KR101299557B1 - SNP MAKER FOR DISCRIMINATION OF Schizandrae fructus, SPECIFIC-IDENTIFICATION METHODS OF Schizandrae fructus SPECIES USING SNP MAKER, AND SPECIFIC-IDENTIFICATION KITS OF Schizandrae fructus SPECIES USING SNP MAKER KIT - Google Patents

Abstract

The present invention relates to a species identification SNP marker capable of distinguishing Schisandra chinensis varieties, a species identification method using the same, and a Schizandra species identification kit.

Description

Schizandrae species identification SNP marker, Schizandra species identification method and Schizandrae fructus, SPECIFIC-IDENTIFICATION METHODS OF Schizandrae fructus SPECIES USING SNP MAKER, AND SPECIFIC-IDENTIFICATION KITS OF Schizandrae US KIT}

The present invention relates to Schizandra species identification SNP marker, Schizandra species identification method and Schizandra species identification kit using the same.

Schisandrae Fructus, Maximowicziae Fructus is Schisandra chinensis BAILLON (= Maximowiczia chinensis RUPRECHT) belonging to Schisandraceae, Schisandra chinensis BAILLON var. glabrata NAKAI (= Maximowiczia chinensis RUPRECHT var. glabrata NAKAI), Schisandra sphenanthera REHD. et WILS., Schisandra nigra MAX. (= Maximowiczia nigra NAKAI), dried fruit of Kodsura japonica DUNAL. Constituents include Schizandrin, deoxyschizandrin, γ-Schizandrin, gomisin AQ, acetylgomisin P, tigloylogomisin, benzoylgomisin Q and benzoylgomisin P, wuweizi A, wuweizi B, citral, d-ylangene, citric acid, ascorbic acid, malic acid, malic acid anthocyanin, α-chamigrene, β-chamigrene, β-chamigrenol, sterol, tocopherol, oleic acid, linoleic acid, stearic acid, palmitic acid, myristic acid, palmitoleic acid, etc. Is being used.

Currently, three species of Schisandra chinensis, Black Schisandra chinensis and South Schisandra chinensis grow in Korea. Unlike the Schisandra chinensis , which is cultivated in the southern part of Korea , Schisandra rependa is a special plant that grows only in parts of Jeju Island, and is recognized as a plant with excellent edible value and medicinal effect. However, due to unplanned fruit harvesting, deterioration of forest resources and a large amount of good genetic resources are being exhausted. Therefore, in order to increase the income of agricultural products through quality improvement and quality uniformity, it is urgent to secure good resources. To this end, it is necessary to develop genetic markers that can be distinguished between and within Schisandra chinensis.

Recently, many studies have been conducted to identify specific species or varieties using various DNA markers. In general, random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP) and microsatellite methods are used to identify species and varieties. However, such identification methods and imaging techniques make it difficult to obtain a single band that is species or variety specific, making it difficult to identify each species or variety from mixed species and varieties.

The present invention has been proposed to solve the problems of the prior art as described above, an object of the present invention to develop a species identification marker that can be distinguished between three species commonly used as Schizandra, and to provide a Schizandra species identification method using the same. have.

It is also an object of the present invention to provide a kit for identifying Schizandra chinensis.

For this purpose, the present invention provides a marker for identifying Schisandra chinensis consisting of one or more primer sets selected from the group of primer sets consisting of SEQ ID NOs: 1 and 2, 3 and 4, and 5 and 6.

In addition, the present invention provides a marker for identifying Schizandra species consisting of a modified sequence in which any one of the bases 2 to 4 positions from the 3 'end in the base sequence is mutated to any one of A, T, G, C.

In another aspect, the present invention provides a SNP marker for identifying a Schizandra chinensis strain in which the second base is mutated from the 3 'end in the nucleotide sequence.

In addition, the present invention comprises the steps of separating the genomic DNA (genomic DNA) of Schizandra chinensis;
Amplifying a specific region for each variety using a marker for identifying Schizandra chinensis according to claim 1 using the genomic DNA as a template; And
After identifying the specific gene for each amplified variety by electrophoresis, identifying each variety through the analysis of the combined band; provides a Schizandra species identification method comprising a.

In addition, the present invention provides a method for identifying Schizandra chinensis characterized by determining the presence or absence of PCR products by each marker for each Schizaceae species, and determining each species by analyzing the results.

In addition, the present invention provides a marker for identifying Schizandra species; And a kit for Schizandra species identification comprising nucleic acid amplification reagents.

Hereinafter, the content of the present invention in more detail as follows.

In order to develop the marker according to the present invention, the nucleotide sequence of the nrDNA ITS region (Internal Transcribed Spacer grgion) and rbcL region was analyzed in three domestic and eight varieties, which were purchased varieties. Modified allele-specific PCR primers were constructed to develop six SNP markers.

ITS is a region that is more useful as a target DNA for genotyping because there are more conserved regions and more conserved regions than 16S rRNA which is commonly used as target DNA. Since the plant's chloroplast genome contains hundreds of identical chloroplast genomes in a single cell, it is easier to analyze than the nuclear genome and transfers later only through the maternal inheritance without hybridization between parent genes. It is a marker that distinguishes a species or a specific lineage within the same species, and is the most reliable and quick analysis marker.

Herein, the SNP marker refers to a marker in which a 3 'terminal base portion is exactly matched to one allele, but is substituted with a base mismatched to a specific allele. The allele specific primer (or marker) according to the present invention is completely identical to one specific allele, and the 3 ′ terminal base does not coincide with the nonspecific allele. Allele-specific primers selectively amplify specific alleles because the 3′-ends that do not match are stretched by the Tag polymerase at a much lower efficiency than the perfectly matched ends. The presence or absence of the product amplified by PCR using such Schizandra species identification markers can be easily analyzed in the general agarose gel.

In addition, the marker for identifying a variety according to the present invention may impart a mutation to at least one or more bases so long as it does not affect PCR amplification with the original allele. Preferably, at least one or more selected from the second to fourth bases from the 3 'end is mismatched, and more preferably, the second base is mutated from the 3' end.

The base sequences shown in SEQ ID NOs: 1 to 6 represent the nucleotide sequences of the Schizandra chinensis species identification markers presented as preferred embodiments of the present invention. Odd sequences all represent anterior primers, even sequences represent posterior primers. They are all substituted such that the 3 'terminal base is located in the SNP region of the allele, and the base located second from the 3' end is mismatched in certain alleles. These sequences can be selectively amplified by a PCR process in one allele, but may not be amplified for any other allele. Using this property, it is possible to accurately identify Schizandra species using various combinations of Schizandra species identification markers according to the present invention.

When using the SNP marker for species identification that can be distinguished between species of Schizandra chinensis of the present invention, and Schizandra species identification method using the same, Schizandra species and intra species can be identified.

Figure 1 shows a known primer and gene map for analyzing the nucleotide sequence of the nrDNA ITS region.
Figure 2 shows a known primer and gene map for analyzing the nucleotide sequence of the chloroplast DNA rbcL region.
3 shows the nucleotide sequence in the nrDNA ITS region.
4 shows the nucleotide sequence in rbc L region.
5 shows the species specific primer design in the ITS region.
6 shows the species specific primer design in rbc L region.
Figure 7 shows the results of species screening using markers in the ITS region of the present invention.
Figure 8 shows the results of species screening using the marker in the rbc L region of the present invention.

Example 1 Extraction of Genomic DNA from Schizandrae

1) plant sample

In the present invention, four representative taxa from Schisandra chinensis group of 33 Schisandra chinensis cultivated in Gyeongsangbuk-do are selected and used as basic materials. Also, two Schisandra rependa and two Schisandra chinensis belonging to the same genus as Schisandra chinensis and Kadshura japonica Was used as a comparative study material.

2) Extraction of Genomic DNA

As a material for DNA extraction, mainly young leaves without pests or alterations were dried on silica gel, and CTAB methods generally used when extracting DNA from plants were used in the present invention.

The CTAB method is a method of extracting and purifying DNA with a mixture of cetyl trimethyl ammonium bromide and phenylchloroform (Murray, MG and WF Thompson. 1980 Nuc. Acids Res 8, 4321-4325, Pietsch et al., 1997 Lebensmittel Runds 93, 35-38). This method has the advantage that the purity of DNA is good and the range of use is widely applied.

50 mg of dried plant tissue is ground into very small pieces with liquid nitrogen. The ground sample (about 30 mg) was put in a 1.5 ml Eppendorf tube, 500 µl of CTBA solution was added, mixed well, and soaked in a 65 ° C constant temperature water bath for 30 minutes. The composition of the CTAB solution is as follows: DNA extraction buffer (Sorbitol 63.75g, Tris-base 12.1g, EDTA-Na2 1.68g / 1ℓ) and nuclei lysis buffer (CTAB 20g, 1M Tris (pH 8.0) 200ml 0.25M EDTA 200 mL 5M NaCl 400 mL / 1 L) was mixed 1: 1, and 0.2 volume 10% sarcosyl, 0.2 volume saline, and 1% 2-mercaptoethanol were mixed in a 65 DEG C constant temperature water bath. After centrifugation at 14,240 × g (15,000 rpm) for 10 minutes, mix 1 volume of 3.8 g / L sodium bisulfite and 1 volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) in the supernatant at room temperature. After standing for 5 minutes, centrifugation was performed for 5 minutes at 14,240 × g. The supernatant was transferred to a 1.5 mL tube, and 1 volume of chloroform: isoamyl alcohol (24: 1) was mixed and rotated at room temperature for 5 minutes. The supernatant was transferred to a 1.5 ml tube by centrifugation at 13,200 rpm for 15 minutes. The above procedure was repeated until the interface became clear. 7.5M ammonium acetate (-20 ° C.) was added to 0.08 volume, 0.54 times of isopropanol of the final volume was added and mixed well for 5 minutes, and precipitated at −70 ° C. for one day. After the precipitation was completed, centrifugation was performed for 5 minutes at a speed of 13,200 rpm. The supernatant was discarded and centrifuged for 1 minute at 13,200 rpm at -20 ° C by adding 700 µl of 70% ethanol to the DNA pellet. The supernatant was discarded and the remaining ethanol was well dried for 3 hours in a wind or vacuum dryer and then dissolved by adding 200 μl of 1 × TE buffer.

Example 2 Single Nucleotide Polymorphism Primer Design

Example 2-1 Primer for Sequence Analysis

To develop SNP markers, the nucleotide sequences of the nrDNA ITS region and the chloroplast DNA rbcL region of Schizandra chinensis, Schizandra chinensis and Schisandra chinensis were analyzed.

Primers and gene maps known for sequencing of the nrDNA ITS region and the chloroplast DNA rbcL region are shown in Table 1, FIGS. 1 and 2, respectively.

Region Primer Sequences (5′-3 ′) Reference nrDNA ITS ITS5 GGAAGTAAAAGTCGTAACAAGG White et al. (1989) ITS1 TCCGTAGGTGAACCTGCGG ITS4 TCCTCCGCTTATTGATATGC ITS3 GCATCGATGAAGAACGACAGC ITS2 GCTGCGTTCTTCATCGATGC rbcL rbc L N ATGTCACCACAAACAGAAACT Terachi et al. (1987)
Yamashita et al. (2000) rbc L 840 R TTGTCGCGGCAATAATGAGCC

Example 2-2 nrDNA ITS region Amplification

Among the primers of Table 1, ITS5 and ITS4 (White et al., 1989) primers were used to amplify the ITS regions of Schisandra chinensis, Black Schisandra chinensis and South Schisandra chinensis. The amplification of the ITS region was pre-denaturated at 94 ° C for 2 minutes, followed by 30 termal cycles consisting of 1 minute denaturation at 94 ° C, 1 minute annealing at 52 ° C, and 2 minutes extension at 72 ° C. Finally, it was done through PCR consisting of a final extension process at 72 ℃.

<Example 2-3> rbc L region amplification

In order to amplify the genes of the rbc L region, rbc L of each of Schisandra chinensis, Black Schisandra chinensis and South Schisandra chinensis using the rbc L N (Terachi et al., 1987) and rbc L 840R (Yamashita and Tamura, 2000) primers in Table 1 above. Some of the genes were amplified. The amplification of rbc L was repeated 40 times in a thermal cycle consisting of pre-denaturation at 94 ° C for 4 minutes, denaturation at 94 ° C for 1 minute, annealing at 50 ° C for 1 minute, and extension for 2 minutes at 72 ° C. Finally, it was done by PCR consisting of a final extension process at 72 ℃.

Example 2-4 Sequence Alignment and SNP Location Search from PCR Products

The PCR products obtained in Examples 2-2 and 2-3 were purified according to the supplier's manual using QIAquick PCR Purification Kit (QIAGEN, USA), and the purified PCR products were used as templates for cycle sequencing reactions.

Cycle sequencing reactions were performed using the BigDye Terminator V3.1 Sequencing Kit (Applied Biosystems, Inc. USA) according to the supplier's manual in the GeneAmp PCR System 9700 (Applied Biosystems Inc. USA). In case of over, cycle sequencing was performed using primers in the section.

Post reaction clean-up procedures were purified using Montage SEQ96 sequencing reaction cleanup kit (Millipore Corporation, Bedford, Mass.) According to the supplier's manual. Sequencing was performed using an ABI 3700 automated DNA sequencer (Applied Biosystems, Inc. USA).

The base sequences in the nrDNA ITS region of aligned Schisandra chinensis, Schisandra chinensis and Schisandra chinensis are shown in FIG. 3 and SEQ ID NOs: 7-9.

As shown in FIG. 3, the nrDNA ITS region nucleotide sequence was found to have no difference between the used Schisandra chinensis, Black Schisandra chinensis and South Schisandra chinensis, and between individuals. The base sequence of Schisandra chinensis, which is the main study subject, was registered with GenBank (NCBI) Matched. As a result of aligning the nucleotide sequences of each species, as shown in FIG. 3, the mutants showed mutations at a total of 28 sites and polymorphisms such as insertion and deletion of small nucleotide sequences were found.

The base sequences in the rbc L region of aligned Schisandra chinensis, Black Schisandra chinensis and South Schisandra chinensis are shown in FIG. 4 and SEQ ID NOs: 10-12.

As shown in FIG. 4, the nucleotide sequences of each species of the r bc L gene were compared using rbc L N and rbc L 840R. As a result, mutations were observed at a total of 9 sites. ) Was not observed.

Example 3 SNP marker design

Example 3-1 Primer Design in ITS Region

As shown in FIG. 3, SNP markers for multiplex PCR, which can be easily identified among 28 SNP positions showing differences among species in the ITS region sequence sequence, were prepared using the method of In et al. (2010). It was.

The position of the marker in the nucleotide sequence is shown in FIG. 5. In the present invention, Schizandra species identification SNP markers prepared a modified sequence in which the 3 'terminal base is located at the SNP region of the allele, and any one or two bases of the bases 2 to 4 are mutated from the 3' terminal. . According to this, the 3 ′ terminal base is located at the SNP site of the allele, and the modified sequence in which any of the bases 2 to 4 from the 3 ′ terminal is changed to any of A, T, G, and C is identified as Schisandra chinensis species. As a marker for the test, it was confirmed that the specific allele enables identification with other varieties without interfering with PCR amplification.

The SNP markers sch-ITS-F1, sch-ITS-R1, sch-ITS-F2, and sch-ITS-F2 sequences designed to mutate the second base from the 3 ′ end used in this example are shown in Table 2 below. same.

primer name original sequences (5 '→ 3') primer sequence (5 '→ 3') SEQ ID NO: 1 sch-ITS-F1 GCTGTGTCCCTCAAGGGTGT GCTGTGTCCCTCAAGGGTCT SEQ ID NO: 2 sch-ITS-R1 CGGCTTGCGGGTGTTGCCAC GTGGCAACACCCGCAAGCTG SEQ ID NO: 3 sch-ITS-F2 TGTGCGGTCGGCCGAAAGAT TGTGCGGTCGGCCGAAAGGT SEQ ID NO: 4 sch-ITS-R2 CGGGCCCCTGGTGTGTTGCG CGCAACACACCAGGGGCCTG

Example 3-2 Primer Design in rbc L region

SNP markers for multiplex PCR, which can be easily identified between species using nine base positions showing differences between species in the aligned rbc L gene sequences, were prepared using the method of In et al. (2010). .

A 3 'terminal base was located at the SNP site of the allele, and a modification sequence was prepared by mutating any one or two bases from the bases 2 to 4 from the 3' terminal. The position of the marker in the nucleotide sequence is shown in FIG.

In the present invention, a modification in which any one or two bases of the bases 2 to 4 positions are modified from the 3 'end to prepare primers for allele-specific PCR for developing SNP markers for identifying Schizandra species The sequence was prepared. According to this, the modified sequence in which any one of the bases 2 to 4 from the 3 'end of the base sequence was mutated to any of A, T, G, and C was used as a marker for identifying Schisandra chinensis. It was confirmed that it is possible to identify with other varieties without disturbing the amplification.

The SNP markers sch-rbcL-F1 and sch-rbcL-R1 sequences designed to mutate the second base from the 3 ′ end actually used are shown in Table 3 below.

primer name original sequences
(5 '→ 3') primer sequence
(5 '→ 3') SEQ ID NO: 5 sch-rbcL-F1 GTCTGGAAGATTTGCGAATC GTCTGGAAGATTTGCGAACC SEQ ID NO: 6 sch-rbcL-R1 TCCTCCTGCTTATTCCAAAAC GTTTTGGAATAAGCAGGAGAA

Example 4 Variety Selection Confirmation Using a Marker

<Example 4-1> Selection of varieties using markers in the ITS region

The primers ITS1, ITS4 for ITS region amplification and primers sch-ITS-F1 and sch-ITS-R1 in the ITS region designed in Example 4-1 were confirmed by electrophoresis with 1% agarose gel.

As shown in FIG. 7, in the case of C 1-C4 representing S. chinensis , a band different from R1-R4 representing S. rependa and K1-K2 representing K. japonica appeared. When the primers sch-ITS-F1 and sch-ITS-R1 were used as markers, it was confirmed that S. chinensis varieties could be selected.

<Example 4-2> Variety selection confirmation using markers in rbc L region

primer for rbc L region amplified rbc L 92c, 584g and the above-described primer sch- in the rbc L region designed in Example 4-2 rbc L -F1, sch- It was confirmed by electrophoresis with 1% agarose gel using rbc L -R1.

As shown in FIG. 8, in the case of C 1-C4 representing S. chinensis , a band different from R1-R4 representing S. rependa and K1-K2 representing K. japonica appeared. Primer sch- in rbc L region designed in Example 4-2 rbc L -F1, sch- Using rbc L -R1 as a marker, it was confirmed that S. chinensis varieties can be selected.

Attach an electronic file to a sequence list

Claims (6)

A primer set for identifying Schizandra chinensis consisting of at least one primer set selected from the group of primer sets consisting of SEQ ID NOs: 1 and 2, 3 and 4, and 5 and 6.
delete delete Separating genomic DNA of Schizandra chinensis;
Amplifying a specific region for each variety using a primer set for identifying Schizandra chinensis according to claim 1 using the genomic DNA as a template; And
Identifying each cultivar through analysis of the combined bands after confirming the specific gene for each amplified cultivar by electrophoresis; Schizandra species identification method comprising a.
5. The method of claim 4,
A method for identifying Schisandra chinensis according to the present invention, wherein the presence or absence of PCR products by each primer set for each Schisandra chinensis species is prepared in a table, and each Schisandra chinensis species is determined by analyzing the results.
A primer set for identifying Schizandra species according to claim 1; And a kit for Schisandra species identification comprising nucleic acid amplification reagents.

Images