KR101360680B1 - Method for screening inhibitor against hormonal skin aging - Google Patents
Method for screening inhibitor against hormonal skin aging Download PDFInfo
- Publication number
- KR101360680B1 KR101360680B1 KR1020130057717A KR20130057717A KR101360680B1 KR 101360680 B1 KR101360680 B1 KR 101360680B1 KR 1020130057717 A KR1020130057717 A KR 1020130057717A KR 20130057717 A KR20130057717 A KR 20130057717A KR 101360680 B1 KR101360680 B1 KR 101360680B1
- Authority
- KR
- South Korea
- Prior art keywords
- seq
- female
- expression
- genes
- skin aging
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/15—Medicinal preparations ; Physical properties thereof, e.g. dissolubility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/148—Screening for cosmetic compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
여성 호르몬에 의해 피부 각질형성세포에서 발현 패턴이 변화하는 유전자를 확인하고, 그 정보를 여성 호르몬 결핍으로 초래되는 여성의 피부 노화를 억제할 수 있는 노화 억제제 스크리닝에 이용하는 방법을 개시한다.Disclosed is a method of identifying genes whose expression patterns change in skin keratinocytes by female hormones, and using the information in screening of aging inhibitors that can suppress skin aging of women caused by female hormone deficiency.
Description
본 발명은 노화 억제제 스크리닝 방법에 관한 것이다.The present invention relates to a method for screening an aging inhibitor.
사람의 유전체는 3x109개의 염기쌍으로, 대략 5 만개의 유전자를 가지고 있는 것으로 추측되며, 하나의 세포에서 발현되는 기능성 유전자의 개수는 대략 10,000개 정도로 추정된다. 즉 50,000개의 유전자로부터 약 10,000개의 단백질만을 선택적으로 만들어내고 있으며, 어떤 단백질을 발현하느냐에 따라 그 세포의 기능적 특성이 결정된다. 세포의 유전자 발현 특성의 차이는 단지 서로 다른 세포 간에서만 나타나는 것이 아니며, 동일한 세포의 병적인 상황, 예를 들면 젊은 세포와 노화된 세포 간에도 유전자 발현 특성의 차이가 나타난다. 종래의 생명과학은 이러한 유전자 발현의 변화를 일대일의 관계로부터 찾았으나, 특정 단백질의 작용은 하나의 단백질에만 국한되는 것이 아니라 다양한 단백질의 발현에 관여하며, 세포의 특성 또한 하나의 특정 단백질에 의하여 결정되는 것이 아니라 다양한 단백질들의 특성이 총체적으로 조화를 이룸으로써 결정된다는 점을 생각할 때 종래의 접근은 매우 제한적일 수밖에 없다. The human genome is estimated to have 3x10 9 base pairs, approximately 50,000 genes, and the number of functional genes expressed in one cell is estimated to be approximately 10,000. In other words, only about 10,000 proteins are selectively produced from 50,000 genes, and the functional characteristics of the cells are determined according to which proteins are expressed. The difference in gene expression characteristics of a cell does not only appear between different cells, but also a pathological condition of the same cell, for example, a difference in gene expression characteristics between young cells and aged cells. Conventional life sciences have found such changes in gene expression from a one-to-one relationship, but the action of specific proteins is not limited to one protein, but is involved in the expression of various proteins, and the characteristics of cells are also determined by one specific protein. Considering that the properties of various proteins are determined by harmonizing overall, the conventional approach is bound to be very limited.
피부의 노화 과정 또한 다른 생리 현상과 비슷하게, 외부 자극(UV, ROS 등)과 세포 내에 내재적으로 존재하는 인자(유전자, 단백질)의 상호 작용에 의해 결정되므로 이런 여러 인자들을 아울러 관찰할 필요가 있다. 하지만 지금까지 피부 노화에 대한 연구는 노화를 유도하는 외적 인자에 의한 세포/조직 내의 내적 인자의 변화를 모니터하는 것이었으므로, 연령 증가에 따른 내재적 노화를 이해하는데 한계가 있었다. 또한, 피부 노화의 여러 현상과 노화 사이의 인과 관계가 명확하지 않기 때문에 효과적인 노화 조절 방법이 개발되지 못하고 있고, 노화 피부 세포의 특성을 총체적으로 이해하기 위해 다양한 단백질들의 특성을 이해하려는 시도 또한 효능 물질(RA, 진세노사이드 등) 이나 자극원(UV, ROS)을 세포에 처리한 배양 시스템 연구에 국한되어 그 한계를 가지고 있다.The aging process of the skin is also determined by the interaction of external stimuli (UV, ROS, etc.) and factors (genes, proteins) inherent in cells, similar to other physiological phenomena, so it is necessary to observe these factors together. However, until now, studies on skin aging have been limited in understanding the intrinsic aging with increasing age, since it has been to monitor changes in internal factors within cells/tissues caused by external factors that induce aging. In addition, since the causal relationship between various phenomena of skin aging and aging is not clear, effective aging control methods have not been developed, and attempts to understand the properties of various proteins in order to comprehensively understand the properties of aging skin cells are also effective substances. (RA, ginsenosides, etc.) or stimulants (UV, ROS) are limited to the study of culture systems in which cells are treated, and there is a limitation.
연령 증가에 따른 여성 피부의 내재적 노화와 관련하여, 폐경기 즈음 여성이 경험하게 되는 매우 갑작스런 피부 변화를 근거로 여성 호르몬의 결핍이 하나의 원인으로 지목되고 있다. 특히, 활성을 가지는 여성 호르몬인 17 베타-에스트라디올(E2)은 피부에서 콜라겐의 함량과 질을 개선시키고, 피부의 두께를 증가시키며, 혈관 형성을 촉진시킨다고 알려져 있다. 또한, 여성 호르몬은 여성의 표피에서의 세포분열 및 피부의 상처 치유 속도 및 정도를 촉진시키는 것으로 알려져 있다. Regarding the intrinsic aging of women's skin with increasing age, a lack of female hormones has been pointed out as a cause based on the very sudden skin changes experienced by women around menopause. In particular, 17 beta-estradiol (E2), an active female hormone, is known to improve the content and quality of collagen in the skin, increase the thickness of the skin, and promote blood vessel formation. In addition, female hormones are known to promote the rate and extent of cell division in the epidermis of women and wound healing of the skin.
그러나 이와 같이 여성 호르몬이 피부에 미치는 여러 영향에 대한 중요성이 부각되고 있음에도 불구하고, 여성 호르몬의 피부에서의 작용점이나 작용 기작에 대한 세포 수준, 또는 세포 하위 수준에서의 연구는 매우 미흡하다. 또한 표피의 미세 환경에서의 여성 호르몬 작용 기작에 대한 연구는 충분히 진행되지 못하였다. 그리고 E2에 의한 특정 유전자 개개의 발현 조절에 초점이 맞추어진 최근의 연구는 E2에 대한 각질 세포의 반응을 전체적으로 설명하기에 한계가 있다. However, although the importance of the various effects of female hormones on the skin is emerging, studies on the action points or mechanisms of action of female hormones on the skin at the cellular level or at the sub-cellular level are very insufficient. In addition, studies on the mechanism of action of female hormones in the microenvironment of the epidermis have not been sufficiently conducted. In addition, recent studies focused on the regulation of individual expression of specific genes by E2 are limited in explaining the overall response of keratinocytes to E2.
E2의 작용은 핵에 존재하는 특정 수용체(estrogen receptors)를 경유하는 과정과 세포막에서 시작되는 신호 전달 과정(membrane-initiated signal transduction pathways)으로 크게 나누어지고 이 과정에 참여하는 수 많은 인자들 간의 상호 작용이 복잡하게 얽혀 있는 것으로 밝혀지고 있다.The action of E2 is largely divided into a process via specific receptors present in the nucleus (estrogen receptors) and a membrane-initiated signal transduction pathway (membrane-initiated signal transduction pathways), and the interactions between a number of factors participating in this process. It turns out to be intricately intertwined.
본 발명자들은 폐경기 여성의 피부 조직으로부터 분리한 각질형성세포에서 여성 호르몬에 의해 그 발현 패턴이 변화되는 유전자 및 이들 유전자의 발현을 조절하는 전사인자 유전자를 생물정보학 기법으로 추출하여, 이를 여성 호르몬 결핍으로 초래되는 여성 피부의 내재적 노화 진단을 위한 분자 표적으로 새로이 규명하였다. 이를 통해 본 발명은 여성 호르몬 결핍으로 초래되는 여성 피부 노화 억제제 개발을 위한 스크리닝 방법을 제공하고자 한다.The present inventors extracted genes whose expression patterns are changed by female hormones in keratinocytes isolated from skin tissues of menopausal women, and transcription factor genes that control the expression of these genes by bioinformatics techniques, and this resulted in female hormone deficiency. It has been newly identified as a molecular target for the diagnosis of intrinsic aging in female skin that results. Through this, the present invention is to provide a screening method for the development of female skin aging inhibitors caused by female hormone deficiency.
본 발명의 일측면은 세포에 시험 화합물을 처리하는 단계; 및 시험 화합물 처리 후 세포 내 INSIG1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, NUDC, NCOA4, PSMD11, SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM8A1, NET1, CCND2, BNIP1, ARMC6, ALDOC, CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R2, PKM2, GIPC1, RRM1, RPL26, WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1,TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19 및 PIGC 유전자로 구성되는 군에서 선택되는 하나 이상의 유전자의 발현이 촉진되는지 확인하는 단계를 포함하는 노화 억제제 스크리닝 방법을 제공한다.In one aspect of the present invention, the cell is treated with a test compound; And intracellular INSIG1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, NUDC, NCOA1, PSMD11, and SFRS. , CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAMC8A1, BNIP1, CAPC6A1, NETC1, CCND , CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R2, PKM74 , S100A2, SCAMP3, TBC1D4, TUBB, PSMD1, TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19, and the expression of one or more genes selected from the group consisting of PIGC genes. It provides a method of screening for an aging inhibitor comprising the step of determining whether it is promoted.
본 발명의 다른 일측면은 세포에 시험 화합물을 처리하는 단계; 및 시험 화합물 처리 후 세포 내 DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, MLL, NPC1, ADAM8, BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFP36, ARPP-19, HIF1A, FXR2, CDCP1, CCNB1IP1, GOLGA4, ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP4A1, PTPN12, RTN3, SEC24D, SLC3A2, YARS, ACTB, CHD2, NOTCH1 및 ANKIB1 유전자로 이루어진 군에서 선택되는 하나 이상의 유전자의 발현이 억제되는지 확인하는 단계를 포함하는 노화 억제제의 스크리닝 방법을 제공한다.Another aspect of the present invention is the step of treating the test compound to the cells; And intracellular DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, MLL5, KLF6, MLL , BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFP1GA, AR4IP-19, HIFNBOL1, CCR1PP1, HIFNBOL , ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP12, RTLC3, SEC24, PTP4A1, SEC24 , YARS, ACTB, CHD2, NOTCH1 and ANKIB1 provides a method for screening an aging inhibitor comprising the step of checking whether the expression of one or more genes selected from the group consisting of genes is suppressed.
본 발명의 또 다른 일측면은 SREBF1(SREBP1), LMO2, TFAP2A, XBP1, MEF2A, LEF1, RUNX2(OSF2), PATZ1(MAZR), IKZF1(LYF1, ZNFN1A1), THRA, PITX2, NKX2-5, SOX5, MYOG, MEIS1, IRF1, GATA3, TBX5, AP1(FOS/JUN), TBP, SP1, HNF4A, KLF12(AP2REP), NKX2-1(TTF1), MYOD1, RUNX1(AML1) 및 ZEB1 (AREB6) 유전자로 이루어진 군으로부터 선택된 유전자 및 유니버설(universal) 프로모터를 포함하는 플라스미드, 및 상기 선택된 유전자에 의해 코딩되는 전사인자가 결합하는 DNA 서열 및 리포터 유전자를 포함하는 플라스미드를 세포에 트랜스펙션시키는 단계; 상기 세포에 시험 화합물을 처리하는 단계; 및 상기 시험 화합물이 상기 리포터 유전자의 발현을 촉진하는지 여부를 확인하는 단계를 포함하는 것을 특징으로 하는 노화 억제제 스크리닝 방법을 제공한다.Another aspect of the present invention is SREBF1 (SREBP1), LMO2, TFAP2A, XBP1, MEF2A, LEF1, RUNX2 (OSF2), PATZ1 (MAZR), IKZF1 (LYF1, ZNFN1A1), THRA, PITX2, NKX2-5, and Group consisting of MYOG, MEIS1, IRF1, GATA3, TBX5, AP1 (FOS/JUN), TBP, SP1, HNF4A, KLF12 (AP2REP), NKX2-1 (TTF1), MYOD1, RUNX1 (AML1) and ZEB1 (AREB6) genes Transfecting cells with a plasmid comprising a gene selected from and a universal promoter, and a plasmid comprising a reporter gene and a DNA sequence to which the transcription factor encoded by the selected gene binds; Treating the cells with a test compound; And determining whether the test compound promotes the expression of the reporter gene.
본 발명은 여성 호르몬에 의해 피부 유래 각질형성세포에서 기준치 이상으로 발현이 증가되는 유전자와 발현이 감소되는 유전자, 및 이들 유전자의 프로모터 영역에 존재하는 전사인자 결합 부위로부터 생물정보학 기술을 이용해 추출한 전사인자 유전자를 여성 호르몬의 결핍으로 초래되는 여성 피부 노화에 대한 마커 유전자로 하여, 시험 화합물이 상기 유전자들의 발현 촉진 또는 억제하는지 여부를 확인함을 통해 노화 억제제로 이용 가능한지 알 수 있게 한다. 또한 상기 유전자들을 이용하여 피부 노화 정도를 빠르게 진단할 수 있게 하며, 이들 유전자를 피부 노화 억제제 개발을 위한 유전자 타겟으로 활용하고, 개발된 피부 노화 억제제를 평가하는 방법으로 활용할 수 있다.The present invention is a transcription factor extracted using bioinformatics technology from a gene whose expression is increased above a reference value in skin-derived keratinocytes by a female hormone, a gene whose expression is reduced, and a transcription factor binding site present in the promoter region of these genes. Using the gene as a marker gene for female skin aging caused by a lack of female hormones, it is possible to know whether the test compound can be used as an aging inhibitor by confirming whether the test compound promotes or inhibits the expression of the genes. In addition, the genes can be used to quickly diagnose the degree of skin aging, and these genes can be used as gene targets for the development of skin aging inhibitors, and used as a method for evaluating the developed skin aging inhibitors.
도 1은 폐경기 여성의 피부에서 유래한 각질형성세포에 여성 호르몬 처리(처리군 1), 여성 호르몬과 여성 호르몬의 길항제인 ICI-182780 처리(처리군 2), 무처리(음성 대조군) 후 24시간 경과 시점의 세포의 모습이다.
도 2는 폐경기 여성의 피부에서 유래한 각질형성세포에 여성 호르몬을 처리했을 때 세포 분열이 증가함을 보여주는 형광 유세포분석 결과이다.
도 3은 폐경기 여성의 피부에서 유래한 각질형성세포에 여성 호르몬 처리(처리군 1), 여성 호르몬과 여성 호르몬의 길항제인 ICI-182780 처리(처리군 2), 무처리(음성 대조군) 후의 유전자 발현 패턴 클러스트링 분석 결과이다.
도 4는 폐경기 여성의 피부에서 유래한 각질형성세포에 여성 호르몬을 처리한 후 발현이 변화된 유전자를 유전자 온톨로지(Ontology) 분류 체계에 따라 기능별로 분류한 그림이다.
도 5 내지 도 9는 여성 호르몬에 의한 유전자들의 발현 변화를 실시간(real-time) PCR로 확인한 결과이다.
도 10은 여성 호르몬에 의해 변화한 유전자와 이를 조절하는 전사인자 간의 상호 작용을 보여주는 매트릭스 맵이다.
도 11은 여성 호르몬에 의한 전사인자들의 발현 변화를 보여주는 실시간(real-time) PCR 결과이다.
도 12 내지 17은 전사인자의 발현을 억제시켰을 때 세포 분열 지표인 사이클린 D2의 발현 변화를 보여주는 그림이다.
도 18은 전사인자의 발현을 억제시켰을 때 노화 지표인 p21의 발현 변화를 보여주는 그림이다.
도 19 내지 21은 전사인자의 발현을 shRNA로 억제시켰을 때 여성 호르몬에 의한 전사 반응의 변화를 보여주는 그림이다.1 is a female hormone treatment (treatment group 1) to keratinocytes derived from the skin of a postmenopausal female, 24 hours after treatment with female hormones and ICI-182780, an antagonist of female hormones (treatment group 2), and no treatment (negative control). This is the appearance of the cells at the time of elapsed time.
2 is a result of fluorescence flow cytometry showing that cell division increases when keratinocytes derived from the skin of a postmenopausal woman are treated with female hormones.
3 shows gene expression after treatment with female hormones (treatment group 1), treatment with female hormones and ICI-182780, an antagonist of female hormones (treatment group 2), and no treatment (negative control) in keratinocytes derived from the skin of postmenopausal women. This is the result of pattern clustering analysis.
4 is a diagram showing genes whose expression is changed after treatment of female hormones in keratinocytes derived from the skin of a postmenopausal woman by function according to a gene ontology classification system.
5 to 9 are results of confirming changes in the expression of genes caused by female hormones by real-time PCR.
10 is a matrix map showing the interaction between genes changed by female hormones and transcription factors that regulate them.
11 is a real-time PCR result showing changes in the expression of transcription factors by female hormones.
12 to 17 are diagrams showing changes in the expression of cyclin D2, an indicator of cell division, when the expression of transcription factors is suppressed.
18 is a diagram showing changes in the expression of p21, an indicator of aging, when the expression of transcription factors is suppressed.
19 to 21 are diagrams showing changes in transcriptional response by female hormones when the expression of transcription factors is suppressed with shRNA.
이하 본 발명을 더욱 구체적으로 설명한다. Hereinafter, the present invention will be described in more detail.
본 발명에서는 여성 호르몬에 의해 피부에서 유래한 각질형성세포에서 기준치 이상으로 발현이 증가되는 91종의 유전자와 발현이 감소되는 76종의 유전자, 이들 유전자의 프로모터 영역에 존재하는 전사인자 결합 부위로부터 생물정보학 기술을 이용해 추출한 전사인자 유전자 27종을 발굴하였으며, 이들이 폐경기 여성의 피부 노화와 관련이 있다는 사실은 아직까지 보고된 바 없다.In the present invention, 91 kinds of genes whose expression is increased above a reference level in keratinocytes derived from skin by female hormones, 76 kinds of genes whose expression is decreased, and a transcription factor binding site present in the promoter region of these genes Twenty-seven kinds of transcription factor genes extracted using informatics technology were discovered, and the fact that these are related to skin aging in postmenopausal women has not been reported yet.
하기 표 1은 폐경기 여성 피부에서 유래한 각질형성세포에서 여성 호르몬에 의해 기준치 이상으로 발현이 증가한 유전자, 표 2는 폐경기 여성 피부에서 유래한 각질형성세포에서 여성 호르몬에 의해 기준치 이상으로 발현이 감소한 유전자를 나열한 것이다. GBAcc는 NCBI의 genebank accession ID를 의미한다.Table 1 is a gene whose expression is increased above the reference level by female hormones in keratinocytes derived from menopausal female skin, and Table 2 is a gene whose expression is decreased by female hormones in keratinocytes derived from postmenopausal female skin. Is listed. GBAcc stands for NCBI's genebank accession ID.
이상의 폐경기 여성 피부에서 유래한 각질형성세포에서 여성 호르몬에 의해 기준치 이상으로 발현이 증가하거나 감소한 유전자에 대하여 프로모터 염기 서열을 분석한 결과, 통계값(fisher 통계, Z 통계, 하이퍼지오메트리(Hypergeometric) 통계, Audic 통계)을 기준으로 과다 관찰되는 전사인자 결합 영역(TRE)을 추출하고 그 출현 빈도 및 그에 결합되는 전사인자를 표기한 것이 하기 표 3이다.As a result of analyzing the promoter base sequence for genes whose expression increased or decreased above the reference level by female hormones in keratinocytes derived from the above menopausal female skin, statistical values (fisher statistics, Z statistics, hypergeometric statistics, and Audic statistics), the over-observed transcription factor binding region (TRE) was extracted, and the frequency of its appearance and the transcription factor bound thereto are indicated in Table 3 below.
AccessionAccession
IDID
NM_002228BX647104/
본 발명의 일측면은 R3HCC1, INSIG1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, NUDC, NCOA4, PSMD11, SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM8A1, NET1, CCND2, BNIP1, ARMC6, ALDOC, CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R2, PKM2, GIPC1, RRM1, RPL26, WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1,TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19 및 PIGC로 이루어진 군으로부터 선택된 하나 이상의 폴리뉴클레오티드 One aspect of the present invention is R3HCC1, INSIG1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, PS, NUMD11, NCOA4 SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM6, BNIPDOC1, FAM6, BNIP, NET CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R13L, PPP4R2, PRM2 One or more polynucleotides selected from the group consisting of WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1, TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19 and PIGC
또는 그 단편으로서 10개 이상의 연속 뉴클레오티드를 포함하는 폴리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드; 및 Or a polynucleotide comprising 10 or more contiguous nucleotides as a fragment thereof, or a complementary polynucleotide thereof; And
상기 폴리뉴클레오티드를 표면에 결합시킨 고상 지지체를 포함하며, It includes a solid support in which the polynucleotide is bound to the surface,
진단 대상 피부 유래 각질형성세포의 전사체 중에서 상기 폴리뉴클레오티드에 혼성화된 전사체의 양이 기준치 이하이면 여성 호르몬 결핍에 따른 노화 피부로 진단하는 피부 노화 진단 키트를 제공한다.Provided is a skin aging diagnostic kit for diagnosing aging skin due to female hormone deficiency when the amount of the transcript hybridized to the polynucleotide among the transcripts of the skin-derived keratinocytes to be diagnosed is less than or equal to a reference value.
본 발명의 다른 일측면은 DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, MLL, NPC1, ADAM8, BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFP36, ARPP-19, HIF1A, FXR2, CDCP1, CCNB1IP1, GOLGA4, ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP4A1, PTPN12, RTN3, SEC24D, SLC3A2, YARS, ACTB, CHD2, NOTCH1 및 ANKIB1로 이루어진 군으로부터 선택된 하나 이상의 폴리뉴클레오티드 또는 그 단편으로서 10개 이상의 연속 뉴클레오티드를 포함하는 폴리뉴클레오티드, Another aspect of the present invention is DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, AD , BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFP1GA, AR4IP-19, HIFNBOL1, CCR1PP1, HIFNBOL , ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP12, RTLC3, SEC24, PTP4A1, PTP4A3, PTP , One or more polynucleotides selected from the group consisting of YARS, ACTB, CHD2, NOTCH1 and ANKIB1, or a polynucleotide comprising 10 or more consecutive nucleotides as fragments thereof,
또는 그의 상보적 폴리뉴클레오티드; 및Or a complementary polynucleotide thereof; And
상기 폴리뉴클레오티드를 표면에 결합시킨 고상 지지체를 포함하며, It includes a solid support in which the polynucleotide is bound to the surface,
진단 대상 피부 유래 각질형성세포의 전사체 중에서 상기 폴리뉴클레오티드에 혼성화된 전사체의 양이 기준치 이상이면 여성 호르몬 결핍에 따른 노화 피부로 진단하는 피부 노화 진단 키트를 제공한다.Provides a skin aging diagnostic kit for diagnosing aging skin due to female hormone deficiency when the amount of the transcript hybridized to the polynucleotide among the transcripts of the skin-derived keratinocytes to be diagnosed is greater than or equal to a reference value.
본 발명의 일측면은 R3HCC1, INSIG1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, NUDC, NCOA4, PSMD11, SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM8A1, NET1, CCND2, BNIP1, ARMC6, ALDOC, CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R2, PKM2, GIPC1, RRM1, RPL26, WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1,TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19 및 PIGC로 이루어진 군으로부터 선택된 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드; 및 One aspect of the present invention is R3HCC1, INSIG1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, PS, NUMD11, NCOA4 SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM6, BNIPDOC1, FAM6, BNIP, NET CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R13L, PPP4R2, PRM2 18-22 as a fragment of a polynucleotide selected from the group consisting of WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1, TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19 and PIGC. One or more polynucleotides comprising four consecutive nucleotides; And
상기 군으로부터 선택된 폴리뉴클레오티드에 상보적인 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드를 포함하며, One or more polynucleotides comprising 18-22 contiguous nucleotides as a fragment of a polynucleotide complementary to a polynucleotide selected from the group,
진단 대상 피부 유래 각질형성세포에서 상기 폴리뉴클레오티드들을 프라이머로 하여 증폭된 DNA 양이 기준치 이하이면 여성 호르몬 결핍에 따른 노화 피부로 진단하는 피부 노화 진단 키트를 제공한다.Provided is a skin aging diagnostic kit for diagnosing aging skin due to female hormone deficiency if the amount of DNA amplified by using the polynucleotides as primers in the skin-derived keratinocytes to be diagnosed is less than a reference value.
본 발명의 다른 일측면은 DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, MLL, NPC1, ADAM8, BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFP36, ARPP-19, HIF1A, FXR2, CDCP1, CCNB1IP1, GOLGA4, ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP4A1, PTPN12, RTN3, SEC24D, SLC3A2, YARS, ACTB, CHD2, NOTCH1 및 ANKIB1로 이루어진 군으로부터 선택된 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드; 및Another aspect of the present invention is DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, AD , BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFP1GA, AR4IP-19, HIFNBOL1, CCR1PP1, HIFNBOL , ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP12, RTLC3, SEC24, PTP4A1, PTP4A3, PTP , One or more polynucleotides comprising 18-22 contiguous nucleotides as fragments of polynucleotides selected from the group consisting of YARS, ACTB, CHD2, NOTCH1 and ANKIB1; And
상기 군으로부터 선택된 폴리뉴클레오티드에 상보적인 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드를 포함하며, One or more polynucleotides comprising 18-22 contiguous nucleotides as a fragment of a polynucleotide complementary to a polynucleotide selected from the group,
진단 대상 피부 유래 각질형성세포에서 상기 폴리뉴클레오티드들을 프라이머로 하여 증폭된 DNA 양이 기준치 이상이면 여성 호르몬 결핍에 따른 노화 피부로 진단하는 피부 노화 진단 키트를 제공한다.Provided is a skin aging diagnostic kit for diagnosing aging skin due to female hormone deficiency when the amount of DNA amplified by using the polynucleotides as primers in the skin-derived keratinocytes to be diagnosed is greater than or equal to a reference value.
본 발명의 일측면은 R3HCC1, INSIG1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, NUDC, NCOA4, PSMD11, SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM8A1, NET1, CCND2, BNIP1, ARMC6, ALDOC, CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R2, PKM2, GIPC1, RRM1, RPL26, WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1,TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19 및 PIGC 유전자로 이루어진 군으로부터 선택된 유전자에 의하여 코딩되는 폴리펩티드에 대한 하나 이상의 모노클로날 항체를 포함하며, One aspect of the present invention is R3HCC1, INSIG1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, PS, NUMD11, NCOA4 SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM6, BNIPDOC1, FAM6, BNIP, NET CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R13L, PPP4R2, PRM2 WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1, TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19, and the polypeptide encoded by a gene selected from the group consisting of PIGC genes. It comprises one or more monoclonal antibodies against,
진단 대상 피부 유래 각질형성세포에서 상기 항체에 결합된 항원의 양이 기준치 이하이면 여성 호르몬 결핍에 따른 노화 피부로 진단하는 피부 노화 진단 키트를 제공한다.Provided is a skin aging diagnostic kit for diagnosing aging skin due to female hormone deficiency if the amount of antigen bound to the antibody in the skin-derived keratinocytes to be diagnosed is less than or equal to a reference value.
본 발명의 다른 일측면은 DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, MLL, NPC1, ADAM8, BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFP36, ARPP-19, HIF1A, FXR2, CDCP1, CCNB1IP1, GOLGA4, ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP4A1, PTPN12, RTN3, SEC24D, SLC3A2, YARS, ACTB, CHD2, NOTCH1 및 ANKIB1 유전자로 이루어진 군으로부터 선택된 유전자에 의하여 코딩되는 폴리펩티드에 대한 하나 이상의 모노클로날 항체를 포함하며, Another aspect of the present invention is DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, AD , BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFP1GA, AR4IP-19, HIFNBOL1, CCR1PP1, HIFNBOL , ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP12, RTLC3, SEC24, PTP4A1, PTP4A3, PTP , YARS, ACTB, CHD2, NOTCH1 and ANKIB1 comprises one or more monoclonal antibodies against a polypeptide encoded by a gene selected from the group consisting of genes,
진단 대상 피부 유래 각질형성세포에서 상기 항체에 결합된 항원의 양이 기준치 이상이면 여성 호르몬 결핍에 따른 노화 피부로 진단하는 피부 노화 진단 키트를 제공한다.
Provided is a skin aging diagnostic kit for diagnosing aging skin due to female hormone deficiency when the amount of antigen bound to the antibody in the skin-derived keratinocytes to be diagnosed is more than a reference value.
본 발명의 일측면은 피부의 노화를 진단하는 방법으로서, One aspect of the present invention is a method for diagnosing skin aging,
진단 대상 각질형성세포에서 R3HCC1, INSIG1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, NUDC, NCOA4, PSMD11, SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM8A1, NET1, CCND2, BNIP1, ARMC6, ALDOC, CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R2, PKM2, GIPC1, RRM1, RPL26, WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1,TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19 및 PIGC 유전자로 이루어진 군으로부터 선택되는 하나 이상의 유전자의 발현량이 기준치 이하이면 여성 호르몬 결핍에 따른 노화 피부로 진단하는 피부 노화 진단 방법을 제공한다.In keratinocytes to be diagnosed, R3HCC1, INSIG1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, PS, NUMD11, SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM6, BNIPDOC1, FAM6, BNIP, NET CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R13L, PPP4R2, PRM2 The expression level of one or more genes selected from the group consisting of WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1, TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19 and PIGC genes Provides a method for diagnosing skin aging to diagnose aging skin due to female hormone deficiency if it is less than the standard value.
본 발명의 다른 일측면은 피부의 노화를 진단하는 방법으로서, Another aspect of the present invention is a method for diagnosing skin aging,
진단 대상 각질형성세포에서 DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, MLL, NPC1, ADAM8, BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFP36, ARPP-19, HIF1A, FXR2, CDCP1, CCNB1IP1, GOLGA4, ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP4A1, PTPN12, RTN3, SEC24D, SLC3A2, YARS, ACTB, CHD2, NOTCH1 및 ANKIB1 유전자로 이루어진 군으로부터 선택되는 하나 이상의 유전자의 발현량이 기준치 이상이면 여성 호르몬 결핍에 따른 노화 피부로 진단하는 피부 노화 진단 방법을 제공한다.DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, MLL5, KLF6, MLL BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFPOLNB1, ARPP,-19, HIFOLNB1,191, GIFOL1 ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP12, RTN3A2, SECN24 Provides a method for diagnosing skin aging in which the expression level of one or more genes selected from the group consisting of YARS, ACTB, CHD2, NOTCH1, and ANKIB1 genes is greater than or equal to a reference value, thereby diagnosing aging skin due to female hormone deficiency.
본 발명의 진단 키트에서 프로브로 사용되는 폴리뉴클레오티드는 여성 호르몬에 의해 발현이 증가하거나 감소하는 마커 유전자의 전장(full length) 또는 그의 단편을 포함한다. 단편의 길이는 10개 이상의 연속 뉴클레오티드를 포함하는 것이 바람직한데, 이는 프로브의 길이가 10bps이하이면 비특이적으로 결합되기 때문이다.The polynucleotide used as a probe in the diagnostic kit of the present invention includes the full length of a marker gene whose expression is increased or decreased by female hormones or a fragment thereof. It is preferable that the length of the fragment includes 10 or more contiguous nucleotides, because if the length of the probe is 10 bps or less, it binds non-specifically.
본 발명의 진단 키트에서 프라이머로 사용되는 폴리뉴클레오티드는 그 길이가 18-22개인 것이 바람직하다. 이는 프라이머의 길이가 18bps미만이면 비특이적으로 결합되고, 22bps를 초과하면 프라이머끼리 자체 결합하여 효율성이 떨어지며, 제작시에도 비용과 기술적인 면에서 비효율적이기 때문이다. It is preferable that the length of the polynucleotide used as the primer in the diagnostic kit of the present invention is 18-22. This is because if the length of the primer is less than 18bps, it binds non-specifically, and if the length of the primers exceeds 22bps, the primers bind themselves to each other, resulting in poor efficiency, and it is inefficient in terms of cost and technology even at the time of manufacture.
본 발명의 진단 키트에 포함된, 마커 유전자에 의하여 코딩되는 폴리펩티드에 대한 모노클로날 항체는 일반적인 모노클로날 항체 제조 방법으로 제조된다.A monoclonal antibody against a polypeptide encoded by a marker gene included in the diagnostic kit of the present invention is prepared by a general method for producing a monoclonal antibody.
또한 폐경기 여성의 피부 각질형성세포에서 여성 호르몬 처리에 의해 발현이 증가하는 유전자의 프로모터에 과다 관찰되는 전사인자인 SREBF1(SREBP1), LMO2, TFAP2A, XBP1, MEF2A, LEF1, RUNX2(OSF2), PATZ1(MAZR); 발현이 감소하는 유전자의 프로모터에 과다 관찰되는 전사인자인 IKZF1(LYF1, ZNFN1A1), THRA, PITX2, NKX2-5, SOX5, MYOG, MEIS1, IRF1, GATA3, TBX5, AP1(FOS/JUN), TBP, SP1; 및 발현이 증가하는 유전자와 감소하는 유전자에서 동시에 과다 관찰되는 전사인자인 HNF4A, KLF12(AP2REP), NKX2-1(TTF1), MYOD1, RUNX1(AML1), ZEB1 (AREB6)의 전사조절 활성을 측정하여 피부 노화 억제제를 스크리닝하는 방법은 일반적인 분자생물학 기법에 따라 제조된 리포터 유전자 벡터를 이용할 수 있다. In addition, transcription factors SREBF1 (SREBP1), LMO2, TFAP2A, XBP1, MEF2A, LEF1, RUNX2 (OSF2), PATZ1 ( MAZR); IKZF1 (LYF1, ZNFN1A1), THRA, PITX2, NKX2-5, SOX5, MYOG, MEIS1, IRF1, GATA3, TBX5, AP1 (FOS/JUN), TBP, which are transcription factors that are excessively observed in the promoter of the gene whose expression is decreased. SP1; And by measuring the transcriptional regulation activity of the transcription factors HNF4A, KLF12 (AP2REP), NKX2-1 (TTF1), MYOD1, RUNX1 (AML1), ZEB1 (AREB6), which are over-observed transcription factors simultaneously in the increasing and decreasing genes As a method for screening for skin aging inhibitors, a reporter gene vector prepared according to general molecular biology techniques may be used.
구체적으로는 일반적인 배양 조건에서도 발현되는 유니버설(universal) 프로모터에 SREBF1(SREBP1), LMO2, TFAP2A, XBP1, MEF2A, LEF1, RUNX2(OSF2), PATZ1(MAZR), ZEB1(AREB6), HNF4A, KLF12(AP2REP), NKX2-1(TTF1), MYOD1, RUNX1 (AML1), RUNX1(AML1), IKZF1(LYF1, ZNFN1A1), THRA, PITX2, NKX2-5, SOX5, MYOG, MEIS1, IRF1, GATA3, TBX5, AP1(FOS/JUN), ZEB1(AREB6), TBP 및 SP1 유전자가 결합된 플라스미드(플라스미드 1), 및 상기 전사인자들이 결합하여 전사를 활성화시킬 수 있는 DNA 서열인 TRE(Transcription Response Element)를 가지는 프로모터에 리포터 역할을 하는 반딧불(firefly) 루시퍼라제(luciferase) 유전자가 결합된 플라스미드(플라스미드 2)를 사용한다. 플라스미드 2의 TRE 서열은, MatInspector (Quandt et al., 1995) 및 Transfac(Knuppel et al., 1994)과 같은, 모티프(motif)를 예측, 발견, 분석하는 프로그램에 표 1 및 2의 유전자들의 accession ID를 입력하여 서열을 검색한다. 플라스미드 1의 전사인자 유전자 부분은 표 3의 유전자들의 accession ID를 참고하여 준비한다. COS7 세포에 상기 전사인자 유전자를 지닌 플라스미드 1과 해당 TRE 프로모터-리포터 플라스미드 2를 동시에 트랜스펙션시킨 후 24시간 경과 시점에 피부 노화 억제제 후보 약물을 처리하고 세포를 수확하여 루시퍼라제 활성을 측정하면, 피부 노화 억제제 후보 약물이 상기 전사인자의 활성에 미치는 영향을 확인할 수 있다. 여성 호르몬 처리에 의해 발현이 증가하는 유전자의 프로모터에서 과다 관찰되는 전사인자의 경우에는 세포의 루시퍼라제 활성이 증가했을 때 효과적인 피부 노화 억제제라고 판단할 수 있고, 발현이 감소하는 유전자의 프로모터에서 과다 관찰되는 전사인자의 경우에는 세포의 루시퍼라제 활성이 감소했을 때 효과적인 피부 노화 억제제라고 할 수 있을 것이다. 발현이 증가, 감소하는 유전자의 프로모터에서 모두 과다 관찰되는 전사인자의 경우에는 보조적인 스크리닝 방법으로 활용될 수 있다. Specifically, universal promoters expressed even under general culture conditions include SREBF1 (SREBP1), LMO2, TFAP2A, XBP1, MEF2A, LEF1, RUNX2 (OSF2), PATZ1 (MAZR), ZEB1 (AREB6), HNF4A, KLF12 (AP2REP). ), NKX2-1(TTF1), MYOD1, RUNX1 (AML1), RUNX1(AML1), IKZF1(LYF1, ZNFN1A1), THRA, PITX2, NKX2-5, SOX5, MYOG, MEIS1, IRF1, GATA3, TBX5, AP1( FOS/JUN), ZEB1 (AREB6), a plasmid to which TBP and SP1 genes are bound (plasmid 1), and a reporter on a promoter having a DNA sequence TRE (Transcription Response Element) capable of activating transcription by binding the transcription factors A plasmid (plasmid 2) to which a firefly luciferase gene is conjugated is used. The TRE sequence of
이하, 구체예를 들어 본 발명을 더욱 구체적으로 설명한다. 하기 구체예는 본 발명을 설명하기 위한 것이고 한정하기 위한 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to specific examples. The following specific examples are intended to illustrate the present invention and are not intended to be limiting.
[실시예 1] 인체 세포의 획득 및 여성 호르몬 처리 후 형광 세포 유속기 분석[Example 1] Acquisition of human cells and analysis of fluorescent cell flow rate after female hormone treatment
55세 이상의 연령에 해당하는 한국인 여성의 피부에서 분리한 각질형성세포(NHEKs)를 1 ml 당 0.5 μg 하이드로코티손, 5 ng 표피성장인자, 5 μg 인슐린, 0.5% 우태아 뇌하수체 추출물을 함유한 무혈청 각질세포배양 배지(Clonetics, Walkersville, MD)에서 배양한다. 실험에 사용된 모든 세포는 3차례 계대 배양된 것으로 한다. 여성 호르몬을 처리(이하, 처리군 1)하거나 여성 호르몬 수용체 길항제인 ICI를 여성 호르몬과 동시에 처리(이하, 처리군 2)한 후 각 시간대별로 변화된 유전자를 검색하였다. 구체적으로는, 각질형성세포를 우태아 뇌하수체 추출물을 함유하지 않은 각질세포 배양액에서 4 일간 키운 후 사이클로덱스트린에 포집된 수용성 여성 호르몬 10 nM을 첨가(처리군 1) 또는 여성 호르몬 10 nM과 ICI-182780 100 nM을 동시 처리(처리군 2)하였다. 에탄올을 용매로 사용하지 않고, 사이클로덱스트린에 포집된 여성 호르몬을 사용한 이유는 여성 호르몬 수용체 신호전달 과정에 에탄올이 영향을 미칠 수 있기 때문이다. 음성 대조군으로는 여성 호르몬 또는 ICI-182780 없이 동일한 양의 사이클로덱스트린만을 처리한 각질형성세포를 준비하였다. 각 물질 처리 후 3시간, 6시간, 12시간, 24시간 경과한 시점에서 시료를 얻는다. 24시간 경과 시점의 세포의 모습을 나타낸 도 1에 의하면, 특별한 세포 독성은 관찰되지 않았다. Serum-free containing 0.5 μg hydrocortisone, 5 ng epidermal growth factor, 5 μg insulin, 0.5% fetal fetal pituitary gland extract per ml of keratinocytes (NHEKs) isolated from the skin of Korean women aged 55 years or older. It is cultured in keratinocyte culture medium (Clonetics, Walkersville, MD). All cells used in the experiment were subcultured three times. After treatment with female hormones (hereinafter, treatment group 1) or treatment with ICI, a female hormone receptor antagonist, with female hormones (hereinafter, treatment group 2), genes that were changed for each time period were searched. Specifically, keratinocytes were grown in keratinocyte culture medium containing no fetal pituitary extract for 4 days, and then 10 nM of water-soluble female hormone collected in cyclodextrin was added (treatment group 1) or 10 nM of female hormone and ICI-182780. 100 nM was treated simultaneously (treatment group 2). The reason why ethanol is not used as a solvent and female hormones trapped in cyclodextrin are used is because ethanol can affect the female hormone receptor signaling process. As a negative control, keratinocytes treated with only the same amount of cyclodextrin without female hormones or ICI-182780 were prepared. Samples are obtained at 3 hours, 6 hours, 12 hours, and 24 hours after each material treatment. Referring to Figure 1 showing the appearance of the cells at the time of 24 hours elapsed, no specific cytotoxicity was observed.
그 다음, 유세포 분석법(flow cytometry)을 이용하여 세포 주기 분석을 수행하였다. 이는 FACStarPLUS(Becton Dickinson) 세포 분석기를 이용하여 세포 내 DNA 양을 측정하여 각 세포 주기에 따른 DNA 양의 차이를 이용함으로써, G0/G1, S, G2/M에 해당하는 세포 수를 측정하는 방법이다. 구체적으로는, 둘베코스 포스페이트 완충 식염수(Dulbeco's Phosphate-buffered saline)(pH 7.2)에 DNA에 대한 형광 염료인 요오드화 프로피디움(propidium iodide, PI)(Sgma) 20 g/ml, RNase(Boehringer Mannheim) 2.2 mg/ml, 노니데트(Nonidet) P40(Signa) 0.5 % v/v, EDTA 0.5 mM를 용해시킨 DNA 염색 용액을 15분간 세포에 처리한 후, FACStarPLUS(Becton Dickinson) 세포 분석기를 이용하여 분석하였다. 488 nm 아르곤레이져를 사용하였고, 620 nm에서 요오드화 프로피디움의 적색 형광을 측정하여 세포 내 DNA 양을 측정하였다. 도 2의 형광 유세포분석 결과에 의하면, 여성 호르몬 처리에 의해(처리군 1) 세포 주기상의 G0/G1에 해당하는 세포의 비율이 72.92 %에서 67.77 %로 감소하였고, S기와 G2/M기에 해당하는 세포의 비율이 각각 7.93 %, 16.84 %에서 8.32 %, 20.31 %로 증가하여 세포 분열이 증가하였음을 알 수 있다.
Then, cell cycle analysis was performed using flow cytometry. This is a method of measuring the number of cells corresponding to G0/G1, S, and G2/M by measuring the amount of DNA in cells using a FACStarPLUS (Becton Dickinson) cell analyzer and using the difference in the amount of DNA according to each cell cycle. . Specifically, in Dulbeco's Phosphate-buffered saline (pH 7.2), a fluorescent dye for DNA, propidium iodide (PI) (Sgma) 20 g/ml, RNase (Boehringer Mannheim) 2.2 A DNA staining solution in which mg/ml, Nonidet P40 (Signa) 0.5% v/v, and 0.5 mM EDTA were dissolved was treated on the cells for 15 minutes, and then analyzed using a FACStarPLUS (Becton Dickinson) cell analyzer. A 488 nm argon laser was used, and the amount of DNA in the cells was measured by measuring the red fluorescence of propidium iodide at 620 nm. According to the fluorescence flow cytometry results of FIG. 2, the proportion of cells corresponding to G0/G1 in the cell cycle decreased from 72.92% to 67.77% by female hormone treatment (treatment group 1), and corresponding to S phase and G2/M phase. It can be seen that cell division increased as the percentage of cells increased from 7.93% and 16.84% to 8.32% and 20.31%, respectively.
[실시예 2] 인체 세포로부터 RNA 채취[Example 2] RNA collection from human cells
3차례 계대 배양한 세포로부터 RNA를 정제하기 위해 트리졸(trizol, Invitrogen, Carlsbad, CA, USA)을 첨가해 세포를 분쇄시킨 후 클로로포름을 넣어 상층액의 RNA를 분리하였다. 얻어진 상층액의 RNA를 농축하기 위해 동량의 이소프로파놀을 넣고 원심 분리하여 침전된 RNA를 얻고, 염기 제거를 위해 70% 에탄올로 침전된 RNA를 세척하였다.
Trizol (Invitrogen, Carlsbad, CA, USA) was added to crush the cells, and then chloroform was added to separate RNA from the supernatant. To concentrate RNA in the obtained supernatant, an equal amount of isopropanol was added and centrifuged to obtain precipitated RNA, and the precipitated RNA was washed with 70% ethanol for base removal.
[실시예 3] 마이크로어레이 실험 및 데이터 분석[Example 3] Microarray experiment and data analysis
14,000 개의 인간 전사체가 집적된 올리고마이크로어레이(Gaiagene, seoul, Korea)를 사용하였다. 이 마이크로어레이 상에는 13,376 유전자와 704 개의 대조군 유전자가 집적되어 있다. 상기 채취한 RNA 20 μg으로부터 아미노-알릴 cDNA 라벨링 키트(Camino-allyl cDNA labeling kit)(Ambion, Austin, Texas, USA)를 이용하여 형광 염색된 cDNA 프로브를 제작하였다. 구체적으로는, 처리군 1의 RNA 시료, 처리군 2의 RNA 시료 및 음성 대조군의 RNA 시료로부터 각각 Cy5, Cy3로 표지된 cDNA 프로브를 제작하였다. 3, 6, 12, 24, 48 시간 경과 후에 각 시간대별로 마이크로어레이 실험을 수행하였고, 염료(dye)에 의한 편차를 제거하기 위해 3번씩의 염료 스와핑(dye-swapping)을 수행하였다. Cy5와 Cy3로 염색된 프로브는 16 시간 동안 55℃에서 혼성화를 수행한다.An oligomicroarray in which 14,000 human transcripts were integrated (Gaiagene, seoul, Korea) was used. On this microarray, 13,376 genes and 704 control genes were accumulated. A fluorescently stained cDNA probe was prepared from 20 μg of the collected RNA using an amino-allyl cDNA labeling kit (Ambion, Austin, Texas, USA). Specifically, cDNA probes labeled with Cy5 and Cy3 were prepared from an RNA sample of
마이크로어레이 이미지 분석을 위해 ImaGene 4.2(Biodiscovery, Los Angeles, CA, USA)와 MAAS(Gaiagene, Seoul, Korea)를 사용하였고 SAM을 이용하여 통계적으로 유의미한 변화를 보이는 유전자를 선택하였다. 그 결과 여성 호르몬에 의해 의미 있는 변화를 보이는 유전자를 추출한 것이 상기 표 1 및 표 2의 유전자들이고, 이들 유전자를 유전자 온톨로지(Gene Ontology) 분류 체계에 따라 기능별로 분류한 그림이 도 4이다. 또한 클러스터 프로그램을 이용하여 발현 패턴 별로 분류하였는데, 구체적으로는 여성 호르몬 수용체 길항제인 ICI-182780 처리에 의해 발현 패턴 변화에 영향을 받는지 여부에 따라 여성 호르몬 수용체 의존적, 비의존적 전사반응을 분류하였다. 도 3에는 상기 클러스트링 분석 결과가 도시되어 있다.
For microarray image analysis, ImaGene 4.2 (Biodiscovery, Los Angeles, CA, USA) and MAAS (Gaiagene, Seoul, Korea) were used, and genes showing statistically significant changes were selected using SAM. As a result, the genes shown in Tables 1 and 2 were extracted from genes showing meaningful changes by female hormones, and FIG. 4 is a diagram showing these genes classified by function according to the Gene Ontology classification system. In addition, the cluster program was used to classify each expression pattern. Specifically, female hormone receptor-dependent and non-dependent transcriptional responses were classified according to whether or not they were affected by changes in expression patterns by treatment with ICI-182780, a female hormone receptor antagonist. 3 shows the results of the cluster ring analysis.
[실시예 4] Real-Time PCR 분석을 통한 마이크로어레이 결과의 검증[Example 4] Verification of microarray results through Real-Time PCR analysis
폐경기 여성의 피부에서 분리한 각질형성세포에 사이클로덱스트린에 포집된 수용성 여성 호르몬 10 nM을 첨가하고 3, 6, 12, 24 경과 후 RNA를 분리하였다. RNA 1 ㎍을 50mM 트리스-HCl(Tris-HCl, pH 8.3), 75mM KCl, 3mM MgCl2, 0.1M DTT, 10mM dNTP, 40유닛/μl RNase 저해제가 함유된 역전사 반응 완충액 25μl에 넣고, 0.5μg/μl 올리고(dT)16의 프라이머와 200유닛 수퍼스크립트 II(SuperScript II, GiboBRL)의 역전사 중합효소를 첨가하여 42℃에서 1시간 반응시켰다. 이후 역전사 반응 용액 2.5μl를 엠플리택(AmpliTaq) DNA 중합효소 0.04U(Perkin Elmer, Shelton, CT), 50mM 트리스(pH 8.3), 0.25mg/ml 우혈청알부민, 3mM MgCl2, 0.25mM dNTPs, SYBR 그린 I의 1/50,000 희석액(Molecular Probes, Eugene, OR)이 함유된 PCR 반응 완충액 50리터에 섞고, 하기 표 4의 10μM의 프라이머 센스 및 안티센스를 첨가하여 94℃에서 30초, 53℃에서 30초, 72℃에서 1분인 사이클을 30 사이클 수행하였다.
10 nM of a water-soluble female hormone collected in cyclodextrin was added to keratinocytes isolated from the skin of a postmenopausal woman, and RNA was isolated after 3, 6, 12, and 24 elapses. 1 μg of RNA was added to 25 μl of reverse transcription reaction buffer containing 50 mM Tris-HCl (Tris-HCl, pH 8.3), 75 mM KCl, 3
상대적인 mRNA 레벨은 아이사이클러(ICycler) 소프트웨어를 이용하여 SYBR 그린 I 형광 변화를 측정함으로써 분석하여 도 5 내지 도 9에 나타내었다. 대조군을 기준 1로 정한 후 각 시료의 상대적인 mRNA 레벨을 측정하였다. 도 5 내지 도 9에 의하면 Real-time PCR 결과는 마이크로어레이 결과와 일치함을 알 수 있다.
Relative mRNA levels were analyzed by measuring changes in SYBR Green I fluorescence using ICycler software, and are shown in FIGS. 5 to 9. After the control was set as
[실시예 5] 프로모터 분석 및 전사 인자 검증[Example 5] Promoter Analysis and Transcription Factor Verification
NCBI Accession No. 기준으로 변화된 유전자의 프로모터 서열을 수집하였다. 업스트림 유전자 서열을 Ensembl genome database로부터 확보한 후 전사개시 사이트로부터 2000 bp 업스트림 영역을 포함하는 게놈 서열을 확보하였다. 그리고 MatInspector(Quandt et al., 1995) 및 Transfac(Knuppel et al., 1994)과 같은 motif를 예측, 발견, 분석하는 프로그램을 이용해 전사인자 결합 부위 (transcription factor binding site, TFBS)를 검색하였다. 검색된 전사인자 결합 부위 중 Fisher 통계, Z 통계, 하이퍼지오메트리 통계, Audic 통계 방법으로 프로모터 부위에 과다 출현하는 전사인자 결합 부위를 선별하였다. 이렇게 선별된 전사인자 결합 부위가 상기 표 3에 나열되어 있다. 도 10은 여성 호르몬에 의해 발현 변화를 보이는 유전자 클러스터와 그 유전자 클러스터를 조절한 것으로 예측되어진 전사인자 간의 조절 네트워크의 연결 고리를 추출하여 히트맵으로 시각화한 것이다.
NCBI Accession No. As a reference, the promoter sequence of the changed gene was collected. After obtaining the upstream gene sequence from the Ensembl genome database, a genomic sequence including a 2000 bp upstream region from the transcription initiation site was obtained. And the transcription factor binding site (TFBS) was searched using programs that predict, discover, and analyze motifs such as MatInspector (Quandt et al., 1995) and Transfac (Knuppel et al., 1994). Among the searched transcription factor binding sites, the Fisher statistics, Z statistics, Hypergeometry statistics, and Audic statistics were used to select the transcription factor binding sites that appear excessively in the promoter site. The transcription factor binding sites thus selected are listed in Table 3 above. FIG. 10 is a diagram illustrating a heat map by extracting the linkage of a regulatory network between a gene cluster showing a change in expression by a female hormone and a transcription factor predicted to regulate the gene cluster.
[실시예 6] 여성 호르몬의 작용 과정에서 전사인자들의 중요성 확인[Example 6] Confirmation of the importance of transcription factors in the process of action of female hormones
상기 생물정보학 방법으로 추출된 전사인자들이 실제로 E2의 작용 과정에서 어떠한 중요성을 갖는지 확인하기 위하여, 폐경기 여성의 피부에서 분리한 각질형성세포에 여성 호르몬을 처리했을 때 상기 전사인자들의 발현량을 보여주는 real-time PCR을 수행하고 그 결과를 도 11에 나타내었다. 실시예 4의 방법과 동일한 방법을 사용하였으며, 사용한 프라이머는 하기 표 5에 정리하였다. XBP1의 경우는, 폐경기 여성의 피부에서 분리한 각질형성세포에 여성 호르몬을 처리했을 때 mRNA양은 감소하나, 도 14에서 확인할 수 있는 바와 같이 단백질 양은 증가한다.
In order to confirm what importance the transcription factors extracted by the bioinformatics method actually have in the process of the action of E2, real shows the expression levels of the transcription factors when female hormones are treated in keratinocytes isolated from the skin of menopausal women. -time PCR was performed and the results are shown in FIG. 11. The same method as the method of Example 4 was used, and the primers used are summarized in Table 5 below. In the case of XBP1, when the keratinocytes isolated from the skin of menopausal women are treated with female hormones, the amount of mRNA decreases, but the amount of protein increases, as can be seen in FIG. 14.
또한, 여성 호르몬에 의한 각질형성세포의 분열 반응에서 전사인자들의 역할을 확인하기 위하여, shRNA(small hairpin RNA) 기술을 이용하여 추출된 전사인자의 발현을 저하시킨 상태에서 여성 호르몬을 처리한 후, 세포 분열 지표인 사이클린 D2(CCND2) 및 노화지표 p21(CDKN1A) 단백질 (세포 분열을 억제하는 기능)의 발현 변화를 웨스턴 블로팅 기법으로 확인하였다. In addition, in order to confirm the role of transcription factors in the division reaction of keratinocytes caused by female hormones, the expression of the transcription factors extracted using shRNA (small hairpin RNA) technology was reduced, and then female hormones were treated. Changes in the expression of cyclin D2 (CCND2), an indicator of cell division, and p21 (CDKN1A), an indicator of senescence (the ability to inhibit cell division), were confirmed by Western blotting.
구체적으로는, 우선 폐경기 여성의 피부에서 분리한 각질형성세포에 PITX2, TBX5, XBP1, TFAP2C, ZNFN1A1, MyoG의 shRNA를 생성하는 렌티바이러스 벡터(시그마 알드리치)를 처리하였다. 상기 렌티바이러스 벡터의 서열이 cDNA 서열 형태로 하기 표 6에 기재되어 있다. 또한 생성된 shRNA의 표적 서열이 cDNA 서열 형태(발현을 저하시키고자 하는 유전자 mRNA에 대한 상보적인 cDNA 서열 형태)로 하기 표 6에 기재되어 있다.
Specifically, first, keratinocytes isolated from the skin of menopausal women were treated with a lentiviral vector (Sigma Aldrich) that generates shRNA of PITX2, TBX5, XBP1, TFAP2C, ZNFN1A1, and MyoG. The sequence of the lentiviral vector is shown in Table 6 below in the form of a cDNA sequence. In addition, the target sequence of the generated shRNA is shown in Table 6 below in the form of a cDNA sequence (a form of a cDNA sequence complementary to the mRNA of a gene intended to decrease expression).
(서열번호 58)GAACAGCAAGTGGTAGATTTA
(SEQ ID NO: 58)
(서열번호 60)AGATCGAAAGAAGGCTCGAAT
(SEQ ID NO: 60)
(서열번호 62)GCCGACGATCACAGATACAAA
(SEQ ID NO: 62)
(서열번호 64)GCTGCACAGAATGTCAAGAAT
(SEQ ID NO: 64)
(서열번호 66)CCCAGGCTATTCCTACAACAA
(SEQ ID NO: 66)
(서열번호 68)CCAGTCTCAACAGCCTGAATA
(SEQ ID NO: 68)
(서열번호 70)CCGTTGGTAAACCTCACAAAT
(SEQ ID NO: 70)
(서열번호 72)GCCGAAGCTATAAACAGCGAA
(SEQ ID NO: 72)
(서열번호 74)CCTATGTCTGTGAAGCCGAAT
(SEQ ID NO: 74)
(서열번호 76)GCCCAGCAACTGTGTAAAGAA
(SEQ ID NO: 76)
(서열번호 78)GTGTAAGGTGTGTAAGAGGAA
(SEQ ID NO: 78)
(서열번호 80)GCGCAGTGCCATCCAGTACAT
(SEQ ID NO: 80)
렌티바이러스 벡터 처리 후 24시간 경과 시점에 여성 호르몬을 처리하고 세포를 회수하여 냉각된 인산완충용액(PBS)로 세척하고, 8M 우레아, 2% CHAPS, 50mm DTT, 2M 티오우레아(thiourea), 2mM PMSF, 100mg/ml 류펩타인(leupeptine)이 함유된 단백질 추출 완충용액 500μl을 처리하고 10분간 상온에서 방치하였다. 그 후 4℃에서 10분간 15,000g의 중력가속도로 원심 분리하고, 상층액을 수거한 후 바이오라드 프로테인 염색 시약(BIO-Rad Protein Dye Reagent ™)을 이용하여 단백질을 정량하였다.After 24 hours of treatment with the lentiviral vector, female hormones were treated, cells were recovered, washed with cooled phosphate buffer (PBS), 8M urea, 2% CHAPS, 50mm DTT, 2M thiourea, 2mM PMSF , 500 μl of a protein extraction buffer containing 100 mg/ml leupeptine was treated and left at room temperature for 10 minutes. Then, centrifugation was performed at 4° C. for 10 minutes at a gravitational acceleration of 15,000 g, and the supernatant was collected, and the protein was quantified using a Bio-Rad Protein Dye Reagent™.
20μg의 단백질을 8% SDS-PAGE를 이용하여 크기별로 분리하고, 50V로 12 시간 동안 PDF(바이오라드)막에 블랏팅(blotting)하였다. 이 블랏을 5% 무지방 우유 용액으로 1시간 동안 블로킹한 후 일차 항체로는 안티-Pitx2(Santa Cruz), 안티-XBP-1(Abcam), 안티-TFAP2C(Santa Cruz), 안티-TBX5(Santa Cruz), 안티-XBP-1(Santa Cruz), 안티-Myogenin(Pharmingen), 안티-ZNFN1A1(Abcam), 안티-p21(Cell Signaling Technology) 또는 안티-cyclin D1 항체(Santa Cruz)를 사용하였고, 홀스래디쉬 퍼록시다제(horse radish peroxidase)가 결합된 이차 항체(아메르샴, amersham)와 아메르샴 사의 향상된 화학발광(enhanced chemiluminescence, "ECL") 키트를 이용하여 웨스트 블랏을 수행하였다. 반응시킨 블랏은 X선 후지 필름에 감광시킨 후 현상하여 단백질 발현 정도를 확인, 분석하였고, 그 결과를 도 12 내지 도 17 및 도 18에 나타내었다. 20 μg of protein was separated by size using 8% SDS-PAGE, and blotting was performed on a PDF (biorad) membrane at 50V for 12 hours. After blocking this blot with 5% fat-free milk solution for 1 hour, the primary antibodies were anti-Pitx2 (Santa Cruz), anti-XBP-1 (Abcam), anti-TFAP2C (Santa Cruz), and anti-TBX5 (Santa Cruz), anti-XBP-1 (Santa Cruz), anti-Myogenin (Pharmingen), anti-ZNFN1A1 (Abcam), anti-p21 (Cell Signaling Technology) or anti-cyclin D1 antibody (Santa Cruz) was used, and Hols West blot was performed using a horse radish peroxidase-conjugated secondary antibody (amersham) and an enhanced chemiluminescence (“ECL”) kit from Amersham. The reacted blot was photosensitive on an X-ray Fuji film and then developed to check and analyze the protein expression level, and the results are shown in FIGS. 12 to 17 and 18.
도 12 내지 도 17에 의하면, 상기 표 6의 shRNA를 이용하여 해당 전사인자의 발현을 저하시켰을 때, 여성 호르몬에 의한 사이클린 D2의 발현 증가가 억제(XBP1, AP2C. MyoG1, PITX2, ZNFN1A1) 되거나 더 증폭(TBX5) 됨을 확인할 수 있었다. 12 to 17, when the expression of the corresponding transcription factor is decreased using the shRNA of Table 6, the increase in the expression of cyclin D2 by female hormones is suppressed (XBP1, AP2C. MyoG1, PITX2, ZNFN1A1) or more It was confirmed that it was amplified (TBX5).
도 18에 의하면, 상기 표 6의 shRNA를 이용하여 해당 전사인자의 발현을 저하시킨 후, 세포 분열을 억제하는 기능을 가진 노화지표 p21 단백질의 여성 호르몬에 의한 발현 감소 현상이 사라짐을 확인하였다. 또한, 전사인자의 발현을 저하시킬 경우, 여성 호르몬 처리 이전의 p21 단백질 양 자체도 증가됨을 확인할 수 있었다. Referring to FIG. 18, after reducing the expression of the corresponding transcription factor using the shRNA of Table 6, it was confirmed that the decrease in the expression of the aging indicator p21 protein, which has a function of inhibiting cell division, by female hormones disappears. In addition, it was confirmed that when the expression of the transcription factor was decreased, the amount of p21 protein itself before female hormone treatment was also increased.
즉, shRNA 기술을 이용하여 추출된 전사인자의 발현을 억제시킬 경우, 여성 호르몬에 의한 유전자 발현에 교란이 일어나는 것을 확인할 수 있다. 이를 real-time PCR로 확인한 결과가 도 19 내지 21에 나타나있다.That is, when the expression of the extracted transcription factor is suppressed using the shRNA technology, it can be confirmed that disturbance occurs in gene expression by female hormones. The results confirmed by real-time PCR are shown in Figs. 19 to 21.
서열목록 전자파일 첨부Attach electronic file of sequence list
Claims (4)
세포에 시험 화합물을 처리하는 단계; 및
시험 화합물 처리 후 세포 내 TBX5 유전자의 발현이 억제되는지 확인하는 단계를 포함하는, 여성 호르몬 결핍에 의한 여성 피부 노화 억제제 스크리닝 방법.As a method of screening female skin aging inhibitor due to female hormone deficiency,
Treating the cell with a test compound; And
A method for screening female skin aging inhibitors due to female hormone deficiency comprising the step of confirming whether expression of TBX5 gene in cells is inhibited after treatment with test compound.
상기 방법은 시험 화합물 처리 후 세포 내 R3HCC1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, NUDC, NCOA4, PSMD11, SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM8A1, NET1, CCND2, BNIP1, ARMC6, ALDOC, CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP4R2, PKM2, GIPC1, RRM1, RPL26, WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1,TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19 및 PIGC 유전자로 구성되는 군에서 선택되는 하나 이상의 유전자의 발현이 촉진되는지 확인하는 단계를 더 포함하는, 여성 호르몬 결핍에 의한 여성 피부 노화 억제제 스크리닝 방법.The method of claim 1,
The method is followed by intracellular R3HCC1, RSPO1, IMP3, FDFT1, SFPQ, PCNA, SFRS2, DERL3, PRPF8, STIP1, MVK, LOC389833, DGCR6L, SFN, ARPC4, RARS, C3orf1, PELO, NUDC, NCOA4, PSMD11 , SFRS1, CTNNB1, CCT5, CYR61, HNRPM, LDHA, PRDX1, RUTBC1, TFRC, TUBB3, IRX2, ZHX1, LOC91316, PAFAH1B1, TARDBP, ZNF302, CXorf26, KIF15, ITGB1BP1, FAM8A2, ARM , CAP1, CD47, CLIC5, RASSF7, C9orf88, CSE1L, LEMD2, CLASP1, DEPDC6, FDPS, C1orf122, MYEOV2, EML3, LY6D, MAEA, MITF, MIDN, PITX1, HTRA1, PPP1R13L, PPP42 R2, PPPM2R2 RPC At least one gene selected from the group consisting of: WDR74, S100A2, SCAMP3, TBC1D4, TUBB, PSMD1, TPI1, DSP, HNRPA3, PES1, POLR2F, RNMT, PITPNA, VHL, DHX9, LMNB2, PPT1, C20orf19 and PIGC genes A method for screening female skin aging inhibitors by female hormone deficiency further comprising the step of confirming that expression is promoted.
상기 방법은 시험 화합물 처리 후 세포 내 DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, MLL, NPC1, ADAM8, BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFP36, ARPP-19, HIF1A, FXR2, CDCP1, CCNB1IP1, GOLGA4, ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYGB, PTP4A1, PTPN12, RTN3, SEC24D, SLC3A2, YARS, ACTB, CHD2, NOTCH1 및 ANKIB1 유전자로 이루어진 군에서 선택되는 하나 이상의 유전자의 발현이 억제되는지 확인하는 단계를 더 포함하는 여성 호르몬 결핍에 의한 여성 피부 노화 억제제의 스크리닝 방법.The method of claim 1,
The method is followed by intracellular DKK1, ELL2, FOSL1, HNRPDL, PLAU, FAM89B, THBS1, ARHGEF2, PRKD2, TRIB3, CES2, F3, CDKN1A, EIF4A2, EIF5, HS3ST1, CALCOCO1, KLF5, KLF6, KLF6, KLF6 , ADAM8, BCL2L1, COPA, FLJ25222, DYNC1H1, FAM102B, MAP2K3, ARL16, ITGB4, MLLT4, NDUFV3, NFE2L2, FSTL3, PRSS8, PTK6, SLC2A1, SLC38A2, FLJ22795, ZFPR2, ARFCA , GOLGA4, ICF45, MPST, DNAJB11, EPRS, MKNK2, MAP1LC3B, NCOA3, ORC4L, PIGH, PSAT1, PABPC1, EIF1, RUVBL1, SARS, ZNF337, GPR56, C17orf40, OPN3, DAP3, PYDN, PTP4 And SLC3A2, YARS, ACTB, CHD2, NOTCH1 and ANKIB1 screening method for screening female skin aging inhibitors by female hormone deficiency further comprising the step of checking whether the expression of one or more genes selected from the group consisting of.
상기 방법은 시험 화합물 처리 후 세포 내 SREBF1(SREBP1), LMO2, TFAP2A, XBP1, MEF2A, LEF1, RUNX2(OSF2), PATZ1(MAZR), ZNFN1A1, THRA, NKX2-5, SOX5, MYOG, MEIS1, IRF1, GATA3, AP1(FOS/JUN), TBP, SP1, HNF4A, KLF12(AP2REP), NKX2-1(TTF1), MYOD1, RUNX1(AML1), ZEB1 (AREB6) 및 TFAP2C 유전자로 이루어진 군으로부터 선택된 유전자의 발현을 촉진하는지 여부를 확인하는 단계를 더 포함하는 여성 호르몬 결핍에 의한 여성 피부 노화 억제제 스크리닝 방법.The method of claim 1,
The method is characterized by intracellular SREBF1 (SREBP1), LMO2, TFAP2A, XBP1, MEF2A, LEF1, RUNX2 (OSF2), PATZ1 (MAZR), ZNFN1A1, THRA, NKX2-5, SOX5, MYOG, MEIS1, IRF1 after test compound treatment. Expression of genes selected from the group consisting of GATA3, AP1 (FOS / JUN), TBP, SP1, HNF4A, KLF12 (AP2REP), NKX2-1 (TTF1), MYOD1, RUNX1 (AML1), ZEB1 (AREB6) and TFAP2C genes A method for screening female skin aging inhibitors by female hormone deficiency further comprising the step of determining whether to promote.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020130057717A KR101360680B1 (en) | 2013-05-22 | 2013-05-22 | Method for screening inhibitor against hormonal skin aging |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020130057717A KR101360680B1 (en) | 2013-05-22 | 2013-05-22 | Method for screening inhibitor against hormonal skin aging |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020100027351A Division KR101317024B1 (en) | 2010-03-26 | 2010-03-26 | Method for screening inhibitor against hormonal skin aging |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20130062312A KR20130062312A (en) | 2013-06-12 |
KR101360680B1 true KR101360680B1 (en) | 2014-02-10 |
Family
ID=48860079
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020130057717A KR101360680B1 (en) | 2013-05-22 | 2013-05-22 | Method for screening inhibitor against hormonal skin aging |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101360680B1 (en) |
-
2013
- 2013-05-22 KR KR1020130057717A patent/KR101360680B1/en active IP Right Grant
Non-Patent Citations (1)
Title |
---|
Experimental Dermatology, Vol. 15, No. 2, pp83-94 (2006.02.) * |
Also Published As
Publication number | Publication date |
---|---|
KR20130062312A (en) | 2013-06-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR100999261B1 (en) | Method for screening inhibitor against hormonal skin aging | |
Song et al. | lncITPF promotes pulmonary fibrosis by targeting hnRNP-L depending on its host gene ITGBL1 | |
US20190062843A1 (en) | Micro-rna biomarkers and methods of using same | |
KR101618950B1 (en) | Composition for screening skin irritant and method for screening skin irritant using the same | |
Chen et al. | miR‑628 reduces prostate cancer proliferation and invasion via the FGFR2 signaling pathway | |
KR101360680B1 (en) | Method for screening inhibitor against hormonal skin aging | |
KR101360746B1 (en) | Method for screening inhibitor against hormonal skin aging | |
KR101360602B1 (en) | Method for screening inhibitor against hormonal skin aging | |
KR101283270B1 (en) | Method for screening inhibitor against hormonal skin aging | |
KR101360681B1 (en) | Method for screening inhibitor against hormonal skin aging | |
KR101360620B1 (en) | Method for screening inhibitor against hormonal skin aging | |
KR101317024B1 (en) | Method for screening inhibitor against hormonal skin aging | |
JP2007315752A (en) | Judging method of hepatic fibrillation stage | |
JP6541049B2 (en) | Biomarkers for amyotrophic lateral sclerosis | |
EP2995956B1 (en) | Use of a diagnostic marker composition comprising apolipoprotein m for diagnosing alzheimer's disease | |
JP2014128249A (en) | USE OF miRNA OR TARGET GENE THEREOF IN INSPECTION AND THERAPY OF NEURODEGENERATIVE DISEASE | |
KR101543172B1 (en) | Biomarker for prediction of sensitive skin and test kit using the same | |
KR101543186B1 (en) | Biomarker for prediction of sensitive skin and test kit using the same | |
EP3728639B1 (en) | Method of selection of an ire1-inhibitor therapy for patient suffering from cancer | |
KR20180099123A (en) | Biomarker for predicting resistance to anticancer agent | |
JP2011045334A (en) | Factor associated with cellular aging | |
US20190264292A1 (en) | Use of h2a.z.1 as a hepatocellular carcinoma biomarker | |
Koptan et al. | Evaluation of serum microRNA-30e-5p expression in systemic lupus erythematosus and its association with clinical manifestations: A cross-sectional study | |
KR101543173B1 (en) | Biomarker for prediction of sensitive skin and test kit using the same | |
KR20140130381A (en) | Biomarker for prediction of sensitive skin and test kit using the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A107 | Divisional application of patent | ||
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20161228 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20190102 Year of fee payment: 6 |
|
FPAY | Annual fee payment |
Payment date: 20200102 Year of fee payment: 7 |