KR101340159B1 - Probes for detecting new influenza viruses, and a method for detecting new influenza viruses using the same - Google Patents

Abstract

The present invention relates to a probe for detecting influenza virus and a method for detecting the presence of the influenza virus using the same. More specifically, a left probe oligonucleotide (LPO) including a forward primer binding region and a left hybridization sequence (LHS) region that specifically hybridizes to a first region of a target sequence; And a right probe oligonucleotide (RPO) including a right hybridization sequence (RHS) and a reverse primer binding region that specifically hybridize to a second region that is independent of the LPO and continuously connected to the first region of the target sequence. And, the left hybridization sequence (LHS) and the right hybridization sequence (RHS) is the first probe of SEQ ID NO: 1 and SEQ ID NO: 2, the second probe of SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 A probe for detecting influenza virus, and a novel novel using the third probe, a fourth probe having SEQ ID NO: 7 and SEQ ID NO: 8, and a fifth probe having SEQ ID NO: 9 and SEQ ID NO: 10 A method for detecting influenza virus.

Description

Probes for detecting new influenza viruses, and a method for detecting new influenza viruses using the same}

The present invention relates to a probe for detecting influenza virus, a probe set and a method for detecting the presence of the influenza virus using the same.

Influenza viruses are the major causative agents of viral respiratory disease and are classified into A, B and C types by the antigenic differences between NP (nuleocapsid) and M (matrix) proteins. Among them, type A is classified according to the antigenic characteristics of proteins, that is, two types of proteins, hemagglutinin and neuraminidase, and H serotype and N serotype. Types are classified into subtypes of type N1 to N9 according to the characteristics of NA protein antigens, from type H1 to H15 (Wiley DC and Skehel TT, Ann Rev Biochem, 56: 365-394, 1987).

In humans, influenza A and B viruses are known to cause diseases including lower respiratory tract infections. In particular, type A infections are known to cause about 10,000 deaths each year during epidemics (Fleming DM et. al., Br. Med. J. 311: 290-291, 1995). In particular, the H1N1 influenza, which was named in 2009, has been reported since 2009, and since 2011, there has been a growing interest in rapid and rapid diagnosis due to high infection rate and mortality.

According to the World Health Organization, influenza type A (matrix, M) and new influenza-specific genes (hemagglutinin, HA) are detected and seasonal influenza genes (H1, H3) are not detected to confirm the influenza infection. It is based on PCR. However, the actual influenza detection is to detect influenza type A (matrix, M), two specific influenza-specific genes of H1 and NP, and seasonal influenza genes (H1, H3). ) Influenza type A (matrix, M gene), ii) Swine influenza specific gene (hemagglutinin, HA) H1, iii) Swine influenza specific gene NP, iv) Seasonal influenza gene H1, v) Seasonal influenza gene H3 gene Detection is performed for the gene region.

However, in case of such multiple detection, the conventional real time PCR-based test method is not easy to carry out multiple tests, so it is necessary to perform individual tests on five genes. It is recommended to test by dividing into two stages, 'confirmation phase'.

Multiplex ligation dependant probe amplification (MLPA) is a method of detecting only a specific nucleotide sequence of DNA and has been used in experiments such as gene expression, CNV detection and analysis. In addition, the MLPA experiment has been proposed as a new pathogen detection method because it has the advantage that multiple detection is possible in one experiment.

The process of detecting swine flu virus by the MLPA method is schematically shown in FIG. 1.

As shown in FIG. 1, the MLPA method denatures a sample, hybridizes two probes to a target gene, ligation of the two probes, PCR amplifies the ligation probes, and amplification products. Detecting.

In MLPA, two probes containing a sequence and a primer sequence that hybridize to the target sample are used. Each of the two probes hybridizes with the target gene, and the hybridization between the two probes is ligation to form a probe assembly. Then, the amplification reaction is performed by primers included in each of the two probes. The amplification reaction made into a template becomes possible. Therefore, the amount of amplification and the amount of detection thereof vary depending on the degree of hybridization of the probe to the target gene and the degree of ligation to form the probe assembly, thereby detecting a specific gene.

However, since conventional MLPA detects whether a specific gene is amplified by the difference in the length of the probe using a capillary electrophoresis (CE) after the PCR amplification reaction, the length of each probe may have a difference in the probe design process for detection. There was a stuffer-sequence designed to be able. A stuffer-sequence is simply a sequence designed to have a difference in length, and is combined with a hybridization sequence of another probe, a stuffer sequence of another probe, or another nucleotide sequence of DNA. The base sequence does not do.

However, such a stuffer sequence has a disadvantage that the design itself is very difficult because there should be no interaction with other base sequences as described above. In addition, even if the base sequence for the stuffer (designer) is designed, the difference in length between the probes increases due to the stuffer sequence having a length of about 400nt, which leads to a change in the amplification efficiency of the whole product. There was a problem that accurate quantitative detection was difficult.

An object of the present invention is to provide a stuffer-free swine influenza virus detection probe and probe set having no stuffer sequence for detecting swine influenza virus by MLPA method in order to solve the above problems of the prior art. do.

The present invention also amplifies the probe assembly to the template by the MLPA method using the new influenza virus detection probe, probe set, and detects the amplification product by applying Capillary Electrophoresis-Single Strand Conformation Polymorphism (CE-SSCP) It is an object of the present invention to provide a method for detecting the presence of a new influenza virus.

In order to achieve the object of the present invention as described above, the present invention includes a left probe oligonucleotide (LPO) including a forward primer binding region, and a left hybridization sequence (LHS) region that specifically hybridizes to a first region of a target sequence; And a right probe oligonucleotide (RPO) comprising a right hybridization sequence (RHS) and a reverse primer binding region that hybridize specifically to a second region that is independent of the LPO and continuously connected to the first region of the target sequence. Wherein the left hybridization sequence (LHS) and the right hybridization sequence (RHS) are the first probe of SEQ ID NO: 1 and SEQ ID NO: 2, the second probe of SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 Provided is a probe for detecting influenza virus, which is any one selected from the group consisting of a third probe, a fourth probe having SEQ ID NO: 7 and SEQ ID NO: 8, and a fifth probe having SEQ ID NO: 9 and SEQ ID NO: 10.

In the present invention, the first probe of SEQ ID NO: 1 and SEQ ID NO: 2 hybridizes specifically to SEQ ID NO: 11 of the influenza type A gene M (matrix), the second probe of SEQ ID NO: 3 and SEQ ID NO: 4 Is specifically hybridized to SEQ ID NO: 12 of the seasonal influenza gene H1, and the third probe of SEQ ID NO: 5 and SEQ ID NO: 6 hybridizes specifically to SEQ ID NO: 13 of the seasonal influenza gene H3, and SEQ ID NO: 7 And the fourth probe of SEQ ID NO: 8 hybridizes specifically to SEQ ID NO: 14 of the H1N1 influenza A specific gene H1, and the fifth probe of SEQ ID NO: 9 and SEQ ID NO: 10 is SEQ ID NO: 15 of the H1N1 influenza A specific gene NP. It is characterized in that it specifically hybridizes to.

The present invention also provides a probe set for detecting a new influenza virus comprising two to five of the first to fifth probes.

The present invention also provides a kit for detecting influenza virus, comprising a probe for detecting influenza virus or a set of probes for detecting influenza virus according to the present invention.

The present invention also provides a method comprising: a first step of hybridizing a sample by contacting the sample with the probe for detecting influenza virus of claim 1; Ligation of the probe hybridized with the sample to form a probe assembly; A third step of PCR amplifying the formed probe assembly as a template; Separating and detecting the amplified product; And a fifth step of determining that there is an influenza virus to which the constituents of the amplified probe assembly are complementarily bound in the sample when the amplification product is separated and detected. Provide a method.

In the method for detecting the presence of the new influenza virus of the present invention, in the first step of hybridizing the sample by contacting the new influenza virus detection probe of claim 1, the LHS of the target sequence first region of the sample and the LPO probe Hybridization, and the RHS of the RPO probe and the target sequence second region of the sample are hybridized.

The method for detecting the presence of the new influenza virus of the present invention, in the second step of ligation of the sample and the probe to form a probe assembly, the LHS end of the LPO hybridized with the first region of the sample and the second of the sample Lg ends of the RHS of the RPO hybridized with the region are characterized by forming a probe assembly consisting of a forward primer binding region-LHS-RHS-reverse primer binding region. The method for detecting the presence of the new influenza virus of the present invention, in a third step of PCR amplification using the formed probe assembly as a template, a forward primer binding region included in the left probe oligonucleotide (LPO) constituting the probe assembly, and The formed probe assembly is PCR amplified using a primer pair complementarily binding to a reverse primer binding region included in a right probe oligonucleotide (RPO).

The method for detecting the presence of the new influenza virus of the present invention, in the fourth step of separating and detecting the amplified probe assembly, the degree of PCR amplification using the probe assembly as a template is CE-SSCP (Capillary Electrophoresis-Single strand conformation polymorphism). It is characterized in that the separation detection using.

The method for detecting the presence of a new influenza virus of the present invention is further characterized by detecting the presence of a plurality of new influenza viruses at once using a probe set comprising two or five kinds of the above-mentioned influenza virus detection probes. do.

A novel strain according to the present invention which uses the novel influenza virus detection probe of the present invention, amplifies the probe assembly by the MLPA method, and isolates and detects the amplified product using CE-SSCP (Capillary Electrophoresis-Single Strand Conformation Polymorphism). The method of detecting the presence of influenza virus is not only accurate, since each probe has only one peak for the gene to be detected, and at least five genes that need to be detected if the influenza virus is to be detected. At the same time, detection and identification are possible quickly, accurately and effectively.

1 is a flow chart schematically illustrating an MLPA method.
Fig. 2 is a diagram showing the structure of a novel influenza virus detection probe having no stuffer sequence according to the present invention.
3 is a flowchart illustrating a process of designing a new influenza virus detection probe having no stuffer sequence according to the present invention.
FIG. 4 is a diagram showing the results of MLPA using individual influenza virus detection probes according to an embodiment of the present invention and analysis using CE-SSCP (Capillary Electrophoresis-Single Strand Conformation Polymorphism).
FIG. 5 is a diagram showing the results of MLPA using a new influenza virus detection probe set according to an embodiment of the present invention, and analysis using CE-SSCP (Capillary Electrophoresis-Single Strand Conformation Polymorphism).

Hereinafter, the present invention will be described in detail.

The present invention provides a probe that complementarily binds to and amplifies a new influenza virus sequence used to determine the presence of a new influenza virus by mutiplex ligation dependant probe amplification (MLPA).

In the present invention, the term "probe" refers to a nucleic acid fragment corresponding to a few to several hundred bases, which can achieve specific binding with DNA or RNA, and then the presence or absence of a specific DNA or RNA by amplification, separation, and detection. You can check. In the present invention, the "probe" is preferably an oligonucleotide.

2 shows the structure of a new influenza virus detection probe having no stuffer sequence according to the present invention. As shown in FIG. 2, the novel influenza virus detection probe of the present invention is composed of a pair of LPO and RPO, and the left probe oligonucleotide (LPO) specifically hybridizes to a first region of a target sequence. ) And a forward primer binding region linked upstream thereof, wherein the right probe oligonucleotide (RPO) hybridizes specifically to a second region that is continuously connected to the first hybridization region in a target sequence of a sample. RHS (Right Hybridization Sequence) and the reverse primer binding region connected to the downstream (downstream).

In the subsequent step, the LPO and the RPO are ligation to form a probe assembly, and in order to bind the PCR polymerase for PCR amplification of the formed probe assembly into the template, the reverse primer forward binding region and the upstream of the LHS and downstream of the RHS Primer binding regions are included. The forward primer binding region and the reverse primer binding region are designed not to bind to the specific sequence of the influenza virus, which is a target sequence, but are not particularly limited, and primers generally used for PCR amplification may be used.

In the present invention, the first region of the target sequence specifically hybridizes to the left hybridization sequence (LHS) and the second region of the target sequence specifically hybridizes to the right hybridization sequence (RHS) are continuously connected to each other. do.

The left hybridization sequence (LHS) of the LPO and the right hybridization sequence (RHS) of the RPO specifically hybridize to the first hybridization region and the second hybridization region of the target sequence, respectively, wherein the left probe oligonucleotide (LPO) and the RPO When the right probe oligonucleotide hybridizes at the correct position of the sample, the probe assembly is composed of the forward primer binding region-LHS-RHS-reverse primer binding region by connecting the ends of the LPO and the ends of the RPO by a linking enzyme. assembly) is formed.

After the probe assembly is formed as described above, primers are bound to the forward primer binding region and the reverse primer binding region, which are respectively included in the left probe oligonucleotide (LPO) probe and the right probe oligonucleotide (RPO) probe. It is amplified as a template. In contrast, in the case of a probe in which a probe assembly is not formed, the amplification of the probe assembly is impossible at all, and as a result, the degree of amplification varies according to the degree of hybridization, and as a result, the detection of a gene specifically hybridizing the probe is possible. do. In this case, to amplify the probe assembly into a template, it is possible to apply methods known in the art such as PCR, MPCR, Real time RT-PCR.

The new influenza virus detection probe of the present invention comprises a first probe, SEQ ID NO: 3 and SEQ ID NO: 4, wherein the left hybridization sequence (LHS) and the right hybridization sequence (RHS) are represented by SEQ ID NO: 1 and SEQ ID NO: 2, respectively. 2 probes, a third probe of SEQ ID NO: 5 and SEQ ID NO: 6, a fourth probe of SEQ ID NO: 7 and SEQ ID NO: 8, or a fifth probe of SEQ ID NO: 9 and SEQ ID NO: 10.

In the present invention, the first probe of SEQ ID NO: 1 and SEQ ID NO: 2 specifically hybridizes to SEQ ID NO: 11 of the influenza type A gene M (matrix), the second probe of SEQ ID NO: 3 and SEQ ID NO: 4 The set hybridizes specifically to SEQ ID NO: 12 of seasonal influenza gene H1, and the third probe set of SEQ ID NO: 5 and SEQ ID NO: 6 hybridizes specifically to SEQ ID NO: 13 of seasonal influenza gene H3, and the sequence The fourth set of probes of No. 7 and SEQ ID NO: 8 hybridizes specifically to SEQ ID NO: 14 of the new influenza specific gene H1, and the fifth set of probes of SEQ ID NO: 9 and SEQ ID NO: 10 is the sequence of the new influenza specific gene NP Hybridize specifically to number 15.

In the present invention, the first influenza virus detection probe first comprises strains of the swine flu virus type A gene M (matrix), seasonal influenza gene H1, seasonal influenza gene H3, swine influenza specific gene H1, swine flu specific gene NP A gene is secured and the gene sequence of the part which is common in each variant is determined. Afterwards, the sequence determined by the binding sequence of the probe assembly of the new influenza gene sequence was divided into LHS and RHS probes and designed. At this time, in the present invention, the following conditions were examined in the order shown in FIG. 3 in order to design a novel influenza virus detection probes LHS, RHS and a probe assembly in which they are ligation without a stuffer sequence.

First, the length of the sequence was considered. The length of the probe and probe assembly can be as long as needed, but too long is not likely to increase specificity but rather increases false mis hybridization and thus lowers specificity.

Next, the binding capacity was considered. The binding capacity between the probe and the target sequence is one of the most basic elements in probe design. Specific binding of DNA and DNA is due to the specific binding of A, G, C, and T of nucleotides, and inevitably, the binding ability of A- and T-rich probes is weaker than that of G- and C-rich probes. Specific binding ability is important because DNA may bind (false positive) even if mismatch occurs due to specificity deterioration depending on conditions.

The binding capacity of the oligonucleotide can generally be represented by Tm. Tm refers to the temperature at which the hybridization dissociates by heating to the hybridization of oligonucleotide and DNA to hybridize to 50% oligonucleotide and the remaining 50% of DNA is dissociated. Therefore, the binding capacity is set by adjusting the Tm.

G값을 설정한다. Third, consider the secondary structure. Oligonucleotides are more likely to hybridize between probes, so

Set the G value.

Finally, specificity was examined. Homology is searched for specificity of probe sequences. However, since homology aims to examine the similarity of gene sequences, there is a difference in binding ability between homology and oligonucleotides. For this reason, the alignment score is also set in addition to the Tm value.

The present invention also includes a probe set for detecting influenza virus using two to five of the first to fifth probes simultaneously. In the present invention, even when all of the first to fifth probes are used, it is possible to detect a new influenza virus at the same time.

In order to confirm the influenza virus infection, a total of five genes are tested: influenza type A, swine flu-specific NP, swine flu-specific H1, seasonal influenza H1, and seasonal influenza H3. A positive detection of influenza type A and swine influenza specific NP or HA, and a negative detection of seasonal influenza H1 and H3 are used as a criterion for confirming the diagnosis of swine influenza infection. When seasonal influenza is not prevalent, positive detection of influenza type A and swine flu specific NP or HA is used to confirm the diagnosis of swine flu infection.

In the present invention, five probes that specifically bind to the five viruses can be used to simultaneously detect whether a virus is required for the determination of swine flu infection.

The present invention uses the new influenza virus detection probe according to the present invention, hybridized and amplified by MLPA (Mutiplex ligation dependant probe amplification), and then amplified the new influenza virus gene by CE-SSCP (Capillary Electrophoresis-Single strand It provides a method for detecting new influenza virus that is isolated and detected using conformation polymorphism.

In the present invention, Capillary Electrophoresis-Single strand conformation polymorphism is used instead of the method of separating and detecting amplification products amplified by template assembly by MLPA (Mutiplex ligation dependant probe amplification) using Capillary Electrophoresis. As a result of the isolation and detection using the method, the stuffer gene is not included, and even if the probes have the same length, it is possible to detect a new influenza virus gene.

Single-chain morphology polymorphism (SSCP) is the principle that changes in DNA nucleotide sequences cause structural folding of single-stranded DNA, and the difference in the distance traveled during electrophoresis, that is, the bases (A, T, The difference between C and G being attracted to electricity is used. In the method, when heat-denatured ds-DNA at high temperature, it degenerates into ss-DNA, and when it is quenched, it does not return to the initial state of ds-DNA. To form a structure. Electrophoresis of gene fragments with these various three-dimensional structures results in different movement speeds due to changes in gene structure. Therefore, even if ds-DNA sequences of the same length have different gene bases, different gene fragments with new conformation by SSCP method show different movement speeds as they pass through the capillary filled with the polymer mixture gel. Can be determined.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1> of virus to be detected gene  decision

Literature research has selected species-specific genes or sequences used for the detection of genes of the H1N1 influenza virus.

M matrix of influenza virus type A, hemagglutinin (HA), a specific gene of the new influenza virus, HA (H1 seasonal) of seasonal influenza virus, HA (H3 seasonal) of seasonal influenza virus, and new influenza virus NP was determined by five specific genes.

The base sequence of 500bp including the nucleic acid base sequence provided for the detection of the new influenza virus in the disease control center (CDC) and Eramus Influenza Resistance Information Study (IRS) among the sequences of each new influenza virus was set. Thereafter, specific base sequences were determined after comparison with a database of new influenza DNA sequences using NCBI blast (Basic Local Alignment Search Tool).

The sources for the strains considered to determine the base sequence of each virus are as follows.

For each virus, nucleotide sequences of domestic and foreign known genes were comprehensively analyzed, and the sequence portion commonly included in all variants of viruses in each species was determined as the portion that the probe specifically hybridized. The results are shown in Table 2 below.

Virus types Specific sequence M1 gene
(SEQ ID NO: 11) GATTTTAGGA TTTGTGTTCACGCTCACCGTGCC CAGTGAGCGAGGACTGCAGCGTAGACGCTTT HA (H1 seasonal)
(SEQ ID NO: 12) TTAAAAGGAATAGCCCCACTACAATTGGGTAAT TGCAGCGTTGCCGGATGGA TCTT AGGAAACCCAGAA HA (H3 seasonal)
(SEQ ID NO: 13) TGACCACAATGTATACAGAGATGAAGCATTAAACAA CCGGTTCCAGATCAAA GGCGTTGAGC TGAAGTCAGGATA HA 2009 H1
(SEQ ID NO: 14) TCCACGAT TGCAATACAACTTGTCAGACACCCAAGGG TGCTATAAACACCAGCCTCCCATTTCAGAAT HA 2009 N1
(SEQ ID NO: 15) TCACATGTGTGTGCAGGGATAACTGGCATGGCTCGA ATCGACCGTGGGTGTC TTTCAACCA GAATCTGGAAT

< Example  2> for virus detection Probe  design

A probe for detecting influenza virus was designed based on five genes for detecting the influenza and nucleotide sequences thereof.

After confirming the uniqueness of the selected gene or sequence by FASTA or BLAST (Basic local alignment search tool), the LHS and RHS sequences are designed so that a ligation site can be included in the identified gene or sequence. It was. The designed sequence length of LHS and RHS is 21nt ~ 50nt, respectively, and the designed Tm of LHS and RHS having sequence length of 21nt ~ 50nt is 70 ~ 80 ℃, and the GC content is 35 ~ 65%, respectively. Then, the uniqueness of the designed LHS and RHS sequences was confirmed by FASTA or BLAST (Basic local alignment search tool).

G값이 0 이상이 되도록 하여 신종 인플루엔자 바이러스 검출용 프로브를 완성하였다. The homology of all the sequences of the identified LHS and RHS is compared so that the alignment score is 50 or less, and the LHS and RHS having the identified alignment score of 50 or less are added to the common primer sequence to form LPO and RPO, respectively.

Probing for influenza virus detection was completed so that G value might be 0 or more.

The completed swine influenza virus detection probes are shown in Table 3 below. As the common primer used, the 5 'primer binding portion bound to LHS was 5'-GGGTTCCCTAAGGGTTGGA-3', and the 3 'primer binding portion bound to RHS was used 5'-GTGCCAGCAAGATCCAATCTAGA-3'.

Virus types Probe Type order M1 gene LHS (SEQ ID NO: 1) GATTTTAGGA TTTGTGTTCACGCTCACCGTGCC
RHS (SEQ ID NO: 2) CAGTGAGCGAGGACTGCAGCGTAGACGCTTT
HA
(H1 seasonal) LHS (SEQ ID NO: 3) TTAAAAGGAATAGCCCCACTACAATTGGG
RHS (SEQ ID NO: 4) TAAT TGCAGCGTTGCCGGATGGATCTT AGGAAACCCAGAA
HA
(H3 seasonal) LHS (SEQ ID NO: 5) TGACCACAATGTATACAGAGATGAAGCATTAAACAA CCGGTTCCAGA
RHS (SEQ ID NO: 6) TCAAAGGCGTTGAGC TGAAGTCAGGATA
HA 2009 H1 LHS (SEQ ID NO: 7) TCCACGAT TGCAATACAACTTGTCAGACACCCAAGGG
RHS (SEQ ID NO: 8) TGCTATAAACACCAGCCTCCCATTTCAGAAT
HA 2009 N1
LHS (SEQ ID NO: 9) TCACATGTGTGTGCAGGGATAACTGGCATGGCTCGA ATCGACCG
RHS (SEQ ID NO: 10) TGGGTGTCTTTCAACCA GAATCTGGAAT

< Example  3> individual The probe  Detection experiment using

end. virus DNA  Sample production

For each gene, a nucleotide sequence of a novel influenza virus having a length of 500 bp including a specific nucleotide sequence as a target was synthesized in Bioneer (Daejeon, Korea) to receive a T vector with a cloned nucleotide sequence.

The received vector was adjusted to 20 μl of the mixture of 2 μl of the M13 sequence using a primer and 20 μl of tertiary distilled water for each 10 μM of the primer using pfu PCR premix (Bioneer, Daejoen, Korea) at 30 ° C. at 95 ° C. Second, the sequence of 30 seconds at 55 ℃, 30 seconds at 72 ℃ 30 times amplified the base sequence. After mixing 1µl of the amplification product, 2µl of enzyme mix (Qiagen, Hilden, Germany), 2µl of 10x buffer, and 2µl of dNTP, make the total volume 20µl and react for 4 hours at 37 ℃. Formed an RNA template for

The five virus-derived RNA samples obtained above were used as templates, and cDNA was synthesized using reverse transcriptase of SpeI and EcoRI nucleotide sequences in the T vector. The reaction was performed using 1 μl of 5 × buffer, 0.25 μl of RNase inhibitor, 0.5 μl of 0.1M DTT, 0.5 μl of reverse transcriptase, 0.5 μl of dNTP, 0.25 μl of Superscript RTase (reverse transcriptase, Qiagen), and 2 μl of final volume. After the reaction was conducted at 40 ° C. for 90 minutes, the enzyme was inactivated at 72 ° C. for 15 minutes.

I. MLPA  Perform

In this example, MLPA used the EK- 1 kit from MRC-Holland ( www.MLPA.com) .

5 μl of each viral DNA was subjected to reverse transcription, denatured at 95 ° C. for 5 minutes, and then 1.5 μl of MLPA buffer (MRC Holland, Netherland) and 1.5 μl of a new influenza detection probe were reacted at 60 ° C. for 16 hours. The target sequence of the sample was hybridized with two probes of LPO and RPO.

After 16 hours, the reaction temperature of the sample was lowered to 54 ° C., and 3 μl of Ligase-65 buffers A and B (MRC Holland, Netherland) and 1 μl of 3 μl of Ligase-65 were added thereto. The probe assembly was formed by ligation of two hybrid-coupled LPO and RPO probes. Thereafter, the enzyme was inactivated at 98 ° C. for 15 minutes.

The formed probe assembly was PCR amplified by binding a primer to a primer binding region included in two LPO and RPO probes. 2 μl of the formed probe assembly and 20 μl of the common primer forward 20 uM and reverse 10 uM were adjusted to 20 μl using PCR premix (Bioneer, Daejoen, Korea) for 30 seconds at 95 ° C. and 30 seconds at 60 ° C. , 35 seconds at 72 ° C. was performed to amplify the ligation probe assembly.

All. Amplified CE - SSCP Detection through

After diluting the obtained MLPA product with tertiary distilled water, 1 μl of sample, 0.3 μl of size standard (ABI), and 8.7 μl of Hi-Di were mixed, and then reacted at 95 ° C. for 4 minutes and placed at 4 ° C. for 3 minutes or more. 3130xl (ABI) was used to confirm the results of Capillary Electrophoresis-Single strand conformation polymorphism (CE-SSCP).

4 is a result of performing MLPA using a separate influenza virus detection probe according to an embodiment of the present invention, and amplified probe assembly using CE-SSCP (Capillary Electrophoresis- Single Strand Conformation Polymorphism) The figure which shows.

As shown in Figure 4 it can be seen that the new influenza virus detection probes according to the present invention shows a single peak for each gene.

< Example  4> Probe  Detection experiment using sets

When using a plurality of probes according to the present invention, it was confirmed whether the virus could be detected independently.

When all five probes of the first to fifth probes are used, and the sample includes all of the target sequences for the five probes of the first to fifth probes (FIG. 5A), the first probe and When the sample containing only the target sequence for the two probes of the fifth probe (Fig. 5b), the sample containing only the target sequence for the two probes of the third probe and the fifth probe (FIG. 5C), in the case of a sample containing only the target sequences for the three probes of the second, fourth, and fifth probes, MLPA was performed in the same manner as in Example 3 above, and CE Analysis was performed using -SSCP (Capillary Electrophoresis-Single Strand Conformation Polymorphism), and the results are shown in FIGS. 5B and 5C illustrate the detection of seasonal flu and FIG. 5D illustrates the detection of swine flu.

Attach an electronic file to a sequence list

Claims (10)

An LPO (left probe oligonucleotide) comprising a forward primer binding region and a left hybridization sequence (LHS) region that specifically hybridizes to a first region of the target sequence; And
And a right probe oligonucleotide (RPO) comprising a right hybridization sequence (RHS) and a reverse primer binding region that specifically hybridize to a second region continuously connected to the first region of the target sequence,
The left hybridization sequence (LHS) and the right hybridization sequence (RHS) are a first probe having SEQ ID NO: 1 and SEQ ID NO: 2, a second probe of SEQ ID NO: 3 and SEQ ID NO: 4, a third probe having SEQ ID NO: 5, and SEQ ID NO: 6 Swine Influenza A without a stuffer sequence, which is any one selected from the group consisting of a probe, a fourth probe of SEQ ID NO: 7 and SEQ ID NO: 8, and a fifth probe of SEQ ID NO: 9 and SEQ ID NO: 10; Probe for detecting H1N1 virus (novel swine-origin influenza A / H1N1 virus). The method of claim 1,
The first probe of SEQ ID NO: 1 and SEQ ID NO: 2 specifically hybridizes to SEQ ID NO: 11 of the influenza type A gene M (matrix),
The second probe of SEQ ID NO: 3 and SEQ ID NO: 4 specifically hybridizes to SEQ ID NO: 12 of the seasonal influenza gene H1,
The third probe of SEQ ID NO: 5 and SEQ ID NO: 6 hybridizes specifically to SEQ ID NO: 13 of seasonal influenza gene H3,
The fourth probe of SEQ ID NO: 7 and SEQ ID NO: 8 specifically hybridizes to SEQ ID NO: 14 of the new influenza A specific gene H1,
The fifth probe of SEQ ID NO: 9 and SEQ ID NO: 10 is a novel influenza A / H1N1 virus having no stuffer sequence, characterized in that it specifically hybridizes to SEQ ID NO: 15 of the new influenza A specific gene NP (novel swine- origin influenza A / H1N1 virus) detection probe. Swine influenza A / H1N1 virus (novel swine-origin influenza A) without a stuffer sequence comprising two to five probes for detecting the influenza A / H1N1 virus without the stuffer sequence according to claim 1 / H1N1 virus) probe set for detection. A method of detecting the presence of the novel swine-origin influenza A / H1N1 virus using the probe of claim 1, comprising:
(1) hybridizing the sample by contacting with a probe for detecting influenza A / H1N1 virus which does not have the stuffer sequence of claim 1;
(2) ligation of the probe hybridized with the sample to form a probe assembly;
(3) PCR amplification using the formed probe assembly as a template;
(4) isolating and detecting the amplification products; And
(5) Determining that there is a new influenza A / H1N1 virus that the complement of the probe constituting the amplified probe assembly is present in the sample when the amplification product is isolated and detected. 5. The method of claim 4,
In the step (1), the target sequence first region of the sample and the LHS of the LPO probe is hybridized, and the target sequence second region of the sample and the RHS of the RPO probe are hybridized. 5. The method of claim 4,
In the step (2), the LHS end of the LPO hybridized with the first region of the sample and the end of the RHS end of the RPO hybridized with the second region of the sample are ligated to forward primer binding region-LHS-RHS- Forming a probe assembly consisting of a reverse primer binding region. 5. The method of claim 4,
In the step (3), the primer pair is complementary to the forward primer binding region included in the left probe oligonucleotide (LPO) constituting the probe assembly, and the reverse primer binding region included in the right probe oligonucleotide (RPO) Using the probe assembly formed by PCR amplification. 5. The method of claim 4,
In the step (4), characterized in that the separation of the PCR amplification using a probe assembly as a template using the Capillary Electrophoresis-Single strand conformation polymorphism (CE-SSCP). 5. The method of claim 4,
In the step (1), the presence of a plurality of swine influenza A / H1N1 virus using a probe set for detecting swine influenza A / H1N1 virus that does not have the stuffer sequence of claim 3, characterized in that for detecting at one time. Novel swine-origin influenza A / H1N1 virus comprising a probe for detecting influenza A / H1N1 virus without a stuffer sequence of claim 1 or a probe set without a stuffer sequence of claim 3 ) Kit for detection.

Images