KR101319492B1 - Electrochemical One-Step Detection Method of DNA Based on the Transport Control of Signaling Materials - Google Patents

Abstract

The present invention relates to an electrochemical one-step nucleic acid detection and quantification method using the control of the movement of a signal material, and more particularly, to immobilized on a matrix surface separate from the electrode generating the electrochemical signal. Capture probes and signal probes labeled with electrochemical signaling materials are designed to reduce the electrochemical signal by limiting the movement of the signaling material that generates the signal as the amount of target nucleic acid increases. An electrochemical one-step nucleic acid detection and quantification method capable of detecting a nucleic acid.
Electrochemical one-step nucleic acid detection and quantification method using the control of the movement of the signal material of the present invention is an electrochemical method that can easily quantitate the presence and concentration of the target nucleic acid without washing or complicated additional reaction steps. It is possible to implement an electrochemical one-step nucleic acid detection kit that can detect nucleic acids at the same time, it can be applied to the electrochemical real-time PCR method using the same.

Description

Electrochemical One-Step Detection Method of DNA Based on the Transport Control of Signaling Materials

The present invention relates to an electrochemical one-step nucleic acid detection and quantification method using the control of the movement of a signal material, and more particularly, to immobilized on a matrix surface separate from the electrode generating the electrochemical signal. Capture probes and signal probes labeled with electrochemical signaling materials are designed to reduce the electrochemical signal by limiting the movement of the signaling material that generates the signal as the amount of target nucleic acid increases. An electrochemical one-step nucleic acid detection and quantification method capable of detecting a nucleic acid.

PCR technology, a nucleic acid amplification technology developed by Kary Mullis in 1983, is regarded as one of the greatest technological and economic value biotechnologies of the 20th century and has revolutionized whole molecular biology. It can be used as basic core technology in all fields of biotechnology such as gene cloning, sequencing, genetic diagnosis, gene fingerprint analysis and infectious disease diagnosis because it can amplify a very small amount of nucleic acid sample in a simple and convenient manner. (Bartlett, Stirling, Methods Mol Biol . 3 (6): 226, 2003).

In addition, nucleic acid amplification technology has been developed into a quantitative amplification technology of nucleic acids since the 1990s, the market is rapidly increasing. The quantitative amplification technique is to overcome the fact that the existing PCR technique cannot predict the initial concentration before the target nucleic acid amplification process and to accurately diagnose the initial concentration in real time. Typically a non-specific fluorescent substances in SYBR the green and sequencing quantitative polymerase chain reaction (qPCR) the real-time PCR technique using specific TaqMan probe and so on are widely used and have been reported by many research results (yichangmuk, BioWave, 9 (8) , 2007). This real-time PCR technique has recently been recognized as the most powerful technique in the field of gene analysis and has been widely used in the field of nucleic acid analysis and has proved its value as it is being used to confirm the H1N1 virus infection, .

On the other hand, nucleic acid analysis methods, such as current real-time PCR is mostly based on the fluorescence signal, so large and expensive analysis equipment, expensive fluorescent materials, and skilled expertise is necessary. Therefore, the current diagnosis based on nucleic acid analysis is possible only by referral to a university / general hospital or a specialized diagnostic institution, so a lot of time and money are required from sample collection to notification of the result. To overcome this limitation, there is a need for the development of new methods for simple in vitro molecular analysis on inexpensive and compact devices that can be used in local small hospitals and health centers, or even at home.

However, studies on nucleic acid analysis methods using electrochemical methods, which are easy to miniaturize simple and inexpensive equipment, are being actively conducted (X. Luo et . Al. , Electrochem . Commun . , 13: 742, 2011; T. Defever et al, Anal Chem, 83:.... 1815, 2011; BY Won et al, Analyst, 136:...... 1573, 2011; T. Defever et al, J. Am Chem Soc. , 131: 11433, 2009; TH Fang et al, Biosens Bioelectron, 24:.... 2131, 2009) , most of the methods reported to date have, such as real-time PCR by the complex further reaction process or cumbersome cleaning process required There is a disadvantage that cannot be applied to the implementation of the quantitative analysis system.

Accordingly, the present inventors have made efforts to implement a multi-target real-time PCR system without going through complicated steps including washing, and, as a result, by using the movement phenomenon control of a signal material, electrochemical one-step nucleic acid detection and quantification are possible. The present invention was completed.

An object of the present invention is to provide an electrochemical one-step nucleic acid detection and quantification method for detecting the presence or absence of a target nucleic acid by controlling the movement of the signal material.

In order to achieve the above object, the present invention (a) (i) a capture probe fixed to the bottom surface of the reaction chamber, having a sequence complementary to the target nucleic acid sequence (ii) generating an electrochemical signal by oxidation / reduction A signal probe labeled with a signal substance, having a sequence complementary to a target nucleic acid sequence different from the capture probe, and (iii) an assay solution in which the signal probe is dissolved, wherein the working electrode, the reference electrode, and the auxiliary electrode Adding a target nucleic acid to a one-step nucleic acid detection kit consisting of an installed chamber, hybridizing the target nucleic acid, a capture probe, and a signal probe; and (b) applying a current to the one-step nucleic acid detection kit to change the current. It provides a one-step nucleic acid detection and quantification method using the control of the movement of the signal material comprising the step of detecting and quantifying the target nucleic acid by measuring.

The present invention is also characterized by (i) a capture probe fixed to the bottom surface of the reaction chamber and having a sequence complementary to the target nucleic acid sequence, (ii) a signal substance that generates an electrochemical signal by oxidation / reduction, A circular probe comprising a signal probe having a sequence complementary to a target nucleic acid sequence different from a capture probe and (i) an analytical solution in which the signal probe is dissolved, and comprising a working electrode, a reference electrode, and an auxiliary electrode. Provided are a kit for detecting a step nucleic acid.

The present invention also comprises the steps of: (a) adding the target nucleic acid to the one-step nucleic acid detection kit, and performing amplification of the target nucleic acid through PCR and hybridization of the amplified target nucleic acid, the capture probe and the signal probe, and (B) provides a real-time PCR method using the control of the movement of the signal material comprising the step of applying a current to the one-step nucleic acid detection kit by measuring the change in current to monitor the target nucleic acid in real time.

Electrochemical one-step nucleic acid detection and quantification method using the control of the movement of the signal material of the present invention is an electrochemical method that can easily quantitate the presence and concentration of the target nucleic acid without washing or complicated additional reaction steps, and a variety of targets It is possible to implement an electrochemical one-step nucleic acid detection kit that can detect nucleic acids at the same time, it can be applied to the electrochemical real-time PCR method using the same.

Figure 1 is a schematic diagram of the electrochemical one-step nucleic acid detection and quantification method using the control of the movement of the signal material and PCR using the same.
Figure 2 relates to an electrochemical one-step nucleic acid detection method using the control of the movement of the signal material.
FIG. 3 relates to a one-step nucleic acid detection kit consisting of an electrode, a reaction chamber, and a gold matrix using an electrochemical one-step nucleic acid detection method using control of signal phenomena.
Figure 4 relates to electrochemical real-time PCR using an electrochemical one-step nucleic acid detection method using the control of the movement of the signal material.
Figure 5 relates to an electrochemical multi-target real-time PCR using an electrochemical one-step nucleic acid detection method using the control of the movement of the signal material.
FIG. 6 relates to a graph showing electrochemical current signals generated from metal nanoparticles as the concentration of target nucleic acid applied to the one-step nucleic acid detection kit increases.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

In one aspect of the present invention, the present invention provides an electrochemical signal generated by (a) a capture probe fixed to the bottom surface of the reaction chamber and having a sequence complementary to the target nucleic acid sequence. A signal probe labeled with a signal substance, having a sequence complementary to a target nucleic acid sequence different from the capture probe, and (iii) an assay solution in which the signal probe is dissolved, wherein the working electrode, the reference electrode, and the auxiliary electrode Adding a target nucleic acid to a one-step nucleic acid detection kit consisting of an installed chamber, hybridizing the target nucleic acid, a capture probe, and a signal probe; and (b) applying a current to the one-step nucleic acid detection kit to change the current. It relates to a one-step nucleic acid detection and quantification method using the control of the movement of the signal substance comprising the step of detecting and quantifying the target nucleic acid by measuring.

In the present invention, the bottom surface to which the capture probe is fixed may be a material selected from the group consisting of glass, carbon, ceramic, silicon, plastic, and metal.

More specifically, an electrochemical one-step nucleic acid detection method is shown. In the embodiment of FIG. 2A, a capture probe 10 immobilized on a gold matrix 8 and a signal probe 9 labeled with metal nanoparticles as an electrochemical signal material are shown. In this state, the metal nanoparticles are glass carbon electrodes. Free diffusion to the surface 3 is possible so that an electrochemical signal is generated through the oxidation / reduction reaction at the electrode surface. In FIG. 2B, when the target nucleic acid hybridizes simultaneously with the capture probe 10 and the signal probe 9, the metal nanoparticles labeled on the signal probe 9 are caught by the gold matrix 8 and reach the glass carbon electrode surface 3. It was inhibited that the electrochemical signal did not occur. As a result, because the target nucleic acid in the sample limits the movement of the signal substance that generates the signal, the electrochemical signal obtained through electrochemical voltammetry decreases as the amount of the target nucleic acid increases, and thus the presence or absence of the target nucleic acid. And concentration.

When gold is used as the bottom surface to which the capture probe is fixed, the capture probe is labeled with a thiol-group to fix the capture probe to the gold surface by a thiol-gold defect reaction.

In the present invention, the electrochemical signal material labeled on the signal probe is ferricyanide (ferricyanide), ferrocene derivatives (ferrocene derivatives), ruthenium derivatives (ruthenium derivatives), osmium derivatives (quinones) It may be characterized in that it is selected from the group consisting of materials and metals.

The electrochemical substances labeled on the signal probes are bismuth (Bi), cadmium (Cd), copper (Cu), gallium (Ga), zemenium (Ge), indium (In), nickel (Ni), and lead (Pb). ), Antimony (Sb), tin (Sn), thallium (Tl), zinc (Zn), mercury (Hg), gold (Au), silver (Ag) and platinum (Pt), etc. The metal, which is a substance, can be used in the form of ions, nanoparticles, and quantum dots to facilitate labeling. In addition, when detecting a multi-target nucleic acid, the metals, which are electrochemical substances, should have different oxidation potentials, and additives such as mercury (Hg) or bismuth (Bi) may be used to improve the sensitivity of the signal.

In the present invention, the assay solution may include a polymerase, a primer, and dNTPs (deoxynucleotide triphosphate).

In the present invention, the target nucleic acid is used to detect two or more target nucleic acids by using two or more target nucleic acids, by labeling the electrochemical material labeled on the signal probe with nanoparticles oxidized at different potentials for each target nucleic acid, respectively. It can be characterized.

In another aspect of the invention, the invention is (i) a capture probe fixed to the bottom surface of the reaction chamber, having a sequence complementary to the target nucleic acid sequence, (ii) a signal material for generating an electrochemical signal by oxidation / reduction A chamber labeled with a signal probe having a sequence complementary to a target nucleic acid sequence different from that of the capture probe, and (i) an assay solution in which the signal probe is dissolved, wherein a working electrode, a reference electrode, and an auxiliary electrode are installed. It is related with the one-step nucleic acid detection kit comprised.

In the present invention, the surface of the working electrode can be characterized in that the patterned.

More specifically, the one-step nucleic acid detection kit is shown. In the embodiment of Figure 3, by coating the gold on the glass specimen (7) was used as the bottom surface 8 to fix the capture probe, the sample inlet for injecting a sample into another glass specimen (1) (2) and the carbon working electrode 3 were patterned, and the auxiliary electrode 4 and the reference electrode 5 were patterned using gold. A one-step nucleic acid detection kit is fabricated by placing the glass specimens (1,7) so that the gold matrix (8) and the carbon working electrode (3) face each other, and inserting a frame to form the reaction chamber (6) between them. It was.

As the material used in the one-step nucleic acid detection kit, various materials can be used according to the probe immobilization method and the type of electrochemical material.

In another aspect of the invention, the present invention (a) after adding the target nucleic acid to the one-step nucleic acid detection kit, the amplification of the target nucleic acid by PCR and hybridization of the amplified target nucleic acid, capture probes and signal probes And (b) applying a current to the one-step nucleic acid detection kit and measuring a change in the current to monitor the target nucleic acid in real time. will be.

In the present invention, the bottom surface to which the capture probe is fixed may be a material selected from the group consisting of glass, carbon, ceramic, silicon, plastic, and metal.

In the present invention, the electrochemical signal material labeled on the signal probe is ferricyanide (ferricyanide), ferrocene derivatives (ferrocene derivatives), ruthenium derivatives (ruthenium derivatives), osmium derivatives (quinones) It may be characterized in that it is selected from the group consisting of materials and metals.

In the present invention, two or more target nucleic acids are used as the target nucleic acids, and the electrochemical material labeled on the signal probe is labeled with nanoparticles oxidized at different potentials for each target nucleic acid to detect two or more target nucleic acids. It can be characterized.

More specifically, the real-time PCR method using the movement phenomenon control of the signal material is shown. In FIG. 4, the capture probe 10 is immobilized on the gold matrix 8 of one-step nucleic acid detection, and a PCR reaction solution (polymerase, primer, dNTPs) containing a signal probe labeled with a signal material is injected into the reaction chamber. The electrochemical real-time PCR was carried out by mounting on a thermostat. The electrochemical signal was measured at the end of the polymerization step among the three steps of denaturation, annealing, polymerization or extension of PCR. . As the target nucleic acid is present in the sample and the amount of the target nucleic acid increases as the PCR proceeds, the target nucleic acid hybridizes with the capture probe and the signal probe to increase the amount of the signal substance caught on the gold matrix. It can be seen that the amount of the signal material that can reach to decrease the electrochemical signal.

If the capture probe sequence is perfectly complementary to the target nucleic acid, the capture probe may be extended along the target nucleic acid sequence during PCR. This eliminates the opportunity for the signal probe to hybridize with the target nucleic acid in the next cycle, so that the 3 'end of the capture probe is artificially designed with a base sequence that is not complementary to the target nucleic acid sequence, so that the capture probe is not extended. Action should be taken to avoid this.

In the real-time PCR method of detecting two or more target nucleic acids, capture probes corresponding to various types of target nucleic acids are immobilized at the bottom of the analysis chamber, and a signal probe labeled with different signal substances according to the target nucleic acids is used. Several kinds of target nucleic acids can be detected simultaneously in the reaction chamber. For example, in the embodiment of FIG. 5, when there are signal probes labeled with five signal substances, in the absence of the target nucleic acid, electrochemical signals for all signal substances are generated (FIG. 5A), and two target nucleic acids. When present, electrochemical signals for three kinds of signal substances are generated (FIG. 5B). When five target nucleic acids are present, electrochemical signals for all signal substances do not occur (FIG. 5C), and thus, the presence or absence of a multi-target nucleic acid can be determined based on the type of signal substance.

Electrochemical one-step nucleic acid detection and quantification method using the control of the movement of the signal material according to the present invention can easily quantify the presence and concentration of the target nucleic acid, without washing or complicated additional reaction step, respectively, It is possible to implement an electrochemical one-step nucleic acid detection kit that can simultaneously detect several kinds of target nucleic acids using various metals. This method enables the monitoring of nucleic acid amplification through PCR to implement an electrochemical real-time PCR system, and can be applied to the detection of biomaterials such as cells and proteins as well as nucleic acids. Can be.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Example 1 electrochemical circle Staff  Nucleic acid detection method

In order to detect the presence or concentration of the target nucleic acid in the sample, a nucleic acid detection kit was applied to which the electrochemical one-step nucleic acid detection method using the movement phenomenon control of the signal substance of the present invention was made. Analysis was performed using GAGTTACGAAGACAAAACCTCTTCGTTGACCGATGTACTCTTGTAGAAAG) as a target nucleic acid. Capture probes (5'-CTTTCTACAAGAGTACATCGGTCAA) and signal probes (5'-CGAAGAGGTTTTGTCTTCGTAACTC), which can hybridize to different portions of the target nucleic acid, are synthesized, and the capture probe is immobilized on the gold matrix at the bottom of the reaction chamber. Cd) labeled with nanoparticles. In a reaction chamber in which a capture probe is immobilized, a reaction solution in which a signal probe labeled with a signal substance is dissolved (polymerase, a primer (forward primer: 5'-TTAATGGAAAAGTTGTTTCA-3, reverse primer: 5'-TCCATATCTTTGATACGACG-3), dNTPs) The nucleic acid detection kit was constructed by covering the working electrode, the reference electrode, and the auxiliary electrode with a patterned glass specimen. To this, a target nucleic acid was added at a concentration of 100 μM to 10 uM, followed by anodic stripping analysis after 30 minutes of reaction. At this time, the reaction time of 30 minutes is to give a sufficient reaction time, it can be shortened depending on the application of this method. The electrochemical signal measurement conditions are as follows.

1. Pretreatment at -0.5V for 1 minute; 2. Accumulation for 2 minutes at -1.4V; 3. Perform square-wave stripping from -1.4V to 0.0V (4mV step potential, 25mV amplitude, 25Hz frequency)

As a result, it was confirmed that the electrochemical current signal decreases as the concentration of the nucleic acid of chlamydia increases (FIG. 6).

As described above, specific parts of the present disclosure have been described in detail, and for those skilled in the art, these specific descriptions are merely preferred embodiments, and the scope of the present disclosure is not limited thereto. Will be obvious. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Attach an electronic file to a sequence list

Claims (11)

One-step nucleic acid detection and quantification method using the control of the movement of the signal material comprising the following steps:
(a) (iii) a capture probe fixed to the bottom of the reaction chamber and having a sequence complementary to the target nucleic acid sequence;
(Ii) a signal probe labeled with a signal material that generates an electrochemical signal by oxidation / reduction and having a sequence complementary to a target nucleic acid sequence at a site different from the capture probe; And
(Iii) adding a target nucleic acid to a one-step nucleic acid detection kit comprising an analytical solution in which the signal probe is dissolved and comprising a chamber in which a working electrode, a reference electrode, and an auxiliary electrode are installed, thereby providing a target nucleic acid, a capture probe, and a signal probe. Performing hybridization; And
(b) applying a current to the one-step nucleic acid detection kit to measure the change in current to detect and quantify the target nucleic acid.
The method of claim 1, wherein the bottom surface to which the capture probe is fixed is a material selected from the group consisting of glass, carbon, ceramic, silicon, plastic, and metal.
The method of claim 1, wherein the electrochemical signal material labeled on the signal probe is ferricyanide (ferricyanide), ferrocene derivatives (ferrocene derivatives), ruthenium derivatives (ruthenium derivatives), osmium derivatives (quinones) material And a metal.
The method of claim 1, wherein the assay solution comprises a polymerase, a primer, and dNTPs (deoxynucleotide triphosphate).
The method of claim 1, wherein two or more target nucleic acids are used, and the electrochemical material labeled on the signal probe is labeled with nanoparticles oxidized at different potentials for each target nucleic acid, thereby detecting two or more target nucleic acids. Way.
(Iii) a capture probe fixed to the bottom of the reaction chamber and having a sequence complementary to the target nucleic acid sequence;
(Ii) a signal probe labeled with a signal material that generates an electrochemical signal by oxidation / reduction and having a sequence complementary to a target nucleic acid sequence at a site different from the capture probe; And
(Iii) A one-step nucleic acid detection kit comprising an analytical solution in which the signal probe is dissolved, and comprising a chamber in which a working electrode, a reference electrode, and an auxiliary electrode are installed.
The kit according to claim 6, wherein the surface of the working electrode is patterned.
Real-time PCR method using the control of the movement of the signal material comprising the following steps:
(a) adding the target nucleic acid to the one-step nucleic acid detection kit of claim 6, and then simultaneously performing amplification of the target nucleic acid through PCR and hybridization of the amplified target nucleic acid, the capture probe, and the signal probe; And
(b) real-time monitoring of the target nucleic acid by applying a current to the one-step nucleic acid detection kit to measure the change in current.
The method of claim 8, wherein the bottom surface to which the capture probe is fixed is a material selected from the group consisting of glass, carbon, ceramic, silicon, plastic, and gold.
The method of claim 8, wherein the electrochemical signal material labeled on the signal probe is ferricyanide (ferricyanide), ferrocene derivatives (ferrocene derivatives), ruthenium derivatives (ruthenium derivatives), osmium derivatives, quinones (quinones) material And a metal.
The method according to claim 8, wherein two or more target nucleic acids are used, and the electrochemical material labeled on the signal probe is labeled with nanoparticles oxidized at different potentials for each target nucleic acid, thereby detecting two or more target nucleic acids. Way.

Images