KR101327028B1 - Transgenic mouse overexpressing isocitrate dehydrogenase 3 alpha and manufacturing method of the same - Google Patents

Abstract

The present invention relates to a transgenic mouse overexpressing isositerate dehydrogenase 3 alpha (IDH3A) involved in ATP production in the TCA cycle, and to a method for preparing the same. Specifically, the CMV promoter, IDH3A gene and polyadenylation It relates to a mouse transformed with an expression vector comprising the sequence and a method for producing such a mouse. These transgenic mice show anti-obesity traits as a result of overexpression of IDH3A, and thus can be used as model animals for the treatment and study of obesity.

IDH3A, TCA cycle, transgenic mouse, obesity

Description

Transgenic mouse overexpressing isocitrate dehydrogenase 3 alpha and manufacturing method of the same} overexpressed isositerate dehydrogenase 3 alpha (IdH3A)

1 is a schematic diagram of the expression vector pcDNA-IDH3A designed to express the IDH3A gene under CMV promoter regulation.

Figure 2 is a diagram showing the results of analyzing the genomic DNA isolated from the tail of the transgenic mice by polymerase chain reaction (PCR).

Figure 3 is a diagram showing the result of analyzing the genomic DNA isolated from the tail of the transgenic mice by Southern blot (southern blot).

The present invention relates to a transgenic mouse overexpressing isositerate dehydrogenase 3 alpha (IDH3A) involved in ATP production in the TCA cycle, and to a method for preparing the same. Specifically, the CMV promoter, IDH3A gene and polyadenylation It relates to a mouse transformed with an expression vector comprising the sequence and a method for producing such a mouse.

The process of making ATP, a source of energy, by breaking down lipids in the body can be divided into three steps. In the first step, they are decomposed into constituents such as fatty acids and triglycerides. In the second step, the fatty acids become acetyl CoA through oxidation, etc., and finally, the third step is the acetyl coA. A is completely oxidized in the tricarboxylic acid cycle (TCA cycle). Various energy sources are metabolized to acetylcoa, which is oxidized to carbon dioxide (CO ₂ ) and water (H ₂ O), all of which are present in the matrix and internal membrane of mitochondria. Happens by

The metabolic process in the TCA cycle is briefly described as follows. It begins with the production of citric acid with six carbon atoms. The citric acid is isocitrate by the aconitase enzyme, which is oxidized by isocitrate dehydrogenase and is bound to the enzyme, oxalosuccinate. ) And reduce the coenzyme NAD ⁺ . It is then decarbonated to produce alpha-ketoglurarate and carbon dioxide (CO ₂ ). In this case, NADH generated by reduction of NAD ⁺ is immediately transferred to an electron transport system existing in the mitochondrial substrate to generate ATP, which is an active energy in vivo.

Isositerate dehydrogenase, an enzyme involved in the dehydrogenation process of isositerate in the TCA cycle, consists of four subunits. Each of the four subunits consists of two alpha subunits, one beta subunit, and one gamma subunit, of which the alpha subunit (IDH3A) is an enzymatic activity subunit. Therefore, promoting the activity of IDH3A or increasing the amount of expression can increase the reactivity of isositerate dehydrogenase, which in turn promotes the circulating metabolic process of the TCA cycle, thereby oxidizing more lipids. It can be decomposed to generate ATP energy (Cupp JR, McAlister-Henn L., Journal of Biological Chemistry. 22199-22205, 1991). If the TCA cycle does not function properly, there is a study showing that ATP synthesis, which is an active energy in vivo, decreases, fatty acid synthesis increases, oxidation also decreases, and obesity eventually occurs (Wlodek D, Gozales M., Journal of Theoretical Biology, 33-44, 2003).

Therefore, the present inventors have found that the IDH3A gene, which is expected to increase the activity of the TCA cycle, will be useful for the treatment of obesity. Accordingly, it is an object of the present invention to provide an expression vector comprising the IDH3A gene, and a transgenic mouse overexpressing the IDH3A protein by microinjecting the expression vector into a fertilized egg of a mouse. Another object of the present invention is to provide a method for producing the transgenic mouse.

In order to achieve the above object, the present invention is a CMV promoter; Isositerate dehydrogenase 3 alpha (IDH3A) gene; And it provides an expression vector pcDNA-IDH3A comprising a polyadenylation sequence. The IDH3A gene is characterized in that the cDNA synthesized from mRNA derived from the human heart, the polyadenylation sequence is characterized in that the SV40 polyadenylation sequence, human growth hormone polyadenylation sequence or bovine growth hormone polyadenylation sequence The expression vector is characterized by having the structure of FIG.

The present invention provides a mouse ( Mus musclus ) fertilized egg (KCTC 11044BP) characterized in that transformed with the expression vector pcDNA-IDH3A. In addition, it provides a mouse ( Mus musclus ), characterized in that transformed with the expression vector pcDNA-IDH3A.

In another aspect, the present invention comprises the steps of a) preparing an expression vector pcDNA-IDH3A comprising a CMV promoter, an isositerate dehydrogenase 3 alpha (IDH3A) gene, and a polyadenylation sequence; And b) provides a process for producing transgenic mice (Mus musclus) method comprising the steps of: microinjection, the prepared expression vector in the step a) the pronucleus of the rat fertilized egg. In the method of manufacturing a transgenic mouse of the present invention, the manufacturing method further comprises the step of implanting the fertilized egg of the mouse micro-injected with the expression vector into the surrogate mother, and the production method from the tail of the prepared transgenic mouse PCR or Southern blot using the extracted genomic DNA characterized in that it further comprises the step of checking whether the IDH3A gene is inserted into the genomic DNA.

In the method of preparing a transgenic mouse of the present invention, the expression vector of step a) is prepared by conjugating an IDH3A gene segment in a vector including a CMV promoter and a polyadenylation sequence, and the IDH3A gene segment is derived from a human heart. CDNA is synthesized from one mRNA and amplified by PCR.

Hereinafter, the present invention will be described in more detail.

In the present invention, "an expression vector comprising a CMV promoter, IDH3A gene, and polyadenylation sequence (poly (A) tail)" is a gene construct in which a CMV promoter is located 5 'above the IDH3A gene and a polyadenylation sequence is located below 3'. It means.

The CMV promoter is a cytomegalovirus promoter that induces overexpression of genes in eukaryotic cells. Thus the IDH3A gene under the control of the CMV promoter can be overexpressed in all cells of the mouse. As the polyadenylation sequence, a commonly used polyadenylation sequence, for example, an SV 40 polyadenylation sequence, a human growth hormone polyadenylation sequence, or a small growth hormone polyadenylation sequence, may be used. Hormone (BGH) polyadenylation sequences are preferred. The polyadenylation sequence aids expression by participating in the initiation of translation and stabilization of mRNA produced by transcription of the IDH3A gene. The IDH3A gene is preferably derived from human.

Method for producing an expression vector containing the IDH3A gene of the present invention is as follows. First, cDNA is synthesized using mRNA of human heart cells. Then, the polymerase chain reaction is carried out using the cDNA as a template. The IDH3A gene segment amplified by polymerase chain reaction is cloned into a vector, which includes a CMV promoter, a polyadenylation sequence, and a restriction enzyme recognition site between the CMV promoter and the polyadenylation sequence. A vector capable of conjugating the IDH3A gene fragment is used. For example, pcDNA vectors are preferred

In another aspect, the present invention provides a transformed mouse transformed with the prepared expression vector. The method for producing the transgenic mouse is as follows. First, female mice over 6 weeks old are selected and injected with PMSG (Pregnant Mare Serum Gonadotropin) and hCG (human Choirionic Gonadotropin) at 48 hour intervals. This results in mating hyperovulation-induced mice with male mice. After that, the vaginal plug of the females is first observed to check for mating. Fertilized eggs are collected from the fallopian tubes of female mice with epilepsy and used for microinjection.

Microinjection is carried out at a magnification of 200 to 400 times using an inverted microscope. After injecting DNA solution into the pronulei of the fertilized egg, healthy fertilized eggs are selected, implanted into the fallopian tube of the pseudo pregnant recipient, and proceeded to development. About 20 fertilized eggs can be implanted per surrogate mother, and 20-30% of them are delivered by 19 days after transplantation. Born mice are grown for 2 weeks, cut their tails, extract genomic DNA, and check for gene insertion by PCR. C57 BL / 6n, BCF hybrid, and FVB / n are the breeds used for transgenic mice. Among them, C57 BL / 6 mice are inbred lines, which are easy to breed and convenient to breed. Do.

Hereinafter, the present invention will be described in more detail with reference to the following examples. These examples are for illustrating the present invention in detail, and the scope of the present invention is not limited to these examples.

Example 1 Preparation of IDH3A Gene Expression Vector

CDNA was synthesized using mRNA isolated from human heart cells. Human mRNA was purchased from Stratagene (USA) and cDNA was synthesized using Promega (USA) cDNA synthesis kit. Using this cDNA as a template, polymerase chain reaction (PCR) was performed using primers (SEQ ID NO: 1, SEQ ID NO: 2) of the following sequence.

Forward primer (SEQ ID NO: 1) 5 'AAGCGATGGCTGGGCCC 3'

Reverse primer (SEQ ID NO: 2) 5 'ATCTAAATCTTTTACTCGGCG 3'

As the polymerase, LA-Taq polymerase from Takara (Japan) was used. The gene region to be amplified is a region corresponding to -5 to +1098 of the IDH3A gene. PCR amplification reaction was heated to 94 ℃ 5 minutes, 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 1 minute cycle was performed 33 times and finally at 72 ℃ 7 minutes. The amplified gene fragment was conjugated to the pcDNA3.1 / V5-His TOPO (Invitrogen) vector to obtain an expression vector pcDNA-IDH3A containing the IDH3A gene (FIG. 1).

Example 2 Preparation of Transgenic Mice Transformed with IDH3A Gene Expression Vector

C57BL / 6 (Central Laboratory Animal, Korea) breed was used as a transgenic mouse. Females over 6 weeks of age were selected and injected with serum gonadotropin (PMSG) and human chorionic gonadotropin (hCG) injections in pregnant horses at 48 h intervals to induce hyperovulation. After mating the female mice and male mice that induced over ovulation, the mating of the females was observed the next day to confirm the mating. Female mice with vaginal sacrifices were sacrificed using cervical spinal bone dissection, and the oviducts were cut out, fertilized eggs were collected, placed in a carbon dioxide incubator at 37 ° C. for about 1 hour, and used for microinjection.

The holding pipettes used for micro-injection were manufactured to have an outer diameter of 60-100 µm and the injection pipettes were less than 1 µm in diameter and pointed at their ends. The holding pipette and the injection pipette were mounted to be symmetrical to the micromanipulator.

Microinjection was performed at a magnification of 250 times using an inverted microscope equipped with a micromanipulator. Using a micromanipulator, a solution in which 1-3 mg / ml of the expression vector pcDNA-IDH3A prepared in Example 1 was dissolved in 5 mM Tris (pH 7.5) and 0.1 mM EDTA was injected into the male pronuclei. After injection, healthy fertilized eggs were selected and placed in the fallopian tubes of fertility surrogate mothers, which were mated with male mice undergoing intubation. More than 20 fertilized eggs were implanted per surrogate mother and delivered at 19 days after transplantation. Transformed fertilized eggs were deposited with the Korea Biotechnology Research Institute Gene Bank on December 6, 2006 (Accession No. KCTC 11044BP).

Example 3 Confirmation of Transplantation of IDH3A Overexpressed Gene in Transgenic Mice Using PCR

In Example 2, the tail tip of the mice aged 3 to 4 weeks old was cut about 1.5 to 2 cm, and genomic DNA was extracted from the tail tissue. Genomic DNA extraction method is as follows. First, the cut tail was treated with 500 μl TES buffer solution (50 mM Tris (pH 8.0), 50 mM EDTA, 0.5% SDS) with 0.1 μg protease K (proteinase K) at 55 ° C. for 4 hours. Then, 500 μl of phenol / chloroform / isoamyl alcohol (25: 24: 1, volume ratio) was added, and the aqueous layer was extracted to remove protein. Then, 350 µl of the aqueous layer was taken, and then 150 µl of 3M sodium acetate solution was added thereto, and 800 µl of 100% ethanol was added thereto, followed by refrigeration centrifugation to precipitate and extracted DNA.

This time, PCR reaction was performed using the extracted DNA as a template. Primers for PCR reactions are as follows.

Forward primer (SEQ ID NO: 3) 5 'TGGAATTGCCCTTAAGCGATGGCTGGG 3'

Reverse primer (SEQ ID NO: 4) 5 'GCCCCCTCGGTGATGAGCTTGATACTCTGC 3'

The primer was used, and the polymerase was heated at 94 ° C for 5 minutes using Takara's LA-Taq polymerase, followed by 33 cycles of 94 ° C 30 seconds, 65 ° C 30 seconds, and 72 ° C 1 minute. Finally, the polymerase chain reaction was performed under the conditions of 7 minutes at 72 ° C. The gene region to be amplified is a region between the primers indicated by arrows in FIG. 1 (forward primer is F and reverse primer is R). DNA fragments obtained through PCR were electrophoresed on 1% agarose gel to confirm DNA fragments of 542 bp, the expected size, as shown in FIG. 2, confirming that the mice were transformed with the IDH3A gene.

Example 4 Confirmation of Transplantation of IDH3A Overexpressing Gene in Transgenic Mice Using Southern Blot

DNA was digested by adding EcoRV restriction enzyme to 10 μg of genomic DNA of the mouse isolated in Example 3 and reacting at 37 ° C. overnight. The cleaved DNA was electrophoresed on 1% agarose gel, and then the DNA present on the gel was attached to the nitrocellulose membrane. The expression vector prepared in Example 1 was digested with NruI and PstI restriction enzymes, and then a probe labeled with radioisotope ³² P was prepared using a DNA 5 ′ end-labeling system (Promega, USA) kit. . The prepared probe was reacted with the DNA-attached nitrocellulose membrane for 16 hours at 65 ° C., and then the nitrocellulose membrane was exposed to the X-ray film to confirm the presence of a DNA band (FIG. 3). As a positive control, the expression vector itself prepared in Example 1 was used. Confirmation of the presence of the DNA band confirmed that the mice were transformed with the IDH3A gene.

As described above, by producing a transgenic mouse overexpressing the isositelate dehydrogenase 3A (IDH3A) gene, it can be used as a model animal for the study of the mechanism of obesity and the treatment method.

<110> Amorepacific Corporation <120> Transgenic mouse overexpressing isocitrate dehydrogenase 3 alpha          and manufacturing method of the same <160> 4 <170> Kopatentin 1.71 <210> 1 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 aagcgatggc tgggccc 17 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 atctaaatct tttactcggc g 21 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 tggaattgcc cttaagcgat ggctggg 27 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gccccctcgg tgatgagctt gatactctgc 30

Claims (11)

CMV promoter; Isositerate dehydrogenase 3 alpha (IDH3A) gene, which is cDNA synthesized from mRNA derived from a human heart; And Mus musclus (KCTC 11044BP) transformed with the expression vector pcDNA-IDH3A having the structure of FIG. 1 as containing bovine growth hormone polyadenylation sequence. delete delete delete The method of claim 1, wherein the mouse is a mouse fertilized egg (Mus musclus). The mouse ( Mus musclus ) according to claim 1, wherein the mouse is overexpressed with IDH3A . a) an expression vector pcDNA- having the structure of FIG. 1 as comprising a CMV promoter, isositerate dehydrogenase 3 alpha (IDH3A) gene, a cDNA synthesized from mRNA derived from a human heart, and bovine growth hormone polyadenylation sequence Preparing IDH3A; And b) a method of manufacturing a transgenic mouse ( Mus musclus ), comprising micro-injecting the expression vector prepared in step a) into the pronucleus of a mouse fertilized egg. The method of claim 7, wherein the method further comprises the step of transplanting the fertilized egg of the mouse micro-injected with the expression vector into the surrogate mother ( Mus musclus ) manufacturing method. The method according to claim 7 or 8, wherein the preparation method is performed by PCR or Southern blot with genomic DNA extracted from the tail of the prepared transgenic mouse to determine whether IDH3A gene is inserted into the genomic DNA. Method for producing a transgenic mouse ( Mus musclus ) characterized in that it further comprises a step. The method of claim 7 or 8, wherein the expression vector of step a) is a transgenic mouse ( Mus musclus ) production, characterized in that the conjugation of the IDH3A gene fragment in a vector containing a CMV promoter and polyadenylation sequence Way. The method of claim 10, wherein the IDH3A gene segment is a method for producing a transgenic mouse ( Mus musclus ), characterized in that the synthesis of cDNA from the mRNA derived from the human heart and amplified by PCR.

Images