KR101286053B1 - The shRNA downregulating TGF-β1 for treatment of tumor - Google Patents

Abstract

The present invention relates to shRNAs that inhibit TGF-β1 expression.
According to the present invention, it is possible to provide an anti-tumor composition using shRNA that inhibits TGF-β1 expression.

Description

The shRNA downregulating TGF-β1 for treatment of tumor}

The present invention relates to shRNAs that inhibit TGF-β1 expression and antitumor compositions comprising the same.

TGF-β1 inhibits the proliferation and differentiation of cytotoxic T cells, natural killer cells, and macrophages, thus inhibiting immune exploration of growing tumors. In addition, TGF-β1 is a multifunctional secretory protein that plays a variety of roles such as inhibiting proliferation, replication, invasion, metastasis, apoptosis, immune probing, and angiogenesis, depending on the type and timing of the cells [Jakowlew, Cancer Metastasis Rev. 25: 435, 2006. TGF-β1 further develops tumors in the late stages when tumors develop, which inactivate TGF-β1 signaling pathways or cause resistance to TGF-β1 proliferation due to abnormal control of the cell cycle. It will play a role. Thus, tumor cells that proliferate and overcome the body's immune system release TGF-β1 and release it from immune surveillance and at the same time act as a positive factor in proliferation, invasion metastasis and blood vessel formation [Pardali and Moustakas, BBA, 1775: 21, 2007].

In the prior art related to TGF-β1, in Non-Patent Document 1, shRNAs were prepared by targeting the coding sequences of human TGF-β1, 300-320 ggccgactactacgccaagga and 974-994 ggccctgcccctacatttgga, and introduced into the expression vector, but their TGF- β1 inhibition was low (less than 20%).

Also, In Non-Patent Document 2 Using a sense and antisense sequence such as 5'-GATCCCGTTTAACTTGAGCCTCAGCAGACGCAGCTTCAAGAGAGCTGCGTCTGCTGAGGCTCAAGTTAAATTTTTTCCAAA-3 ', TGF-β1 shRNA was made with 9 loops to create a stable cell line (stable cell line 1) in MDA-MB-435 cells. Silencing was induced but the efficacy or nonspecificity of the target sequence was not known.

“Inhibition of TGF-β1 expression in human peritoneal mesothelial cells by pcDU6 vector-mediated TGF-β1 shRNA” Nephrology 11: 23-28, 2006 "Silencing of Transforming Growth Factor-β1 In situ by RNA Interference for Breast Cancer: Implications for Proliferation and Migration In vitro and Metastasis In vivo“ Clin Cancer Res 2008 Aug 1; 14 (15): 4961-70.

Accordingly, the present inventors have made efforts to solve the above problems, and as a result, by selecting a target that effectively induces silencing of human TGF-β1 or mouse TGF-β1 to produce shRNA, and mounted it in adenovirus The present invention has been completed by drastically improving the ability of siRNA to be delivered by existing nonviral agents.

Therefore, an object of the present invention is to provide a shRNA that suppresses TGF-β1 expression by using a nucleotide sequence represented by SEQ ID NO: 1 or 2 as a target sequence.

The present invention also has another object to provide an antitumor composition comprising the shRNA as an active ingredient.

The present invention also has another object to provide a recombinant expression vector expressing the shRNA.

Another object of the present invention is to provide an antitumor composition comprising the recombinant expression vector as an active ingredient.

The present invention also has another object to provide an adenovirus into which the recombinant expression vector is introduced.

The present invention as a means for solving the above problems,

Using the nucleotide sequence shown in SEQ ID NO: 1 or 2 as a target sequence, an shRNA that suppresses TGF-β1 expression is provided.

As another means for solving the above problems,

It provides an anti-tumor composition containing the shRNA as an active ingredient.

The present invention, as another means for solving the above problems,

It provides a recombinant expression vector for the shRNA expression.

The present invention, as another means for solving the above problems,

It provides an anti-tumor composition comprising the recombinant expression vector as an active ingredient.

The present invention, as another means for solving the above problems,

And provides the adenovirus into which the recombinant expression vector is introduced.

The present invention produced new shRNAs that inhibit TGF-β1 expression, and significantly increased specificity, delivery capacity, and expression suppression ability compared to the prior art by increasing the infection rate using adenovirus as a gene carrier.

That is, the present invention provides an anti-tumor composition containing shRNA that inhibits TGF-β1 expression. In particular, most cancer cells can be applied to all cancers by imparting targeting to adenoviruses having excellent delivery efficiency.

1 shows a pSP72 / ΔE3 / si-negative vector, which is an E3 shuttle vector.
2 is a schematic diagram of a process of homologous recombination with dl324, an adenovirus backbone, after subcloning of TGF-β1 shRNA into a shuttle vector.
Figure 3 shows the PCR screening of homologously recombined colonies in BJ5183 bacteria.
Figure 4 shows the final recombinant colonies screened in HindIII digestion pattern (digestion pattern).

RNA interference (RNAi) is a natural mechanism that selectively inhibits the expression of target genes. The mediator of sequence specific mRNA degradation is a small interfering RNA of 19-23 nucleotides produced by cleavage of ribonuclease III from longer ds RNA. The cytoplasmic RNA-induced silencing complex (RISC) binds to siRNA and directs the degradation of mRNA containing a sequence complementary to one of the siRNAs. The application of RNA interference in mammals has the effect of therapeutic gene silencing. Despite the advantages of siRNAs, siRNAs have limitations in clinical applications in that they must be prepared in vitro and knockdown genes are typically delivered by transient transfection for 6-10 days. The shRNA (small-hairpin RNA) expression system of the present invention can solve the aforementioned disadvantages.

A shRNA is a molecule of about 20 bases or more having a double-stranded structure in a molecule and having a structure similar to a hairpin, by partially including a circular base sequence in single-stranded RNA.

The present invention relates to shRNA that inhibits TGF-β1 expression, characterized in that the following sequence is used as a target sequence.

Mouse target sequence: 5'-CCCTCTACAACCAACACAACCCGGG-3 '[SEQ ID NO: 1]

Human target sequence: 5'-ACCAGAAATACAGCAACAATTCCTG-3 '[SEQ ID NO: 2]

In the present invention, the shRNA that inhibits TGF-β1 expression has a sequence complementary to a part of the TGF-β1 gene, and can degrade mRNA or inhibit translation of the TGF-β1 gene. When the complementarity is 80-90%, translation of mRNA can be inhibited, and when it is 100%, mRNA can be degraded.

Thus, in the present invention, shRNAs that inhibit TGF-β1 expression are 80%, preferably 90%, particularly preferably 100% relative to the 1022th nucleotide of mouse mRNA and the complementary sequence to 512th nucleotide of human mRNA. It is preferable to include the base sequence which has homology.

In one embodiment, the mouse shRNA consists of the nucleotide sequence shown in SEQ ID NO: 1 and its complementary nucleotide sequence, and the human shRNA may consist of the nucleotide sequence shown in SEQ ID NO: 2 and its complementary nucleotide sequence. Each of the above base sequences and its complementary base sequence may be palindromically linked by a loop region of 4 to 10 bp to form a hairpin structure.

Specific examples of shRNAs of the present invention may include the following sequences:

ShRNA as a mouse target sequence of SEQ ID NO: 5'- CCCUCUACAACCAACACAACCCGGG ucucCCCGGGUUGUGUUGGUUGUAGAGGG-3 '[SEQ ID NO: 3]

ShRNA for the human target sequence of SEQ ID NO: 2: 5'- ACCAGAAAUACAGCAACAAUUCCUG ucucucCAGGAAUUGUUGCUGGUAUUUCUGGUUU - 3 '[SEQ ID NO: 4].

As a substance which inhibits the expression of TGF-β1 by RNAi, shRNA (short hairpin RNA) composed of a short hairpin structure having a protrusion at the 3 'end may be used.

The substance which inhibits the expression of TGF-β1 by RNAi may be artificially chemically synthesized, and the DNA of the hairpin structure in which the DNA sequences of the sense strand and the antisense strand are connected in the reverse direction is subjected to laboratory conditions by T7 RNA polymerase. RNA may be synthesized in vitro. When synthesized under laboratory conditions, antisense and sense RNA can be synthesized from template DNA using T7 RNA polymerase and T7 promoter. After annealing these in laboratory conditions, introducing them into cells causes RNAi to inhibit expression of TGF-β1. Introduction into a cell can be performed, for example by the calcium phosphate method or the method using various transfection reagents (for example, oligofectamine, lipofectamine, lipofection, etc.).

As a substance which inhibits the expression of TGF-β1 by RNAi, an expression vector containing shRNA or DNA may be used, or a cell containing the expression vector may be used. The type of the expression vector or cell is not particularly limited, but an expression vector or cell already used as a medicament is preferable.

In the present invention, shRNA having the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 as the target sequence can be used.

Accordingly, the present invention includes a recombinant expression vector for shRNA expression.

The recombinant vector of the present invention can be constructed by a recombinant DNA method known in the art.

Adenoviruses, retroviruses, lentiviruses, adeno-associated viruses and the like are useful viruses (or viral vectors) useful for delivering shRNA in the present invention, and adenoviruses are preferred for reasons of temporary induction of expression as in tumors.

In order to introduce the shRNA into adenovirus, the following DNA can be prepared based on the shRNA sequence.

≪ DNA for mouse target sequence >

Top strand: 5'-gatc G CCTCTACAACCAACACAACCCGGG tctc CCCGGGTTGTGTTGGTTGTAGAGGG tttt-3 '[SEQ ID NO: 5]

Bottom strand: 5'-agtcaaaa CCCTCTACAACCAACACAACCCGGG gaga CCCGGGTTGTGTTGGTTGTAGAGGG-3 '[SEQ ID NO: 6]

≪ DNA for human target sequence >

Top Strand: 5'-gatcc G CCAGAAATACAGCAACAATTCCTG tctctc CAGGAATTGTTGCTGTATTTCTGGT tttttt a-3 '[SEQ ID NO: 7]

Bottom strand: 5'-agctt aaaaaa ACCAGAAATACAGCAACAATTCCTG gagaga CAGGAATTGTTGCTGTATTTCTGGT g-3 '[SEQ ID NO: 8]

In addition, non-viral vectors useful for transferring shRNA in the present invention include all vectors commonly used in gene therapy except for the viral vectors described above, and examples thereof include various plasmids and liposomes that can be expressed in eukaryotic cells .

Meanwhile, in the present invention, shRNA that inhibits TGF-β1 expression is preferably operably linked to at least a promoter in order to be properly transcribed in the delivered cells. The promoter may be any promoter capable of functioning in eukaryotic cells, but it is particularly preferable that the U6 promoter is advantageous for producing small size RNA as RNA polymerase III. For efficient transcription of shRNAs that inhibit TGF-β1 expression, regulatory sequences including leader sequences, polyadenylation sequences, promoters, enhancers, upstream activation sequences, signal peptide sequences, and transcription terminators may be used as needed. It may be included additionally.

The term "operably linked" as used herein means that the binding between nucleic acid sequences is functionally related. When any nucleic acid sequence is operably linked, any nucleic acid sequence is located so as to be functionally related to another nucleic acid sequence. In the present invention, it is said that when any transcriptional control sequence affects the transcription of an shRNA, the transcriptional control sequence is operably linked to the shRNA.

In addition, the present invention comprises a shRNA that inhibits TGF-β1 expression of SEQ ID NO: 3 or 4, a top strand represented by SEQ ID NO: 5, and a bottom strand represented by SEQ ID NO: 6 An anti-tumor composition comprising DNA or a top strand represented by SEQ ID NO: 7 and a bottom strand represented by SEQ ID NO: 8 or a recombinant expression vector expressing the same as an active ingredient will be.

The route of administration of the antitumor composition of the present invention is not particularly limited and may be selected from oral or parenteral administration (for example, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, mucosal administration, rectal administration, Topical administration to a patient, skin administration, etc.). The form of the formulation suitable for oral administration may be in the form of a solid or liquid, and the form of a suitable formulation for parenteral administration may be in the form of injections, drops, suppositories, external preparations, eye drops, nasal drops, and the like. The antitumor composition of the present invention may contain a pharmaceutically acceptable additive, if necessary, depending on the form of the preparation. Specific examples of the pharmaceutically acceptable additives include additives such as excipients, binders, disintegrators, lubricants, antioxidants, preservatives, stabilizers, isotonizing agents, colorants, mildewers, diluents, emulsifiers, suspending agents, , Extenders, buffers, delivery carriers, carriers, excipients and / or pharmaceutical adjuvants.

The antitumor composition of the present invention in the form of a solid preparation for oral use can be prepared, for example, by adding an excipient to an active ingredient and, if necessary, adding a formulation additive such as a binder, a disintegrant, a lubricant, a colorant or a mating agent After that, it can be prepared as tablets, granules, powders and capsules according to a conventional method. The antitumor composition of the present invention in the form of a liquid preparation for oral use can be prepared by adding one or more additives for formulation such as a mating agent, a stabilizer, or a preservative to the active ingredient, , Elicitation practice, and the like.

As the solvent used for prescribing the antitumor composition of the present invention as a liquid preparation, any of water and non-aqueous solvents may be used. Liquid preparations can be prepared by methods well known in the art. For example, the injection may be prepared by dissolving the injectable solution in a solvent such as physiological saline, a buffer such as PBS, sterilized water, etc., filtering sterilized with a filter paper or the like, and then filling the sterilized container (for example, ampule). The injectable preparation may contain a conventional pharmaceutical carrier if necessary.

Also, an administration method using a non-invasive catheter may be used. Carriers usable in the present invention include neutral, buffered physiological saline, or physiological saline containing serum albumin.

Regarding gene delivery, such as an shRNA expression vector that inhibits TGF-β1 expression, the method is not particularly limited as long as the shRNA or shRNA expression vector that inhibits TGF-β1 expression is expressed in the cell to which it is applied. It is possible to use gene introduction using viral vectors, liposomes. Examples of the viral vector include animal viruses such as retroviruses, vaccinia viruses, adenoviruses, and sindividual semicircular viruses.

Substances that inhibit TGF-β1 expression by RNAi may be injected directly into cells.

The effective ingredient of the antitumor composition of the present invention is used in a therapeutically effective amount, and the dose of the composition may vary depending on the purpose of use, the degree of addiction of the disease, the age, body weight, sex, history of the patient, And the like can be determined by those skilled in the art. For example, about 1x10 < ¹⁰ > particles to 1x10 < ¹² > particles per kg of adult as an active ingredient. The frequency of administration of the antitumor composition of the present invention may be, for example, once per day to several months.

Since the shRNA of the present invention inhibits TGF-β1 expression, the pharmaceutical compositions of the present invention can be used in various diseases or diseases associated with tumors, such as brain cancer, gastric cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, It can be used for the treatment of esophageal cancer, pancreatic cancer, bladder cancer, prostate cancer, colon cancer, colon cancer and cervical cancer. As used herein, the term “treatment” means (i) prevention of tumor cell formation; (Ii) inhibition of a disease or condition associated with the tumor following removal of the tumor cells; And (iii) alleviation of a disease or disorder associated with a tumor following removal of tumor cells. Thus, the term “therapeutically effective amount” herein means an amount sufficient to achieve the above pharmacological effect.

Hereinafter, the present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited by the following examples.

Example  One: shRNA  Produce- TGF -silence of β1 ( silencing ) Effectively inducing target  selection

In order to induce silencing of TGF-β1, the present invention has prepared shRNAs based on sense 25 mer / antisense 25-27 mer (including a loop having 4 or 6 bases in the middle) and expressed in adenovirus. To the shuttle vector and homologous recombination virus was produced.

In order to verify the specificity of shRNA TGF-β1, a shuttle vector having a scrambled shRNA was also prepared. The specificity and the ability to inhibit the expression were greatly improved as compared with the conventional method.

To this end, siRNA having an effect of inhibiting at least 75% of TGF-β1 mRNA in mice at least 10 nM of shRNA of TGF-β1 was secured through real-time PCR.

To this end, the siRNA of the mouse was skin cancer cells NIH3T3, and the human siRNA was made using the HeLa cell line, uterine cancer cells, and then shRNA was made, and then transfected and examined to decrease after 48 hours.

The experimental method is as follows.

Real-time RT-PCR transfected several types of candidate shRNA 10nM to NIH3T3 and incubated for 48 hours, screening 11 shRNAs against mouse TGF-β1 via validation, resulting in 76.51% silencing in shRNAs targeted to the target (silencing) effect was confirmed.

For real-time RT-PCR, the forward primer was 5'-TTGCTTCAGCTCCACAGAGA-3 '[SEQ ID NO: 9] and the reverse primer was 5'-TGGTTGTAGAGGGCAAGGAC-3' [SEQ ID NO: 10], and the reaction conditions were performed as follows. .

Step 1: Reverse transcription (42 ° C for 5 min, 95 ° C for 10 sec)

Step 2: PCR reaction (95 ° C for 5 sec, 60 ° C for 20 sec) 50 cycles,

Step 3: The separation was carried out (60 ° C-> 95 ° C).

As a result of validation experiment, the following target was selected based on Table 1 among 10 target sequence candidates.

Mouse target sequence: 5'-CCCTCTACAACCAACACAACCCGGG-3 '[SEQ ID NO: 1]

ShRNA primer ct ^{1 )} Δct ^{2 )} ΔΔct ^{3 )} 2-ΔΔct ^{4 )} Expression inhibition rate (%) ^{5 )} Control group
Trp53 ^{6 )} actin 16.58 Trp53 26.50 9.92 2.30 0.20 79.69 TGF-β1 27.05 10.47 TGF-β1 shRNA actin 16.41 TGF-β1 28.97 12.56 2.09 0.23 76.51

1) ct: cycle threshold, the number of cycles it takes to reach saturation, the smaller the original mRNA

2) Δct: TGF-β1 ct minus actin ct

3) ΔΔct: Δct of the TGF-β1 shRNA treated sample minus TGF-β1 Δct of the control group

4) 2-ΔΔct: negative index ΔΔct value of 2

5) Expression inhibition rate: 2-ΔΔct expressed as a percentage

6) Trp53: positive control shRNA

The shRNAs having 25/27 +4 loops were synthesized with respect to the target sequences and their inhibitory effects on the target sequences were confirmed by real-time PCR.

ShRNA with mouse target sequence (5'-CCCTCTACAACCAACACAACCCGGG-3 ': 5'- CCCUCUACAACCAACACAACCCGGG ucucCCCGGGUUGUGUUGGUUGUAGAGGG-3' [SEQ ID NO: 3])

BamHI and HindIII base sites were inserted at both ends to express 10 base sequences selected by the real-time PCR described above, and had a loop having 4 bases of tctc in the middle. That is, the basic structure of the mouse shRNA is composed of 5'-25 mer-loop (4 mer) -25mer-3 '.

Based on this, the following two strands of DNA were prepared for introduction into adenoviruses.

Top Strand: 5'-gatc G CCTCTACAACCAACACAACCCGGG tctc CCCGGGTTGTGTTGGTTGTAGAGGG tttt-3 '[SEQ ID NO: 5]

Bottom strand: 5'-agtcaaaa CCCTCTACAACCAACACAACCCGGG gaga CCCGGGTTGTGTTGGTTGTAGAGGG-3 '[SEQ ID NO: 6]

In particular, only the first siRNA of the top strand was replaced with G (for transcript enhancement, the final siRNA was the same).

Primers for real time PCR for human TGF-β1 inhibition are as follows.

Forward primer: 5'-CAAGGGCTACCATGCCAACT-3 '[SEQ ID NO: 11]

Reverse primer: 5'-AGGGCCAGGACCTTGCTG-3 '[SEQ ID NO: 12]

Reaction conditions are ~ 1 step: reverse transcription (42 ℃ 5 min, 95 ℃ 10 sec),

Step 2: PCR reaction (95 ° C for 5 sec, 60 ° C for 20 sec) 50 cycles,

Step 3: The separation was carried out (60 ° C-> 95 ° C).

As a result of validation experiment, the following target was selected based on Table 2 among three target sequence candidates.

Human target sequence: 5'-ACCAGAAATACAGCAACAATTCCTG-3 '[SEQ ID NO: 2]

ShRNA primer ct Δct ΔΔct 2-ΔΔct Expression inhibition rate (%) Luci ^{1 )} actin 19.4 vim 22.08 2.68 TGF-β1 29.9 10.5 vim ^{2 )} actin 18.47 vim 25.25 6.78 4.1 0.058315 94.1685438 TGF-β1 shRNA actin 18.66 TGF-β1 32.44 13.78 3.28 0.102949 89.70511228

1) Luci: negative control shRNA

2) vim: positive control shRNA

The shRNAs having 25/27 +6 loops were synthesized with respect to the target sequences, and their inhibitory effects on the target sequences were confirmed by real-time PCR.

ShRNA for human target sequence (5'-ACCAGAAATACAGCAACAATTCCTG-3 ': 5'- ACCAGAAAUACAGCAACAAUUCCUG ucucucCAGGAAUUGUUGCUGGUAUUUCUGGUUU - 3 '[SEQ ID NO: 4]

BamHI and HindIII base sites were inserted at both ends to express the second base sequence selected by the real-time PCR described above in the adenovirus, and a loop having 6 bases of tctctc was prepared in the middle. That is, the basic structure of human shRNA is composed of 5'-25 mer-loop (6 mer) -27mer-3 '.

Based on this, the following two strands of DNA were prepared for introduction into adenoviruses.

Top Strand: 5'-gatcc G CCAGAAATACAGCAACAATTCCTG tctctc CAGGAATTGTTGCTGTATTTCTGGT tttttt a-3 '[SEQ ID NO: 7]

Bottom strand: 5'-agctt aaaaaa ACCAGAAATACAGCAACAATTCCTG gagaga CAGGAATTGTTGCTGTATTTCTGGT g-3 '[SEQ ID NO: 8]

In particular, only the first siRNA of the top strand was substituted with G (for transcript enhancement, the final siRNA was the same).

Example  2: target  For sequence shRNA  Inability to reproduce Adenovirus  Vector production

The most effective inhibitory siRNA sequences identified by real-time RT-PCR were placed with the sense and antisense sequences between tctc or tctctc, and consisted of bases with BamH I and Hind III restriction enzyme sequences at both ends. After oligonucleotide and complementary oligonucleotides were synthesized and annealed, respectively, the adenovirus E3L (26591-28588) in the pSP72 / ΔE3 / si-negative vector (Fig. 1, pSP72 cloning vector (Promega)), an E3 shuttle vector. And a plasmid containing E3R (30504-31057) in ambion's psilencer 2.1-U6 hygrownd, a base sequence for -EcoRI-U6 promoter + -BamHI-nonsense shRNA ggatcc actaccgttg ttataggtgt tcaagagaca cctataacaacggtagtttt ttggaaaagctt-HindSP containing deltaSP3 si a negative (scrambled)] first, Bam HI and H ind ⅲ after treatment, was inserted to prepare a pSP72 / E3-sh-human TGF -β1 or pSP72 / E3-sh-mouse TGF -β1 [ 2]. Negative control adenoviruses with BamHI and HindIII at both ends and scrambled sequences (actaccgttgttataggtgt) and loop (ttcaagaga) were prepared.

After screening only positive clones (# 1, 5, 8, 13, 14, 15) by E3 site PCR of adenovirus [FIG. 3], the final recombinant was selected by HindIII digestion pattern as shown in FIG. 4. It was.

Each of the E3 shuttle vectors prepared by the above method was treated with Xmn I restriction enzymes to form single strands, and then Spe I restriction enzymes were simultaneously transformed with E. coli BJ5183 together with single-stranded non-replicating adenovirus dl324. Gene homologous recombination was induced (when shRNA was produced in a replicable adenovirus, a replication adenovirus was produced because the inhibitory effect by shRNA and the cell lysis effect were mixed and it was difficult to clearly identify only the inhibitory effect).

Homologously recombined plasmid DNA was obtained and treated with Hind III restriction enzyme to confirm the change of DNA pattern and finally sequenced to confirm homologous recombination. The identified plasmids were cut with Pac I and transformed into 293 cell lines. A nonreplicating adenovirus expressing siRNA TGF-β1 was constructed. The adenovirus was grown in 293 cell lines and concentrated to CsCl gradients to determine the titer of the virus by limiting dilution or plaque assay.

The final virus titer was 2.0 x 10 ⁹ pfu / ml by limiting dilution titration.

Implementation 3: Confirmation of effects on cancer cells - shRNA  Expressive Adenovirus  by TGF -inhibiting β1 expression

1) real-time RT - PCR confirmed

TGF-β1 Expression inhibition was confirmed by infection of mouse skin cancer cells B16F10 with 100 moi and 500 moi 2 days later, RNA was extracted and confirmed the expression inhibition effect by real-time RT-PCR.

Real-time PCR primers for mouse TGF-β1 inhibition were used as forward primer: 5'-TTGCTTCAGCTCCACAGAGA-3 '[SEQ ID NO: 9] and reverse primer: 5'-TGGTTGTAGAGGGCAAGGAC-3' [SEQ ID NO: 10], AB powerSYBR Green Using the RNA-to-Ct 1step kit, 0.2 μl RT enzyme mix (125X), 12.5 μl RT-PCR Mix (2x), 0.5 μl Forward Primer (100 pM), 0.5 μl reverse reverser (100 pM), RNA (10ng) 5 μl, 6.3 μl of Nuclease-free water was brought to a total volume of 25 μl.

The reaction conditions are shown in Table 3 below.

Step Temp (캜) Duration Cycles RT step 48 30min Hold Enzyme Activation 95 10 min Hold Denature 95 15 sec 40 Anneal / Extend 60 1 min

As a result of confirming mouse TGF-β1 shRNA, a silencing effect of 98% was observed at 500 moi [Table 4].

ShRNA primer ct Δct ΔΔct 2-ΔΔct Expression inhibition rate (%) Cell-1 ¹⁾ actin 15.45 Mouse TGF-β1 28.66 13.21 Nc-1 ²⁾ 100 moi actin 15.27 Mouse TGF-β1 28.42 13.15 -0.06 1.04246576 -4.24657608 Nc-1 500 moi actin 15.12 Mouse TGF-β1 28.48 13.36 0.15 0.90125046 9.87495374 Mouse TGF-β1 shRNA
100 moi actin 15.94 Mouse TGF-β1 33.6 17.66 4.45 0.04575268 95.42473220 Mouse TGF-β1 shRNA
500 moi actin 15.52 Mouse TGF-β1 34.49 18.97 5.76 0.01845301 98.15469897

1) Cell-1: Cell not treated with virus

2) Nc-1: Adenovirus with Scrambled shRNA sequence

TGF-β1 Expression inhibition was confirmed by 1 to 200 moi of human prostate cancer cells DU-145 at 1 to 200 moi, cells were lysed with Trizol and treated with chloroform, isopropanol, ethanol and the like continuously. TGF-β1 after harvesting RNA mRNA expression inhibition was confirmed by real-time PCR.

Real-time PCR primers for human TGF-β1 inhibition were used as forward primer: 5'-CAAGGGCTACCATGCCAACT-3 '[SEQ ID NO: 11] and reverse primer: 5'-AGGGCCAGGACCTTGCTG-3' [SEQ ID NO: 12], AB powerSYBR Green Using the RNA-to-Ct 1step kit, 0.2 μl RT enzyme mix (125X), 12.5 μl RT-PCR Mix (2x), 0.5 μl Forward Primer (100 pM), 0.5 μl reverse reverser (100 pM), RNA (10ng) 5 μl, 6.3 μl of Nuclease-free water was brought to a total volume of 25 μl.

The reaction conditions are shown in Table 5 below.

Step Temp (캜) Duration Cycles RT step 48 30min Hold Enzyme Activation 95 10 min Hold Denature 95 15 sec 40 Anneal / Extend 60 1 min

In human TGF-β1 shRNA identification, 98% silencing effect was observed in 200 moi adenovirus expressing shRNA TGF-β1 [Table 6].

shRNA primer ct Δct ΔΔct 2-ΔΔct Expression inhibition rate (%) Control group actin 19.25 human TGF-β1 25.45 6.2 NC ^{1 )} 1moi actin 19.55 human TGF-β1 25.66 6.11 -0.09 1.06437018 -6.43701825 NC 5moi actin 19.21 human TGF-β1 25.35 6.14 -0.06 1.04246576 -4.24657608 NC 10 moi actin 19.71 human TGF-β1 26.08 6.37 0.17 0.88884268 11.11573188 NC 50 moi actin 19.85 human TGF-β1 57.75 5.9 -0.3 1.23114441 -23.11444133 NC 100 moi actin 19.39 human TGF-β1 25.95 6.56 0.36 0.77916458 22.08354203 NC 200 moi actin 19.99 human TGF-β1 26.46 6.47 0.27 0.82931955 17.06804542 human TGF-β1 shRNA
1 moi actin 19.18 human TGF-β1 26.07 6.89 0.69 0.61985385 38.01461500 human TGF-β1 shRNA
5 moi actin 18.98 human TGF-β1 26.65 7.67 1.47 0.36098230 63.90177011 human TGF-β1 shRNA
10 moi actin 19.18 human TGF-β1 27.37 8.19 1.99 0.25173889 74.82611125 human TGF-β1 shRNA
50 moi actin 19.28 human TGF-β1 28.25 8.97 2.77 0.1660437 85.33956313 human TGF-β1 shRNA
100 moi actin 19.53 human TGF-β1 29.19 9.66 3.46 0.09087328 90.91267177 human TGF-β1 shRNA
200 moi actin 19.24 TGF-β1 31.14 11.9 5.7 0.01923663 98.07633685

1) NC: Adenovirus with Scrambled shRNA sequence

2) Confirm by ELISA

The amount of TGF-β1 secreted in serum-free medium was measured in the last 24 hours while incubating in B16F10, a mouse melanoma cancer cell, for 2 days after 100 moi and 500 moi of the adenovirus.

When adenoviruses expressing shRNA of TGF-β1 were infected, the amount of secreted up to 20 times or more was reduced compared to the control group [Table 7].

Sample Values ^{1 )} Outliers ^{2 )} Result ^{3 )} MeanResult ^{4 )} Std.Dev. ⁵⁾ CV% ⁶⁾ Dilution Factor * 1.3 (pg / ml) ⁷⁾ Mouse adeno / shRNA TGF-β1 100 moi-1 0.026 Outlier 0.021 0.023 0.008 32.5 29.9 Mouse adeno / shRNA TGF-β1 100 moi-2 0.022 Outlier 0.017 Mouse adeno / shRNA TGF-β1 100 moi-3 0.036 0.031 Mouse adeno / shRNA TGF-β1 500 moi-1 0.018 Outlier 0.013 0.013 0.001 8.2 16.9 Mouse adeno / shRNA TGF-β1 500 moi-2 0.019 Outlier 0.014 Mouse adeno / shRNA TGF-β1 500 moi-3 0.017 Outlier 0.012 adeno / shRNA negative 100 moi-1 0.22 0.223 0.21 0.013 6 273 adeno / shRNA negative 100 moi-2 0.196 0.198 adeno / shRNA negative 100 moi-3 0.207 0.209 adeno / shRNA negative 500 moi-1 0.237 0.241 0.245 0.01 4.1 318.5 adeno / shRNA negative 500 moi-2 0.252 0.256 adeno / shRNA negative 500 moi-3 0.234 0.238 cell only-1 0.192 0.194 0.215 0.021 9.8 279.5 cell only-2 0.232 0.235 cell only-3 0.198 0.2 cell only-4 0.227 0.23

1) Value: Optical density when the optical density when the TGF-β1 protein is 0 is o

2) Outliers: Out of range of TGF-β1 protein for the standar curve

3) result: calibrated optical density calculated from standard curve

4) mean value: average of 3 values

5) std Dev: standard deviation

6) cv%: coefficient value

7) dilution factor: multiply by 1.3 (mouse) the ratio of HEPES to neutralize after HCL addition to activate TGF-β1 in the medium.

Like mice, adenoviruses for human sequencing were infected with prostate cancer cells DU-145 with 5, 10, 50 and 100 moi, followed by incubation for 2 days. Measured.

Adenovirus infection was reduced by at least 8-fold at 50 moi compared to the control, and almost completely inhibited at 500 moi, which could not be measured [Table 8].

Sample Value Result Mean result SD CV Dilution factor
* 1.4 (pg / ml) ¹⁾ Ave ^{2 )} adeno / shRNA negative 5 moi 0.256 0.127 0.217 0.127 58.6 165.1 0.547 0.307 399.1 294.2 0.447 0.245 0.245 0 0 318.5 adeno / shRNA negative 10 moi 0.523 0.292 0.307 0.026 8.5 379.6 0.522 0.291 378.3 398.7 0.596 0.337 438.1 adeno / shRNA negative 50 moi 0.546 0.306 0.244 0.055 22.5 397.8 0.403 0.218 283.4 316.3 0.385 0.206 267.8 adeno / shRNA negative 100 moi 0.444 0.243 0.243 0 0 315.9 0.445 0.244 0.254 0.015 5.7 317.2 325.9 0.479 0.265 344.5 human adeno / shRNA TGF-β1 5 moi 0.341 0.179 0.152 0.025 16.1 232.7 0.265 0.132 171.6 197.2 0.284 0.144 187.2 human adeno / shRNA TGF-β1 10 moi 0.218 0.103 0.098 0.004 4.5 133.9 0.208 0.097 126.1 127.4 0.203 0.094 122.2 human adeno / shRNA TGF-β1 50 moi 0.085 0.021 0.02 0.001 6.8 27.3 0.082 0.019 24.7 40.4 0.439 0.24 0.24 0 0 312 human adeno / shRNA TGF-β1 100 moi 0.046 -0.003 -0.003 0.004 128.5 -3.9 0.053 0.001 1.3 -4.3 0.039 -0.008 -10.4

1) dilution factor: multiply by 1.4 (human) the ratio of HEPES to neutralize after HCL addition to activate TGF-β1 in the medium

Ave: mean amount of secreted TGF-β1

Attach an electronic file to a sequence list

Claims (10)

A shRNA that suppresses the expression of TGF-β1 represented by SEQ ID NO: 4, using the nucleotide sequence represented by SEQ ID NO: 2 as a target sequence. delete An anticancer composition comprising the shRNA of claim 1 as an active ingredient. The recombinant expression vector expressing shRNA of claim 1. delete 5. The method of claim 4,
A recombinant expression vector comprising DNA comprising a top strand represented by SEQ ID NO: 7 and a bottom strand represented by SEQ ID NO: 8. 5. The method of claim 4,
A recombinant expression vector obtained by recombining DNA into a vector containing a U6 promoter. 5. The method of claim 4,
Recombinant expression vector pSP72 / E3-shTGF-β1 represented by the cleavage map of FIG. An anticancer composition comprising the recombinant expression vector of claim 4 as an active ingredient. Adenovirus introduced with a recombinant expression vector of claim 4.

Images