KR101282331B1 - Production of D-allose by a novel ribose-5-phosphate isomerase or mutant thereof - Google Patents

Abstract

The present invention relates to a novel ribose-5-phosphate isomerase or a mutant enzyme thereof and a method for producing di-allose using the enzyme, and more specifically, to ribose-5-phosphate isomerase. Recombinant expression vector containing 5-phosphate isomerase or its mutant enzyme and its gene, microorganism transformed therefrom and a method for producing a large amount of ribose-5-phosphate isomerase mutant using them and the ribose It relates to a production method for obtaining di-allose in high yield using -5-phosphate isomerase or a mutant thereof.

Description

Production of D-allose by a novel ribose-5-phosphate isomerase or mutant according to novel ribose-6-phosphate isomerase or a mutant thereof

The present invention relates to a novel ribose-5-phosphate isomerase or a mutant enzyme thereof and a method for preparing di-allose using the enzyme, and more specifically, ribose-5-phosphate isomerase. A recombinant expression vector comprising a 5-phosphate isomerase or a mutant enzyme thereof and a gene thereof, a microorganism transformed therefrom, and a method for producing a large amount of ribose-5-phosphate isomerase or a mutant thereof using the same; The present invention relates to a production method for obtaining di-allose in high yield using ribose-5-phosphate isomerase or a mutant thereof.

Allose is the third carbon epimer of glucose (D-glucose) and is known as a rare monosaccharide which is an isomer of psocose. Such allose is used as an anticancer substance because it has a property of inhibiting the proliferation of cancer cells, and may also be used as a long-term preservative because it also has a function of inhibiting organ damage caused by ischemic action. In addition, allose is reported to exhibit the function of inhibiting the formation of segmented neutrophil leukocytes as well as inhibiting platelet reduction. Thus, allose is one of the rare saccharides currently of great medical attention (Hossain, MA, Izuishi, K., and H., Maeta. 2003, J. Hepatobiliary Pancreat Surg ., 10: 218225 .; Hossain, MA, Izuishi, K., Tokuda, M., Izumori, K., and H. Maeta. 2004, J. Hepatobiliary Pancreat Surg ., 11: 181189 .; Hossain, MA, Wakabayashi, H., Izuishi, K., Okano, K., Yachida, S., Tokuda, M., Izumori, K., and H., Maeta. 2006, J. Biosci . Bioeng ., 101: 369371.)

Although allos is highly valuable in the pharmaceutical industry, there is only a very small amount in the natural world, so it is necessary to secure a sufficient amount of allos to be effectively supplied to the medical application. In addition, until now, allose has been produced mainly by chemical synthesis. However, the chemical synthesis of allose has several serious problems in its production process. Indeed, there are risks in the working environment that require high temperatures and pressures, the formation of additional sugars after chemical reactions, the resulting separation and purification of complex allos, and environmental pollution from the chemical wastes generated.

In order to solve this problem, a production method for obtaining a high yield of biologically high allose using an enzyme produced by a microorganism as a method capable of producing a large amount of specific sugars with high environmental friendliness and specificity has been recently attempted. come. Specifically, the Izumori group of Kagawa University, Japan, studied the biological production method of allos. Here we report for the first time to produce seen from Los psicose using Pseudomonas shoe cherry (Pseudomonas stutzeri) a rhamnose isomerase (L-rhamnose isomerase) derived from the strain. However, since the rhamnose isomerase also produces a large amount of D-altrose as a by-product of allose production, there is a disadvantage in that metal ions must be added in this process.

Therefore, the present inventors have attempted to isolate an enzyme capable of producing allose without producing by-products such as altrose and without requiring addition of metal ions. For reference, the gene of ribose-5-phosphate isomerase is already known as an enzyme that converts ribose to ribulose in the phosphate metabolic circuit, and is also involved in allose metabolism in various microorganisms. It is reported to be involved.

We first identified that ribose-5-phosphate isomerase, which is found in various microorganisms, can produce D-allose from D-psicose and then crosstridium Recombinant expression vectors containing the ribose-5-phosphate isomerase gene derived from the thermocell ( Clostridium thermocellum ) and microorganisms transformed therefrom are constructed, and ribose-5-phosphate isomerase is prepared in large quantities using these. The present invention was successfully completed by investigating the optimum reaction conditions (temperature, pH, and substrate concentration, etc.) in which only allos was obtained in high yield without the formation of by-products and the addition of metal ions. , C., Yeom, S., Kim, H., Lee, S., Lee, J., Kim, S., and D., Oh. 2007, Characterization of ribose-5-phosphate isomerase of Clostridium thermocellum producing D -allose from D-psicose.Biotechnology letters., 29: 13871391). However, D-known former temperament Los producing D-Boys Cross Tree Stadium Course Thermocell ( Clostridium Since it is not the original substrate of the ribose-5-phosphate isomerase derived from thermocellum ), the enzyme activity is limited compared to the activity on the original substrate. Therefore, in order to overcome this, it is urgent to develop an economical biological method that is more productive by developing an enzyme having a high activity for the conversion of di-cyclos to di-allose.

SUMMARY OF THE INVENTION The present invention has been made in view of the above problems and the above-mentioned necessity, and an object of the present invention is to provide novel ribose-5-phosphate isomerase and mutant enzyme.

Still another object of the present invention is to provide a method for preparing the ribose-5-phosphate isomerase and mutant enzyme.

It is still another object of the present invention to provide a method for preparing high yield of di-allose.

In order to achieve the above object, the present invention provides ribose-5-phosphate isomerase described in SEQ ID NO: 1.

The present invention also provides an R132E mutant ribose-5-phosphate isomerase obtained by converting the amino acid of residue 132 of the ribose-5-phosphate isomerase of the present invention from arginine (Arg) to glutamic acid (Glu).

The present invention also provides a gene encoding the wild-type ribose-5-phosphate isomerase of the present invention.

In one embodiment of the present invention, the wild type gene preferably has a nucleotide sequence set forth in SEQ ID NO: 2, but is not limited thereto.

The present invention also provides a gene encoding the mutant ribose-5-phosphate isomerase of the present invention. In one embodiment of the present invention, the gene is preferably a gene having a nucleotide sequence set forth in SEQ ID NO: 2, but is not limited thereto.

The present invention also provides a recombinant expression vector pET28 (a) / ribose-5-phosphate isomerase comprising the ribose-5-phosphate isomerase gene of the present invention.

In one embodiment of the invention, the recombinant expression vector preferably has a cleavage map described in Figure 8 is not limited thereto.

In addition, the present invention a) preparing an expression vector comprising the gene of the present invention;

       b) culturing the microorganism transformed with the expression vector; c) providing a method for producing a ribose-5-phosphate isomerase mutant of the present invention comprising the step of separating the ribose-5-phosphate isomerase from the microorganism.

The present invention also provides a method for producing allose using the ribose-5-phosphate isomerase mutant of the present invention.

In one embodiment of the present invention, the allose is D-allose (D-allose), preferably produced using D-psicose (D-psicose) as a substrate, but is not limited thereto.

In another aspect, the present invention provides a composition for producing allose comprising the ribose-5-phosphate isomerase mutant of the present invention.

Hereinafter, the present invention will be described.

The present inventors have made diligent efforts to develop a method for more effectively producing allose using ribose-5-phosphate isomerase, resulting in high temperature bacteria, crosstridium. It was confirmed that a large amount of the ribose-5-phosphate isomerase gene derived from the thermocell strain was produced and produced in a high yield without producing by-products by this environmentally friendly process. - is a substituted mutant enzyme to a specific amino acid sequence with other amino acids of the phosphate isomerase said cross tree Stadium The present invention was completed by confirming that it is a di- allose producing enzyme that surpasses ribose-5-phosphate isomerase derived from a thermocell strain.

Hereinafter, the present invention will be described in detail.

Ribose-5-phosphate isomerase of the present invention is characterized by having the amino acid sequence represented by SEQ ID NO: 1. In addition, in the amino acid sequence of SEQ ID NO: 1, at least one variant of deletion, substitution and addition of one or more amino acids is introduced within a range in which the enzyme activity of the present invention indicated by the protein having these amino acid sequences is not impaired. The modified ribose-5-phosphate isomerase is also included in the ribose-5-phosphate isomerase of the present invention, and the most representative example thereof is the amino acid of residue 132 of the ribose-5-phosphate isomerase of the present invention. It is an R132E mutant that is converted from Arg to glutamic acid (Glu).

In addition, the present invention includes a ribose-5-phosphate isomerase gene encoding a ribose-5-phosphate isomerase having an amino acid sequence of SEQ ID NO: 1, wherein the nucleotide sequence of SEQ ID NO: 1 is obtained by mutation. The variant ribose-5-phosphate isomerase gene encoding one variant ribose-5-phosphate isomerase is also included in the ribose-5-phosphate isomerase gene of the present invention, and the most representative example thereof is the amino acid sequence of SEQ ID NO: 2. to be.

In addition, the present invention includes a recombinant vector containing the ribose-5-phosphate isomerase gene, and a transformant transformed by the recombinant vector. The present invention also includes a method for producing ribose-5-phosphate isomerase, wherein the transformant is cultured to separate ribose-5-phosphate isomerase from the obtained culture.

Ribose-5-phosphate isomerase gene of the present invention is crosstridium It is isolated from the strain Clostridium thermocellum . First, cross-tree Stadium with Lai boss-5-phosphate isomerase gene Thermocell ( Clostridium thermocellum ) to obtain chromosomal DNA. Next, using the designed oligonucleotide as a primer, G. crosstridium Thermocell ( Clostridium The polymerase chain reaction (PCR) is performed using the chromosomal DNA of the thermocellum strain as a template to partially amplify the ribose-5-phosphate isomerase gene. The PCR amplification fragment thus obtained was crosstridium Thermocell ( Clostridium thermocellum ) A fragment having a homology close to 100% of the ribose-5-phosphate isomerase gene of the thermocellum strain, and a high S / N ratio can be expected as a probe when colony hybridization is performed, and a hybridization test is performed. It facilitates stringency control. The PCR amplification fragments are labeled with appropriate reagents, and colony hybridization is performed on the chromosomal DNA library to select ribose-5-phosphate isomerase gene (Current Protocols in Molecular Biology, Vol. 1, 603). Page, 1994).

The DNA fragment containing the ribose-5-phosphate isomerase gene was recovered by recovering the plasmid from the Escherichia coli selected by the above method using the alkaline method (Current Protocols in Molecular Biology, Vol. 1, p. 161, 1994). You can get it. After the nucleotide sequence is determined by the above method, it is possible to obtain the entire gene of the present invention by hybridizing with the DNA fragment prepared by digestion of the DNA fragment having the nucleotide sequence with a restriction enzyme as a probe.

The transformed microorganism of the present invention is obtained by introducing the recombinant vector of the present invention into a host suitable for the expression vector used when producing the recombinant vector. For example, when a bacterium such as E. coli is used as a host, the recombinant vector according to the present invention is capable of autonomous replication in the host, and at the same time, a DNA containing a promoter, ribose-5-phosphate isomerase gene, and It is preferred to have a configuration necessary for the expression of the transcription termination sequence. As the expression vector used in the present invention, pET 28a (+) was used, but any expression vector satisfying the above requirements can be used.

Production of the ribose-5-phosphate isomerase mutant according to the present invention comprises culturing a transformant obtained by transforming a host with a recombinant vector having a gene encoding the same, and culturing the culture (cultured cell or culture supernatant). It is performed by generating and accumulating ribose-5-phosphate isomerase, which is a gene product, in the genus, and obtaining the enzyme from the culture.

The acquisition and purification of ribose-5-phosphate isomerase of the present invention is performed by centrifuging the cells or supernatants from the cultures obtained, and performing cell disruption, affinity chromatography, cation or anion exchange chromatography alone. Or it can carry out by combining.

The present invention crosstridium Thermocell ( Clostridium thermocellum ), a recombinant expression vector comprising ribose-5-phosphate isomerase or a mutant thereof and its gene, a microorganism transformed therefrom, and a method for obtaining a large amount of ribose-5-phosphate isomerase using them, And it is effective to provide a production method for obtaining the high yield of el- allose using the ribose-5-phosphate isomerase.

From a cross-tree Stadium Thermo selreom (Clostridium thermocellum) bacteria of the present invention lie boss-5-phosphate isomerase or its mutants as anti-cancer substances and ischemic action due to its inhibition of the proliferation characteristics of cells with high specificity and environmentally-friendly way Di-allose, which is a raw material of a medicine having a function of suppressing long-term damage due to it, can be produced in high yield, and the produced di-allose can be usefully used as a starting material for synthesis of various medicines.

Figure 1 shows the comparison of the enzyme activity according to the pH of the ribose-5-phosphate isomerase and R132E mutase of the present invention (○: potassium phosphate buffer-wild type enzyme ●: Tris-HCl buffer-wild-type enzyme; □ : Potassium phosphate buffer-R132E mutase; ■: Tris-HCl-R132E mutase)
Figure 2 shows the comparison of the enzyme activity according to the temperature of the ribose-5-phosphate isomerase and R132E mutase of the present invention. (●: wild type enzyme; ■: R132E mutant)
Figure 3 shows the results of measuring stability according to the temperature of the ribose-5-phosphate isomerase of the present invention (●: 55 ℃;: 60 ℃; ▲: 70 ℃; △: 75 ℃; ■: 80 ℃; and □: 85 ° C.).
Figure 4 shows the stability measurement results of the temperature of the ribose-5-phosphate isomerase R132E mutase of the present invention (●: 55 ℃;: 60 ℃; ▲: 70 ℃; △: 75 ℃; ■: 80 ° C. and □: 85 ° C.).
Figure 5 shows the conversion of allose by the ribose-5-phosphate isomerase (○) and R132E mutase (●) of the present invention at a substrate concentration of 10mM.
Figure 6 shows the amino acid sequence of the ribose-5-phosphate isomerase of the present invention.
Figure 7 shows the amino acid sequence of the R132E mutant enzyme of the ribose-5-phosphate isomerase of the present invention.
8 shows a vector sequence map of pET28a (+) / ribose-5-phosphate isomerase of the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example 1 Preparation of Recombinant Expression Vectors and Transgenic Microorganisms Comprising Ribose-5-Phosphate Isomerase Gene and Mutations

For the production of Rye boss-5-phosphate isomerase, cross-tree Stadium Ribose- 5-phosphate isomerase derived from a Clostridium thermocellum strain was first isolated.

Specifically, cross-tree Stadium with a gene sequence and amino acid sequence has already been specified Thermocell ( Clostridium thermocellum ) strains were selected and the following primers were devised based on the well-known DNA sequence (Genebank Accession Number ZP 00503831) of the ribose-5-phosphate isomerase derived therefrom.

Ribose-5-Phosphate Isomerase

SEQ ID NO: 16 (Forward primer): 5'-TTT CATATG AAAATTGGAATTGGAAGCGACC-3 '

SEQ ID NO: 17 (Reverse primer): 5'-TTT CTCGAG CTATTTGCTGTATTTTTTTTCAAT-3 '

The primers of the ribose-5-phosphate isomerase gene were designed with NdeI - XhoI restriction enzyme cleavage portion. PCR was performed using the primers to amplify the nucleotide sequence of the gene. A large amount of ribose-5-phosphate isomerase gene was inserted into the plasmid vector pET-28a (+) (Invitrogen) using respective restriction enzymes, and the pET-28a (+) / ribose-5-phosphate isomerase. Was produced.

Primers were designed to construct a mutant vector of ribose-5-phosphate isomerase (see Table 1). Mutation was induced using the primers and the Quick-Change kit (Stratagene, Beverly, MA) to prepare a pET 28 (+) a / ribose-5-phosphate isomerase mutant vector.

The recombinant expression vector thus obtained was transformed into E. coli ER 2566 strain by a conventional transformation method. In addition, the transformed microorganisms were stored frozen before the incubation for the production of allose by the addition of 20% glycerin (glycerine) solution.

Mutant enzyme primer R132A F: CTGAGTTCCAGGGAGGAGCACATGCCACCAGGG (SEQ ID NO: 4)
R: CCCTGGTGGCATGTGCTCCTCCCTGGAACTCAG (SEQ ID NO: 5) R132I F: GAGTTCCAGGGAGGAATACATGCCACCAGG (SEQ ID NO: 6)
R: CCTGGTGGCATGTATTCCTCCCTGGAACTC (SEQ ID NO: 7) R132Q F: CTGAGTTCCAGGGAGGACAGCATGCCACCAGGG (SEQ ID NO: 8)
R: CCCTGGTGGCATGCTGTCCTCCCTGGAACTCAG (SEQ ID NO: 9) R132K F: CTGAGTTCCAGGGAGGAAAGCATGCCACCAGGG (SEQ ID NO: 10)
R: CCCTGGTGGCATGCTTTCCTCCCTGGAACTCAG (SEQ ID NO: 11) R132E F: CTGAGTTCCAGGGAGGAGAGCATGCCACCAGGG (SEQ ID NO: 12)
R: CCCTGGTGGCATGCTCTCCTCCCTGGAACTCAG (SEQ ID NO: 13) R132D F: CTGAGTTCCAGGGAGGAGATCATGCCACCAGGGTTGG (SEQ ID NO: 14)
R: CCAACCCTGGTGGCATGATCTCCTCCCTGGAACTCAG (SEQ ID NO: 15)

Example  2: Ribose -5-phosphate Isomerase and  Preparation of Mutant Enzymes

For mass production of ribose-5-phosphate isomerase and mutant enzyme, the recombinant E. coli ER 2566 strain prepared in Example 1 above was inoculated into a test tube containing 3 ml of LB medium and 600 The spawn culture was performed with a shake incubator at 37 ° C. until the absorbance at 2.0 was 2.0. The seed cultured culture was then added to a 2,000 ml flask containing 500 ml of LB medium to carry out the main culture.

In addition, when the absorbance at 600 nm became 0.6, 0.1 mM IPTG was added to induce mass expression of ribose-5-phosphate isomerase. The stirring rate during the process was adjusted to 200rpm, the culture temperature was maintained at 37 ℃, and after the addition of IPTG, the stirring rate was adjusted to 150rpm, the culture temperature was adjusted to 16 ℃.

In addition, the ribose-5-phosphate isomerase produced as overexpressed as described above was centrifuged at 6,000 × g for 30 minutes at 6,000 × g, and washed twice with 0.85% sodium chloride (NaCl). The cell solution was then crushed by adding 50 mM sodium phosphate, 300 mM sodium chloride, 10 mM imidazole, 0.1 mM protease inhibitor (phenylmethylsulfonyl fluoride). The cell lysate was again centrifuged at 13,000 × g for 20 minutes at 4 ° C., the cell pellet was removed, and only the cell supernatant was obtained, followed by a fast protein liquid chromatography system (Bio-Rad Laboratories, Hercules, CA, USA). ) Was equipped with a HisTrap HP adsorption column using a heat-tag and separated as an enzyme solution used for allose production.

Example  3: pH  And the temperature Ribose -5-phosphate isomerase and mutant enzyme activity

The activity according to pH and temperature changes of the ribose-5-phosphate isomerase and the mutant isolated in Example 2 was confirmed as follows. Enzymes and substrates were reacted under various pH and temperature conditions and enzyme activities were compared.

3-1: pH end Ribose Effect of -5-phosphate Isomerase and Mutant Enzymes

To investigate the pH effect on the enzymes, 50 mM Tris-HCl buffer ranged from pH 6.0 to 7.0 using 50 mM potassium phosphate buffer containing 10 mM di-cyclos, 0.5 mg / ml enzyme as substrate. The enzyme reaction was carried out using pH from 7.0 to 9.0. Specifically, the enzymatic reaction was carried out at 80 ° C. for 5 minutes and the reaction was stopped again by adding a final concentration of 200 mM hydrogen chloride. As a result, as shown in Figure 1, the optimum pH of the ribose-5-phosphate isomerase and mutant enzyme was found to be 7.5.

3-2: the temperature Ribose Effect of -5-phosphate Isomerase and Mutant Enzymes

In order to investigate the temperature effect on the enzymes, the enzyme reaction was carried out using 50 mM Tris-HCl buffer, pH 7.5 containing 10 mM di-cyclos and 0.5 mg / ml enzyme, ranging from 60 ° C to 90 ° C. Each reaction was carried out for 5 minutes. The reaction was then stopped by adding a final concentration of 200 mM hydrogen chloride.

As a result, as shown in Figure 2, the optimum temperature of the ribose-5-phosphate isomerase and mutant enzyme was found to be 80 ℃.

In addition, the concentrations of alloses and sicoses and other sugars in the determination of enzymatic activity can be analyzed using a Bio-LC (Bio-LC) system equipped with an electrochemical detector and a CarboPacPA column. Dionex ICS-3000, Sunnylvale, Calif., USA), wherein the Carbopack PA column was passed 200 mM sodium hydroxide (NaOH) at 1 ° C./min at 30 ° C.

Example 4: Temperature stability investigation of ribose -5-phosphate isomerase and mutant enzyme

To investigate the temperature stability of ribose-5-phosphate isomerase and mutant enzyme, 50 mM Tris-HCl at pH 7.5 with 10 mM cyclose, 0.5 mg / ml enzyme in the temperature range of 55 ° C. to 80 ° C. The reaction was carried out using a buffer until the time when the enzyme activity was reduced by half. After the reaction was completed, the reaction was stopped by adding a final concentration of 200 mM hydrogen chloride, and the activity of ribose-5-phosphate isomerase enzyme was measured.

Figure 3 and Figure 4 shows the results of temperature stability measurement of ribose-5-phosphate isomerase and mutant enzyme of the present invention. In the graph above, the temperature notation is 55 ° C., 60 ° C., 65 ° C., 70 ° C., 75 ° C., 80 ° C., 80 ° C., and 85 ° C., respectively. Respectively.

As a result, as shown in Figure 3, the ribose-5 phosphate isomerase is 15 hours at 55 ℃, 60 ℃ 10 hours, 65 ℃ 6.6 hours, 70 ℃ 3.5 hours, 75 ℃ 1.2 hours, and 80 At 0.5 ° C., it was confirmed that the enzyme activity was halved after 0.5 hours. In contrast, as shown in Figure 4, the R132E mutant enzyme is 21 hours at 55 ° C, 13 hours at 60 ° C, 8.3 hours at 65 ° C, 5.1 hours at 70 ° C, 2.6 hours at 75 ° C, and 0.8 hours at 80 ° C. As time passes, it was confirmed that the enzyme activity was reduced by half. It was confirmed that the R132E mutant enzyme has a better temperature stability than the wild type enzyme of ribose-5-phosphate isomerase.

Example  5: Ribose Di-phosphate Isomerase and Mutant Enzymes To Psychos  About specific activity  And kinetic parameter

Experiments were carried out to measure and compare the specific activity of ribose-5-phosphate isomerase and mutant enzymes against di-cos.

The enzyme reaction was performed for 5 minutes at 80 ° C using 50 mM Tris-HCl buffer solution (pH 7.5) containing 10 mM di-cyclos, and the reaction was stopped again by adding a final concentration of 200 mM hydrogen chloride. I was. In the present invention, the enzyme activity was measured by using a di-cyclos as a substrate, and the enzyme activity of 1 unit (unit) of the enzyme activity was defined as the amount to produce 1 nmole of allose per minute at pH 7.5 and 80 ° C. Was made smoothly. In addition, the analysis of allose and sicose concentrations and other sugars in the measurement of enzyme activity was carried out using a bio-liquid chromatography (Bio-LC) system equipped with an electrochemical detector and a CarboPacPA column. Dionex ICS-3000, Sunnylvale, CA). At this time, the CarboPacPA column was allowed to pass 200 mM sodium hydroxide at 30 ° C. at a rate of 1 ml / min.

As a result, it was confirmed that the activity of R-13E mutant enzyme increased 1.3-fold when using di-cyclos as a substrate compared to wild enzyme. As a result of the kinetic experiment, it was confirmed that R132E mutant enzyme was increased 1.5 times as 64 mM ^-1 s ^{- 1} compared to wild enzyme with 44 mM ^-1 s ^{- 1} catalytic efficiency. This was confirmed to be the highest value of the enzyme reaction for di-allose conversion in di-cyclos to date (see Table 2).

Specific activity (U / mg) K _m (mM) k _cat (s ¹ ) k _cat / K _m (mM ¹ s ¹ ) Wild 1037 ± 26 53 ± 2 2347 ± 117 44 ± 2.6 R132A 1163 ± 35 56 ± 1 2580 ± 129 46 ± 3.0 R132Q 1028 ± 17 54 ± 2 2335 ± 58 43 ± 1.6 R132I 987 ± 4 78 ± 3 2211 ± 52 28 ± 1.1 R132K 929 ± 5 52 ± 2 1962 ± 46 38 ± 1.4 R132D 1207 ± 34 46 ± 2 2674 ± 63 58 ± 2.2 R132E 1335 ± 24 43 ± 1 2743 ± 64 64 ± 2.4

Table 2 shows the specific activity and kinetic parameters of the ribose-5-phosphate isomerase and its mutant de-cyclos.

Example 6 Comparison of Di-Allose Conversion from Di-Cycos using Ribose-5-Phosphate Isomerase and Mutant Enzymes

To develop a method for the production of allose using ribose-5-phosphate isomerase and mutant enzyme, 10 mM PSY at the temperature (65 ° C) considering the optimum pH 7.5 and the time when the enzyme activity was reduced by half With the course, the hourly production of allose was measured.

As a result, it was confirmed that after 80 minutes of reaction, the conversion rate of 10 mM cyclose to allos was 25% for wild enzyme and 32% for R132E mutant enzyme (see FIG. 5). It was confirmed that the highest productivity during production of allose up to now was ribose-5-phosphate isomerase derived from the crosstridium thermocell strain, but the mutant R132E mutant enzyme showed higher activity. Could. This is the R132E mutant enzyme that is a di- allose producing enzyme that surpasses ribose-5-phosphate isomerase derived from the circosedium thermocelum strain with the highest productivity and production concentration in the reported biological di- allose production. Indicates.

Having described specific portions of the present invention in detail, those skilled in the art will appreciate that these specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Attach an electronic file to a sequence list

Claims (12)

Obtained DNA from a Clostridium thermocellum strain, using a primer of SEQ ID NO: 16 (5'-TTTCATATGAAAATTGGAATTGGAAGCGACC-3 ') and SEQ ID NO: 17 (5'-TTTCTCGAGCTATTTGCTGTATTTTTTTTCAAT-3'), PCR Ribose-5-phosphate isomerase obtained by amplifying the nucleotide sequence of the gene and inserting the gene into the plasmid vector to prepare an expression vector. (Dibose-5-phosphate isomerase) using a 10mM di-cyclos as a substrate to a pH of 7.5, 65 ℃ comprising the step of producing a di- allose.
delete delete delete delete delete delete delete delete delete delete delete

Images