KR101322882B1 - Nucleic acid aptamer capable of specifically binding to bovine viral diarrhea virus and use thereof - Google Patents

Nucleic acid aptamer capable of specifically binding to bovine viral diarrhea virus and use thereof Download PDF

Info

Publication number
KR101322882B1
KR101322882B1 KR1020120043230A KR20120043230A KR101322882B1 KR 101322882 B1 KR101322882 B1 KR 101322882B1 KR 1020120043230 A KR1020120043230 A KR 1020120043230A KR 20120043230 A KR20120043230 A KR 20120043230A KR 101322882 B1 KR101322882 B1 KR 101322882B1
Authority
KR
South Korea
Prior art keywords
nucleic acid
acid aptamer
seq
diarrhea virus
aptamer
Prior art date
Application number
KR1020120043230A
Other languages
Korean (ko)
Inventor
구만복
박지웅
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Priority to KR1020120043230A priority Critical patent/KR101322882B1/en
Priority to PCT/KR2012/006927 priority patent/WO2013032242A2/en
Priority to US14/342,241 priority patent/US9322024B2/en
Application granted granted Critical
Publication of KR101322882B1 publication Critical patent/KR101322882B1/en
Priority to US15/066,118 priority patent/US20160202262A1/en
Priority to US15/066,514 priority patent/US9562907B2/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Virology (AREA)
  • Urology & Nephrology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

PURPOSE: A nucleic acid aptamer and a use thereof are provided to diagnose related diseases more sensitively and consistently compared to an existing analysis method. CONSTITUTION: A nucleic acid aptamer capable of uniting with bovine viral diarrhea virus type 1 specifically is indicated as a base sequence among sequence number 1 through 10. If the nucleic acid aptamer is RNA, T is U in the nucleic acid sequence. The nucleic acid aptamer capable of uniting with the bovine viral diarrhea virus type 1 is indicated as a base sequence among sequence number 3, 5, and 8. A detecting method of the bovine viral diarrhea virus type 1 comprises the step of contacting the nucleic acid aptamer with a sample containing the bovine viral diarrhea virus type 1.

Description

Nucleic Acid Aptamer Capable of Specific Binding to Bovine Viral Diarrhea Virus and Use Certain

The present invention relates to a nucleic acid aptamer capable of specifically binding to a viral viral diarrhea virus and a use thereof, and more particularly to a bovine that enables diagnosis of small viral diarrhea more sensitively and consistently than a conventional antibody-based assay. Viral diarrhea The present invention relates to a nucleic acid aptamer specific for virus type 1, a method for detecting an antiviral diarrhea virus, and a method for diagnosing an antiviral diarrhea.

Bovine viral diarrhea causes ulcers, diarrhea and respiratory lesions on the mucous membrane of the digestive tract, and even death. Bovine Viral Diarrhea Virus type 1, which causes bovine viral diarrhea, is one of the major threats in the livestock industry. When infected cows are infected, fetal infections occur at high frequency and various disorders such as stillbirth and birth defects are issued. Infected fetuses in the early stages of birth can be born with persistent infections that continue to preserve the virus for a lifetime and become a new source of infection. . Infections from persistent infected cows are also important as the path of transmission of bovine viral diarrhea, and for effective prevention of bovine viral diarrhea, isolation or detection of virus from bovine serum, tissue, etc. by rapid and reliable test methods is required. In order to detect the presence of bovine viral diarrhea virus from a tissue of a conventional target animal, a method (US 2003/0143573) using an antibody specific for bovine diarrhea virus etiope has been reported.

However, the method of using the antibody for diagnosis is time-consuming and expensive because the target substance (antigen) to be detected is injected into the animal's body to make it through the immune system of the living body and must be purified later. There was a lot of trouble. In addition, since the target material that can be used as an antigen is limited, there was a difficulty in producing antibodies to toxic substances or viruses. In addition, since the antibody is a very large protein of 100 KDa or more, there may be limitations in signal detection in biosensor applications such as electrochemistry, and thermal stability is significantly lower than that of DNA or other chemicals. There was a limit. Accordingly, in order to solve the limitation of the antibody, a lot of researches on aptamers, which are nucleic acid constructs showing high affinity for various target materials, have been made as a new sensing material for improving the antibody. Aptamers are structures of single-stranded DNA or RNA with high specificity and affinity for specific targets. Aptamers are superior in cost to the sensing materials used in the field of sensors because of their high affinity for targets, excellent thermal stability and synthesis in vitro. In addition, there are no restrictions on the target material, so it is possible to synthesize aptamers for various targets such as biomolecules such as proteins and amino acids, small organic chemicals such as environmental hormones and antibiotics, and bacteria. Due to the properties of aptamers that specifically bind to target substances, a lot of research has recently been conducted to develop aptamers and apply them to new drug development, drug delivery systems, and biosensors.

However, aptamers targeting bovine viral diarrhea virus have not been reported in the prior art, and conventional methods have used many methods of immobilizing a target material on a specific separation material such as magnetic beads or columns, but the immobilization yield may be low. Dots, costly and time-consuming analysis of the immobilization yield itself, the possibility of DNA binding directly to the separation material used for immobilization, and DNA pool loss in the process of re-isolating the DNA bound to the target. The problem remains. There has been a lot of research for the aptamer development technology through the non-immobilized method, but the conventional non-immobilized aptamer development technology has problems such as the need for expensive equipment, the complexity of using the device, the need for skilled personnel.

Accordingly, the present inventors have made diligent efforts to prepare nucleic acid aptamers specific for bovine viral diarrhea virus type 1 in order to diagnose bovine viral diarrhea more accurately and quickly. As a result, other similar substances (BVDV type 2, MBCK cell, Bovine) Serum albumin, etc.) and specifically binds only to the antiviral diarrhea virus type 1, and did not complete the present invention.

The information described in the Background section is intended only to improve the understanding of the background of the present invention and thus does not include information forming a prior art already known to those skilled in the art .

It is an object of the present invention to provide a nucleic acid aptamer capable of detecting a viral viral diarrhea virus and its use to more quickly and accurately diagnose the viral viral diarrhea.

In order to achieve the above object, the present invention is characterized in that the nucleotide sequence of any one of SEQ ID NO: 1 to 10, specifically to bind to Bovine Viral Diarrhea Virus type 1 (Bovine Viral Diarrhea Virus type 1). Nucleic acid aptamers that can be provided are:

Here, when the nucleic acid aptamer is RNA, T in the nucleic acid sequence is characterized in that U.

The present invention also provides a method for detecting the antiviral diarrhea virus type 1 comprising the step of contacting the nucleic acid aptamer with the antiviral diarrhea virus type 1 containing sample.

The present invention also provides a method for diagnosing microviral diarrhea, comprising contacting the nucleic acid aptamer with a microviral diarrhea virus type 1 containing sample.

The present invention also provides a composition for the detection of antiviral diarrhea virus comprising the nucleic acid aptamer.

The present invention also provides a diagnostic composition for bovine viral diarrhea comprising the nucleic acid aptamer.

The present invention also provides a sensor for detecting the antiviral diarrhea virus or diagnosing the antiviral diarrhea comprising the nucleic acid aptamer.

The present invention also provides a kit for the detection of antiviral diarrhea virus or antiviral diarrhea diagnosis kit comprising the nucleic acid aptamer.

The present invention also provides a method for isolating a viral viral diarrhea virus, characterized in that using the nucleic acid aptamer.

The present invention also provides a composition for isolation of antiviral diarrhea virus type 1 comprising the nucleic acid aptamer.

Aptamers that specifically bind to the antiviral diarrhea virus type 1 according to the present invention can be expected to be able to diagnose related diseases more sensitively and consistently than antibody-based assays used in the prior art. In addition, DNA aptamers are advantageous for the production of biosensor chips because they are less expensive to produce and easier to immobilize on surfaces. More accurate diagnosis can be expected by developing a biosensor that can diagnose bovine viral diarrhea using BVDV type 1 binding specific DNA aptamer. In addition, the detection method according to the present invention is a method of applying a second aptamer that can be additionally coupled to the target to which the aptamer is bound, and it is possible to diagnose BVDVtype 1 more sensitively by using this in signal augmentation technology. Bar is useful.

1 is a schematic diagram illustrating a principle of separating BVDV type 1 specific aptamer using graphene oxide.
FIG. 2 is a graph showing the percentage of single-stranded DNA bound to BVDV type 1 as the target material in each round of selection in the screening process for BVDV type 1 specific aptamer separation.
3 to 12 are schematic diagrams illustrating aptamer secondary structures in which 10 nucleotide sequences of BVDV type 1 specific aptamers according to the present invention are analyzed using a web server-based m-fold program.
FIG. 13 shows BVDV type 1 (BVDV t1) of aptamer 11 (SEQ ID NO: 5), aptamer 34 (SEQ ID NO: 3) and aptamer 43 (SEQ ID NO: 8), which are BVDV type 1 specific aptamers according to the present invention; Binding specificity analysis results for analogues (BVDV type 2, CSFV, MDVK, BSA).
Figure 14 shows the affinity of BVDV type 1 specific aptamer 11 (SEQ ID NO: 5), aptamer 34 (SEQ ID NO: 3) and aptamer 43 (SEQ ID NO: 8) according to the present invention It is a graph to present.
15 is a schematic diagram of a detection method applying the sandwich method according to the present invention.
Figure 16 is a fixed BVDV type 1 specific aptamers according to the present invention when fixing the lowest aptamer 11 (SEQ ID NO: 5), Kd high aptamer 43 (SEQ ID NO: 8) of the second reaction The result of binding force analysis.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

The definitions of the main terms used in the description of the present invention and the like are as follows.

The term "nucleic acid aptamer " as used herein refers to a small single-stranded oligonucleotide capable of specifically recognizing a target substance with high affinity.

"Sample" as used herein means a composition that contains or is believed to contain an antiviral diarrhea virus and is to be analyzed and is taken from any one or more of liquid, soil, air, food, waste, animal gut and animal tissue. It may be characterized in that detected from the sample, but is not limited thereto. In this case, the liquid may be characterized in that the serum, blood, urine, water, tears, sweat, saliva, lymph and cerebrospinal fluid, and the water is precipitation (江水), sea water (海水), lakes (湖水) and rainwater (雨水) ), Waste includes sewage, wastewater, and the like, and the animal includes cattle. The animal tissues include tissues such as mucous membranes, skin, epidermis, hair, scales, eyes, tongue, cheeks, hooves, beak, snout, feet, hands, mouth, nipple, ear and nose.

In one aspect, the present invention provides a nucleic acid app capable of specifically binding to bovine viral diarrhea virus type 1, characterized in that it has a nucleotide sequence of any one of SEQ ID NO: 1 to 10. It's about a tamer.

Aptamer 13:

5'-CGTACGGAATTCGCTAGCTTGGGTATAACGTTCTGAGTCAGAACGCCGGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 1)

Aptamer 38:

5'-CGTACGGAATTCGCTAGCACGGCGGGTCGCCCGACTTTGGGCCGACTGGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 2)

Aptamer 34:

5'-CGTACGGAATTCGCTAGCCGCTCGGGGCGCTGCACGTAGGGTGGGGTGGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 3)

Aptamer 17:

5'-CGTACGGAATTCGCTAGCGTGGGGCAGTTGCTTGATGATCTGTAGCGCGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 4)

Aptamer 11:

5'-CGTACGGAATTCGCTAGCTGCGCATCCACAAATGTATTGTCGGGGGATGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 5)

Aptamer 39:

5'-CGTACGGAATTCGCTAGCCGGGTCTAGTCAGGAGGTTCCTGTGGTGCTGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 6)

Aptamer 8:

5'-CGTACGGAATTCGCTAGCGAGGGCGCCAAACAGGGTGTCCTGGCGTTGGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 7)

Aptamer 43:

5'-CGTACGGAATTCGCTAGCTGCGGACTCGCGATGCTACTTCTGATGATAGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 8)

Aptamer 27:

5'-CGTACGGAATTCGCTAGCTAAGGGTAGCACAGGTCACCTCGCCACTGTGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 9)

Aptamer 40:

5'-CGTACGGAATTCGCTAGCCGAACGTTGCGGTGTGGAACTTCGCGAGCAGGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 10)

Nucleic acid aptamers are provided as single-stranded DNA or RNA, and in the present invention, when the nucleic acid is RNA, T is represented by U in the nucleic acid sequence, and such a sequence is included in the scope of the present invention. It is obvious to those who have ordinary knowledge in Esau.

Nucleic acid aptamers of the present invention may be generally synthesized, but are not limited thereto. That is, in the present invention, the nucleic acid aptamer may be synthesized chemically or enzymatically.

The nucleic acid aptamer according to the present invention may be characterized by including chemical modification. The chemical modification may be a modification of sugar residues (eg, ribose or deoxyribose) of at least one nucleotide included in the nucleic acid aptamer. That is, the hydroxyl group at the 2 'position of the sugar residue may be characterized by being substituted with any one of a hydrogen atom, a fluorine atom, an -O-alkyl group, an -O-acyl group, and an amino group, without being limited thereto. -Br, -Cl, -R, -R'OR, -SH, -SR, -N3 and -CN (R = alkyl, aryl, alkylene) to enhance the stability of the tamper or the ability to bind to antiviral diarrhea virus Any of these may be substituted. In addition, the phosphate backbone of at least one nucleotide may be substituted with any of phosphorothioate form, phosphorodithioate form, alkylphosphonate form, phosphoroamidate form and boranophosphate form to be resistant to nuclease and hydrolysis. In addition, the chemical modification may be characterized in that at least one nucleotide included in the nucleic acid aptamer is substituted with any one of LNA (locked nucleic acid), UNA (unlocked nucleic acid), Morpholino, PNA (peptide nucleic acid) Can be.

In one embodiment of the present invention, the nucleic acid aptamer specific for the antiviral diarrhea virus type 1 was isolated in a non-immobilized manner using graphene oxide. Nucleic acid aptamer screening method of the present invention uses the point that the DNA is separated from the graphene only by the main target material because there is no way that the DNA adsorbed on the graphene can be released if the displacement is not caused by the main target. .

That is, as shown in Figure 1, the present invention developed a DNA aptamer selective to BVDV individuals using a SELEX process based on Graphene Oxide modified from the general ELEX of Ligand by Exponential Enrichment (SELEX). To this end, we first synthesized 66 mer DNA pools with primer binding sites (18mers each) and 30 random bases in the middle for PCR amplification at both ends, and the DNA pools were synthesized with BVDV type 1 analogues (BVDV type 2, CSFV: Classical Swine Fever Virus, MDBK: Mardin-Darby Bovine Kidney cell, BSA: Bovine Serum albumin), and then mixed in a buffer solution to perform the binding reaction and then remove the DNA bound to BVDV type 1 analog using graphene. . This removal takes advantage of the strong adsorption of single-stranded DNA to the graphene surface through pi-stacking.

Then, centrifugation separates the graphene and the single-stranded DNA adsorbed on the graphene, discards the supernatant and transfers BVDV type 1 to the graphene. It binds to cause DNA displacement on the graphene adsorbed DNA, is separated from the graphene to secure the DNA bound to the target by ethanol precipitation. To amplify the amount of specific DNA that binds only to BVDV type 1, PCR is performed, and the PCR reaction is purified, followed by electrophoresis with polyacrylamide gel containing a high concentration of urea. Isolate with DNA.

After gel extraction of the original single-stranded DNA band, the single-stranded DNA isolated from ethanol precipitation is obtained again. At this time, the obtained DNA pool is mixed with the B VDV type 1 analogous material as the first time, and then discards the DNA binding to the analogous material and reacts BVDV type 1 with graphene on which the DNA which is not bound to the analogous material is adsorbed. Repeat the above procedure to obtain DNA pool binding to BVDV type 1, cloning the DNA pool using pDrive Cloning Vector, and then perform DNA analysis by extracting DNA from the obtained colonies. Finally, the DNA pool was cloned using a pDrive Cloning Vector, and DNA was extracted from the colonies. As a result, as shown in Table 1, ten different BVDV type 1 binding specific nucleic acid constructs were obtained.

In another aspect, the present invention relates to a method for detecting bovine viral diarrhea virus type 1 using the nucleic acid aptamer. The antiviral diarrhea virus is detected from a sample taken from any one or more of serum, blood, urine, water, tears, sweat, saliva, lymph, cerebrospinal fluid, soil, air, food, waste, animal intestine and animal tissue It may be characterized as, but is not limited thereto. In this case, the water includes precipitation, sea water, lakes and rainwater, waste includes sewage, wastewater, and the like, and the animal includes cattle. In addition, the animal tissues include tissues such as mucous membranes, skin, skin, hair, scales, eyes, tongue, cheeks, hoofs, beaks, snouts, feet, hands, mouths, nipples, ears, and nose.

In another embodiment of the present invention using the surface magnetic resonance device (SPR) to determine the binding capacity of the antiviral diarrhea virus type 1 (BVDV type 1) specific aptamer according to the present invention and the binding force according to the BVDV type 1 concentration Compared. As a result, BVDV type 1 (BVDV t1) showed a very high binding force, but BVDV type 2 (BVDV t2) and other similar materials (CSFV, MDVK, BSA) did not bind well. These results suggest that the BVDV type 1 specific nucleic acid aptamer according to the present invention is capable of specific detection of BVDV type 1 virus, and also enables more accurate diagnosis of antiviral diarrhea. Thus, in another aspect, the present invention is directed to a method for diagnosing microviral diarrhea comprising contacting a microviral diarrhea virus type 1 specific nucleic acid aptamer with a microviral diarrhea virus type 1 containing sample. At this time, the diagnosis of bovine viral diarrhea may be characterized in that for the diagnosis of bovine viral viral diarrhea, in particular animals except humans.

In addition, the BVDV type 1 specific nucleic acid aptamer according to the present invention can be used for the detection of BVDV type 1 or the diagnosis of antiviral diarrhea by using a sandwich binding method in which each is a first aptamer and a second aptamer. In another embodiment of the present invention, when comparing the detection ability of BVDV type 1 using a sandwich binding method, aptamer 11 of SEQ ID NO: 5 is immobilized on a solid phase as a first aptamer, and the target material BVDV type 1 is added thereto. It was shown that BVDV type 1 can be detected most sensitively when sandwich sandwiches are subjected to secondary reactions in which aptamer 43 of SEQ ID NO: 8 is secondly reacted with a second aptamer. That is, in the detection method of the present invention, a nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 5 is contacted with a sample containing the viral viral diarrhea virus type 1 on a fixed immobilized nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 8 After addition and reaction, the antiviral diarrhea virus type 1 may be detected by analyzing the binding of the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 8. In this case, the binding of the second aptamer may be applied to any type of signal processing technique as long as it can determine whether the binding is performed. For example, by combining the labeling substance with the second aptamer and detecting the labeling substance itself or its reaction. You can check whether or not. The label may be attached to the second aptamer in an indirect or direct manner, and the label may be, but is not limited to, fluorescent materials, quantum dots, radiolabels, gold nanoparticles, enzymes, enzyme substrates, and electrochemical functional groups ( electrochemical functional group) and the like, and the type of the fluorescent material is not particularly limited, but for example, a known fluorescence such as a fluorescent dye such as Cy3 or Cy5, a luciferase, or a fluorescent protein such as GFP Materials can be used. In addition, the detection of the labeling substance or its reaction can be performed by a known labeling substance or a method of analyzing the reaction. For example, when a fluorescent substance is used as a labeling substance, luminescence or color change occurs in the presence of a target substance, and the target substance can be detected by measuring the fluorescence. By way of example, the reaction well can be scanned through an image scanner capable of detecting a fluorescent dye to confirm whether or not the target substance is detected, and the detection amount can be measured by measuring the extent to which the image is evolved through software.

In another aspect, the present invention relates to a composition for the detection of antiviral diarrhea virus type 1 or the diagnosis of antiviral diarrhea, which contains an aptamer specifically binding to the antiviral diarrhea virus type 1. In addition, the aptamer specifically binding to the antiviral diarrhea virus type 1 may be provided in the form of a sensor for detecting the antiviral diarrhea virus type 1 or the antiviral diagnostic is fixed to a substrate such as a chip.

A detection or diagnostic sensor system containing a nucleic acid aptamer specifically binding to the antiviral diarrhea virus type 1 may be provided in the form of a kit. Antiviral diarrhea virus detection or antiviral diarrhea diagnostic kits may take the form of bottles, tubs, small sachets, envelopes, tubes, ampoules, etc., which may be partially or It may be formed entirely from plastic, glass, paper, foil, wax, and the like. The container may be equipped with a fully or partially separable stopper, which may initially be part of the container or attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, which is accessible to the contents by the injection needle. The kit may include an external package, which may include instructions for use of the components.

The aptamer specifically binding to the antiviral diarrhea virus type 1 according to the present invention also specifically detects only the antiviral diarrhea virus type 1, including the composition for isolation of the antiviral diarrhea virus type 1 It will be apparent to those skilled in the art that the present invention can be provided.

In another aspect, the present invention relates to a method for isolation of bovine viral diarrhea virus type 1 using an aptamer that specifically binds bovine viral diarrhea virus type 1. According to one aspect of the invention, preferably, the aptamer-immobilized beads may be packed in a column and passed through a sample containing antiviral diarrhea virus type 1 to isolate the viral viral diarrhea virus type 1.

Example

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Of app tamer  detach

A 66mer DNA pool was synthesized with DNA pools containing primer sequences for PCR at both ends and 30 random sequences in the middle.

5'-CGTACGGAATTCGCTAGC-N30-GGATCCGAGCTCCACGTG-3 '(SEQ ID NO: 11)

(N: A, T, G, or C)

First, the DNA pool is a target material similar to the antiviral diarrhea virus type 1 (BVDV type 1) BVDV type 2, CSFV (Classical Swine Fever Virus), MDBK (Mardin-Darby Bovine Kidney cell), BSA (Bovine) Serum albumin) was added to a buffer solution (pH 7.4, Tris 20 mM, NaCl 100 mM, MgCl 2 2 mM) and mixed for 30 minutes at room temperature. Thereafter, the DNA bound to the analogous materials was discarded and the mixed solution and the graphene solution were reacted for 2 hours to obtain only unbound DNA. At this time, single-stranded DNA that does not bind with analogues is strongly adsorbed by pi-stacking on the surface of graphene. As such, DNA adsorbed on graphene without binding to a similar substance becomes aptamer candidate group of BVDV type 1 later.

The graphene was separated by centrifugation, the supernatant was discarded, and the separated graphene was washed three times using the same buffer solution. Put the target material BVDV type 1 in the washed graphene and reacted for 2 hours. At this time, the target material reacts with the DNA adsorbed on the graphene surface to induce the displacement of the DNA, the DNA is generated from displacement displacement of the graphene.

Next, the DNA separated from the graphene was obtained by single-stranded DNA bound to the target by ethanol precipitation, and then the amount of DNA bound to the obtained BVDV type 1 was measured using a spectrophotometer.

PCR was performed using known primer regions to amplify BVDV type 1 binding specific DNA. Since PCR products are two strands of DNA, fluorescein was immobilized on one primer for the process of separating them into single strands.

Forward primer: 5 'FP-fluorescein-CGTACGGAATTCGCTAGC-3' (SEQ ID NO: 12)

Reverse primer: 5 'RP-CACGTGGAGCTCGGATCC-3' (SEQ ID NO: 13)

PCR reactions were purified using a Purification kit and then polyacrylamide gel electrophoresis was performed to make double-stranded DNA into single strands. The 10% polyacrylamide gel contains 6 M of urea and 20% formamide, resulting in two bands after electrophoresis, in which two strands of DNA are denatured during electrophoresis, resulting in fluorescein. The attached DNA strands are on top and the unattached DNA strands are on bottom.

DNA bands with fluorescein were cut out and gel extracted, followed by ethanol precipitation. At this time, the secured DNA pool was repeated as the first time, a series of processes to react with similar substances of BVDV type 1. A schematic diagram of such a process is shown in FIG. 1, and if a series of processes is one selection, aptamer development was performed after a total of five selection processes. The aptamer's selectivity is high because the DNA that can bind to the analogous substance is removed during each screening process, and the aptamer with high affinity is taken because the DNA is taken by the displacement of the target material in each process. Could get

In FIG. 2, the percentage of single-stranded DNA bound to BVDV type 1 as a target material in each selection round is shown.

Finally, the DNA pool was cloned using pDrive Cloning Vector (Qiagen, The Netherlands), and DNA was extracted from the colonies to obtain 10 different BVDV type 1 binding specific nucleic acid constructs. DNA sequences were analyzed and the results are shown in Table 1.

3 to 12 show the results of predicting the secondary structure of the 10 aptamers using the m-fold program.

SEQ ID NO: Aptamer The base sequence (5'-3 ') One 13 CGTACGGAATTCGCTAGCTTGGGTATAACGTTCTGAGTCAGAACGCCGGGATCCGAGCTCCACGTG 2 38 CGTACGGAATTCGCTAGCACGGCGGGTCGCCCGACTTTGGGCCGACTGGGATCCGAGCTCCACGTG 3 34 CGTACGGAATTCGCTAGCCGCTCGGGGCGCTGCACGTAGGGTGGGGTGGGATCCGAGCTCCACGTG 4 17 CGTACGGAATTCGCTAGCGTGGGGCAGTTGCTTGATGATCTGTAGCGCGGATCCGAGCTCCACGTG 5 11 CGTACGGAATTCGCTAGCTGCGCATCCACAAATGTATTGTCGGGGGATGGATCCGAGCTCCACGTG 6 39 CGTACGGAATTCGCTAGCCGGGTCTAGTCAGGAGGTTCCTGTGGTGCTGGATCCGAGCTCCACGTG 7 8 CGTACGGAATTCGCTAGCGAGGGCGCCAAACAGGGTGTCCTGGCGTTGGGATCCGAGCTCCACGTG 8 43 CGTACGGAATTCGCTAGCTGCGGACTCGCGATGCTACTTCTGATGATAGGATCCGAGCTCCACGTG 9 27 CGTACGGAATTCGCTAGCTAAGGGTAGCACAGGTCACCTCGCCACTGTGGATCCGAGCTCCACGTG 10 40 CGTACGGAATTCGCTAGCCGAACGTTGCGGTGTGGAACTTCGCGAGCAGGATCCGAGCTCCACGTG

Antiviral Diarrhea Virus Binding Specificity Analysis

The ten antiviral diarrhea virus type 1 (BVDV type 1) specific aptamers isolated in Example 1 were the best control of other analogues, namely BVDV type 1, as well as Classical Swine Fever belonging to the same family. The following experiments were performed to determine whether BVDV type 1 specifically functions without showing specificity for MBDK cell and Bovine Serum albumin used for culturing virus, BVDV type 1.

In order to perform Surface Plasmon Resonance (SPR) analysis, first, a COOH group was formed on the surface of a gold chip with 50 mM 3,3'-dithiodiprropionic acid, and then a Self Assenmbly Monolayer was formed using EDC / NHS. Streptavidin was fixed thereon and each aptamer of Example 1 to which biotin was attached was fixed. The same amount of BVDV type 1 and similar substances (BVDV type 2, Classical Swine Fever Virus, MBDK cell, Bovine Serum albumin) was added to the buffer solution (20 mM Tris-Cl buffer, pH 7.6 contained 100 mM NaCl, 2 mM MgCl). 2 , 5 mM KCl, 1 mM CaCl 2 and 0.02% Tween 20) were reacted for 30 minutes, and the unbound material was washed with the same buffer solution.

Subsequently, SPR results were analyzed using an Autolab springle (SPR single channel, Eco chemie, The Netherlands). All 10 aptamers showed high specificity for BVDV type 1, among which BVDV type 1 The affinity of the three aptamers observed with high specificity, Aptamer 11 (SEQ ID NO: 5), Aptamer 34 (SEQ ID NO: 3), and Aptamer 43 (SEQ ID NO: 8), is shown in FIG. . As shown in FIG. 13, aptamer 11 (SEQ ID NO: 5), aptamer 34 (SEQ ID NO: 3), and aptamer 43 (SEQ ID NO: 8) all show very high binding forces to BVDV type 1 (BVDV t1), while BVDV It did not bind well to analogs (CSFV, MDVK, BSA), including type 2 (BVDV t2).

These results suggest that the BVDV type 1 specific nucleic acid aptamer according to the present invention is capable of specific detection of BVDV type 1 virus, and also enables more accurate diagnosis of antiviral diarrhea.

Measurement of Dissociation Constant (Kd) for Antiviral Diarrhea Virus Type 1

Among the 10 BVDV type 1 binding specific aptamers prepared in Example 1, binding assays were performed for BVDV type 1 of aptamer Nos. 11, 34 and 43 having the highest specificity.

After fixing the aptamer in the same manner as in Example 2, different concentrations of BVDV type 1 buffer solution (20 mM Tris-Cl buffer, pH 7.6 contained 100 mM NaCl, 2 mM MgCl 2 , 5 mM KCl, 1 mM CaCl) 2 and 0.02% Tween 20) for 30 minutes. In order to find the dissociation constant, each reaction degree was plotted using Sigmaplot 10.0 as nonlinear regression and single site saturation ligand binding method, and y = B max * X / K d + X was used (y is the saturation ( saturation), B max is the maximum binding position, K d is the dissociation constant, and X is the unbonded target.

As a result, the Kd value of the aptamer was derived, and analysis data thereof is shown in FIG. 14. 14 shows that all three aptamers show strong affinity for BVDV type 1.

Detection of antiviral diarrhea virus by sandwich binding method

Optimal composition for detecting antiviral diarrhea virus type 1 using the sandwich binding scheme (FIG. 15), namely optimal first aptamer (solid-immobilized aptamer) and second aptamer (first aptamer) Aptamer bound to the target material bound to, and labeled with a labeling material) was performed in the following experiment.

First, three kinds of aptamers (aptamers 11 (SEQ ID NO: 11) on the gold chip were subjected to the same method as in Example 2, targeting three kinds of aptamers identified as having the strongest affinity in Examples 2 and 3. 5), after fixing one of the aptamers of Aptamer 34 (SEQ ID NO: 3) and Aptamer 43 (SEQ ID NO: 8)), combine BVDV type 1, and then add one of the three additional aptamers I tried to combine. A total of nine combinations of sequences were tested and the results compared.

As a result, the best results were obtained when the aptamer 11 (SEQ ID NO: 5) having the lowest Kd was fixed and the second aptamer 43 (SEQ ID NO: 8) having the highest Kd was reacted, as shown in FIG. . In other words, when aptamer 11 of SEQ ID NO: 5 is immobilized on a solid phase as a first aptamer, and a target material, BVDV type 1, is added, and then a sandwich bond is performed in which aptamer 43 of SEQ ID NO: 8 is secondly reacted with a second aptamer. The most sensitive BVDV type 1 was detected.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the invention is not limited thereby. It will be obvious. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Unsigned

Attach an electronic file to a sequence list

Claims (17)

A nucleic acid aptamer capable of specifically binding to Bovine Viral Diarrhea Virus type 1, which is represented by any one of SEQ ID NOs: 1 to 10:
Here, when the nucleic acid aptamer is RNA, T in the nucleic acid sequence is characterized in that U.
The nucleic acid aptamer according to claim 1, wherein the nucleic acid aptamer capable of specifically binding to the antiviral diarrhea virus type 1 is represented by any one of SEQ ID NOs: 3, 5, and 8.
A method for detecting antiviral diarrhea virus type 1 comprising contacting the nucleic acid aptamer of claim 1 with a sample containing a viral viral diarrhea virus type 1.
The method of claim 3, wherein the antiviral diarrhea virus type 1 is at least one of serum, blood, urine, water, tears, sweat, saliva, lymph, cerebrospinal fluid, soil, air, food, waste, animal intestine and animal tissues The method characterized in that it is detected from the sample collected in.
The method according to claim 3, wherein the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 5 is brought into contact with the sample containing the antiviral diarrhea virus type 1 on the immobilized solid, and the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 8 is added to After the reaction, the method for detecting bovine viral diarrhea virus type 1 by analyzing the binding of the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 8.
The nucleic acid of claim 5, wherein the labeling material selected from the group consisting of fluorescent material, quantum dot, radiolabel, gold nanoparticle, enzyme, enzyme substrate and electrochemical functional group is represented by the nucleotide sequence of SEQ ID NO: 8. By binding to the aptamer, by detecting the reaction of the label or the labeling material characterized in that the analysis of the binding of the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 8.
A method for diagnosing microviral diarrhea, comprising contacting the nucleic acid aptamer of claim 1 with a microviral diarrhea virus type 1 containing sample.
A composition for detection of antiviral diarrhea virus comprising the nucleic acid aptamer of claim 1.
The method according to claim 8, wherein the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 5 comprises a fixed solid phase and the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 8 as an aptamer for secondary reactions Composition.
A diagnostic composition for antiviral diarrhea comprising the nucleic acid aptamer of claim 1.
The composition according to claim 10, wherein the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 5 comprises a fixed solid phase and the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 8.
A kit for the detection of antiviral diarrhea virus or antiviral diarrhea diagnostic kit comprising the nucleic acid aptamer of claim 1.
The kit according to claim 12, wherein the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 5 comprises a fixed solid phase and the nucleic acid aptamer represented by the nucleotide sequence of SEQ ID NO: 8 as a detection reagent.
Sensor for the detection of antiviral diarrhea virus or diagnosis of antiviral diarrhea comprising the nucleic acid aptamer of claim 1.
A method for isolating a viral viral diarrhea virus using the nucleic acid aptamer of claim 1.
The method of claim 15, wherein the nucleic acid aptamer comprises passing the sample through a column filled with immobilized beads.
A composition for isolation of antiviral diarrhea virus type 1 comprising the nucleic acid aptamer of claim 1.
KR1020120043230A 2011-08-31 2012-04-25 Nucleic acid aptamer capable of specifically binding to bovine viral diarrhea virus and use thereof KR101322882B1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
KR1020120043230A KR101322882B1 (en) 2012-04-25 2012-04-25 Nucleic acid aptamer capable of specifically binding to bovine viral diarrhea virus and use thereof
PCT/KR2012/006927 WO2013032242A2 (en) 2011-08-31 2012-08-30 Target non-binding aptamer selection method using graphene and aptamer selected therefrom
US14/342,241 US9322024B2 (en) 2011-08-31 2012-08-30 Aptamers screening method based on graphene without target immobilization and the aptamers obtained from the method
US15/066,118 US20160202262A1 (en) 2011-08-31 2016-03-10 Aptamers screening method based on graphene without target immobilization and the aptamers obtained from the method
US15/066,514 US9562907B2 (en) 2011-08-31 2016-03-10 Aptamers screening method based on graphene without target immobilization and the aptamers obtained from the method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120043230A KR101322882B1 (en) 2012-04-25 2012-04-25 Nucleic acid aptamer capable of specifically binding to bovine viral diarrhea virus and use thereof

Publications (1)

Publication Number Publication Date
KR101322882B1 true KR101322882B1 (en) 2013-10-29

Family

ID=49639458

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120043230A KR101322882B1 (en) 2011-08-31 2012-04-25 Nucleic acid aptamer capable of specifically binding to bovine viral diarrhea virus and use thereof

Country Status (1)

Country Link
KR (1) KR101322882B1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220057113A (en) * 2020-10-29 2022-05-09 주식회사 셀트릭스 Peptide binding bovine viral diarrhea virus specifically and kit for detecting bovine viral diarrhea virus using the same
WO2024111697A1 (en) * 2022-11-22 2024-05-30 (주)애드바이오텍 Method for preparing single domain vhh antibody for prevention or treatment of digestive disorder in calves
KR20240146187A (en) 2023-03-28 2024-10-08 한경국립대학교 산학협력단 Method for the detection of Bovine Viral Diarrhea Virus by using crispr-cas system

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030143573A1 (en) 2001-08-09 2003-07-31 Roy Huchzermeier Detection of bovine viral diarrhea virus in tissue samples
KR20100093502A (en) * 2009-02-16 2010-08-25 동국대학교 산학협력단 Method for detecting target molecules using aptamers

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030143573A1 (en) 2001-08-09 2003-07-31 Roy Huchzermeier Detection of bovine viral diarrhea virus in tissue samples
KR20100093502A (en) * 2009-02-16 2010-08-25 동국대학교 산학협력단 Method for detecting target molecules using aptamers

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220057113A (en) * 2020-10-29 2022-05-09 주식회사 셀트릭스 Peptide binding bovine viral diarrhea virus specifically and kit for detecting bovine viral diarrhea virus using the same
KR102538417B1 (en) 2020-10-29 2023-06-01 주식회사 셀트릭스 Peptide binding bovine viral diarrhea virus specifically and kit for detecting bovine viral diarrhea virus using the same
WO2024111697A1 (en) * 2022-11-22 2024-05-30 (주)애드바이오텍 Method for preparing single domain vhh antibody for prevention or treatment of digestive disorder in calves
KR20240146187A (en) 2023-03-28 2024-10-08 한경국립대학교 산학협력단 Method for the detection of Bovine Viral Diarrhea Virus by using crispr-cas system

Similar Documents

Publication Publication Date Title
US9562907B2 (en) Aptamers screening method based on graphene without target immobilization and the aptamers obtained from the method
KR101656240B1 (en) Multiplexed analyses of test samples
KR101841046B1 (en) Novel reduced graphene oxide-based aptasensor for detecting kanamycin and use thereof
CN113287014A (en) Sequential multiplex western blot
CN114150089B (en) CRISPR-Cas trans-cleavage and gFET nucleic acid detection
KR101322882B1 (en) Nucleic acid aptamer capable of specifically binding to bovine viral diarrhea virus and use thereof
KR101617205B1 (en) Nucleic Acid Aptamer Capable of Specifically Binding to Tebuconazole, Mefenacet and Inabenfide and Uses Thereof
Asghar et al. Advancements in testing strategies for COVID-19
KR101513766B1 (en) DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use
KR20190031705A (en) DNA aptamer specifically binding to Avian influenza virus and uses thereof
CN107937606B (en) Reagent and method for identifying rabies virus vaccine strain and wild strain
KR101327249B1 (en) DNA aptamers for Porcine Reproductive and Respiratory Syndrome(PRRS) virus
KR101841262B1 (en) Nucleic Acid Aptamer Capable of Specifically Binding to AI Virus and Uses Thereof
Malik et al. Biotechnological innovations in farm and pet animal disease diagnosis
KR100930974B1 (en) DNA aptamer binding to Retinol Binding Protein 4 with specificity and production method thereof
CN111363748B (en) Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus
Gahlawat et al. Advances in Animal Disease Diagnosis
KR101402316B1 (en) ELAAS (Enzyme-linked Antibody Aptamer Sandwich) Method of Detecting Adipokines Using Necleic Acid Aptamer and Antibody
CN110741099B (en) Method for assessing severity of dengue virus infection in individual, detection device and detection kit
US20220073911A1 (en) Methods for aptamer selection
KR101612882B1 (en) Nucleic Acid Aptamer Capable of Specifically Binding to Iprobenfos and Uses thereof
CN111363749A (en) Aptamer for detecting Chinese softshell turtle iridovirus and construction method and application thereof
KR101086026B1 (en) DNA aptamers binding to visfatin with specificity and production method thereof
KR101678946B1 (en) Nucleic Acid Aptamer Capable of Specifically Binding to 25-hydroxy Vitamin D3 and Uses Thereof
KR101616524B1 (en) Aptamer having specific binding ability for vaspin and Biosensor Using therof

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20160928

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20181008

Year of fee payment: 6