungal disease is at least one selected from the group consisting of diarrheal disease, Colibailosis, sepsis, Salmonellosis, Gangrenous enteritis and Aflatoxin intoxication (Aspergillosis) A method of preventing or treating bacterial or fungal diseases of a livestock, comprising: a.

Images