KR101277749B1 - Analysis of the purity of honey, using pollen mixed in honey - Google Patents

Abstract

The present invention relates to a mixed pollen assay for honey purity analysis.
Mixed pot analysis method for honey purity analysis of the present invention is the first step to prepare a pollen analysis tool for purity and mixing form analysis of honey and the mixed pots mixed in the honey of the purity and mixing form analysis target to the pollen analysis tool And a second step of analyzing the purity and incorporation state of the honey by determining the properties to appear.
According to the present invention, there is provided a method capable of analyzing the purity and mixing state of honey by analyzing the mixed pollen of honey collected from a single mill source.

Description

ANALYSIS OF THE PURITY OF HONEY, USING POLLEN MIXED IN HONEY}

The present invention relates to a mixed pot analysis method for analyzing the purity of honey, and more particularly, to a method for analyzing the purity and mixing state of honey by analyzing the mixed pollen of honey collected from a specific wheat source.

The research on how to judge the authenticity of honey and quality assessment has been studied by many scientists for a long time. The most commonly applied method is a study on the method of using the composition of sugar, which is the main component of honey. The composition of sugar, which is the main component of honey, is mainly composed of fructose and glucose. Sucrose is added in small amounts while it is 70-80% of the total.

Therefore, when sugar is added to honey, sugar can be easily detected. However, when an acid hydrolyzate is added to the sugar liquid to artificially lower the sugar, it is difficult to discriminate only by the composition of the sugar. In order to overcome this problem, the color reaction by the resorcinol (Fieche) or the aniline (Feder) method for detecting acid hydrolysis has been intensively studied.

This method uses the principle of color reaction with hydroxymethylfurfural-HMF produced by acid hydrolysis of sugar.

However, hydroxymethylfurfural (Hydroxy-methylfurfural-HMF) is produced by acid hydrolysis, but its concentration is high depending on the type of wheat source, such as chestnut honey, when honey is stored for a long time. Is not practical.

In addition, recently, biotechnological methods have been introduced to develop hydrolysis using enzymes, and from the early 1970s, enzymes that convert glucose, such as glucose isomerase, to fructose are used. There is a case of producing high fructose corn syrup (HFCS) and incorporating it into honey. The composition of these sugars is composed of 42% of fructose and 52% of glucose, which is very similar to the sugar composition of honey. When added, it is impossible to determine whether the sugar is mixed even if the sugar composition is analyzed by HPLC.

In addition, the method of quality evaluation of honey by the composition of the fragrance of honey, the method of determining the incorporation by measuring the sodium / potassium ratio (Na / K) by measuring the mineral content of honey, the method of measuring the titer of enzyme, etc. Although there are branches, each of these methods has a problem of being applied as a quality evaluation method in consideration of the diversity of honey sources, the taxonomic classification of bees, seasonal factors, and regional differences.

For this reason, carbon isotope determination, which is widely used in food chemistry recently, takes two different paths when plants fix carbon in the atmosphere by photosynthesis, and plant groups belonging to these two classes are fixed by carbon assimilation. ^The ratio of ¹² C and ¹³ C is different, so analyzing their stored energy makes it possible to identify the plant group as the source.

This fact indicates that all the plants that produce honey belong to the C ₃ group, while sugar and corn, which are commonly incorporated in honey, and sugarcane and corn, which are the raw materials of HFCS, belong to the C ₄ group, and the carbon sources derived from them, despite any physical treatment, It has a constant ¹³ C value.

Therefore, carbon isotope analysis, a new analytical method that estimates the source of sugar by measuring the carbon isotope ratio of honey, has been used as a method for evaluating the quality of honey.

However, this technique uses sugar beet sugar to produce fake honey, so sugar beet is a C ₃ plant, so sugar made from sugar beet is indistinguishable from honey secreted from flowers with carbon isotope levels. The method of mixing was tacitly indistinguishable from the good honey in the market, and this technical blind spot was used to provide a cure for fake or poor honey in the market.

In fact, in the case of honey, the representative single honey is acacia, and in the case of chestnut honey, the carbon isotope ratio ( ¹³ C / ¹² C) is measured to be less than -23.5 ‰ (-23.0 ‰ ~ -28.1 ‰). It is mostly measured below 22.5 ‰ (-23.0 ‰ ~ -26.0 ‰). When honey is produced using sugar beet sugar, it is measured in the range similar to that of honey (-23 ‰ ~ -27 ‰). Isomerized sugars, molasses and sugar cane sugars, which are measured in the range of -9.0 ‰ to -11.0 ‰, are also incomplete in analyzing the purity of honey by carbon isotopes, resulting in relative losses to farmers producing good honey. This fact influenced the public's credibility of honey.

The object of the present invention is to develop a technology for analyzing the purity of honey, which accounts for most of the income of bee farms, and to seek for income stabilization of healthy bee farms by restoring the trust of honey to the honey market through securing honey market transparency. It aims to establish a foundation for the development of the domestic beekeeping industry by laying the foundation for global brand development through the high quality of Milwon honey.

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not intended to limit the invention to the particular embodiments that are described. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not restrictive of the invention, There will be.

Mixed pollen analysis for honey purity analysis of the present invention for achieving the above object is the first step to prepare a pollen analysis tool for purity and mixing form analysis of honey and the mixed pollen mixed in the honey of the purity and mixing form analysis target It comprises a second step of analyzing the purity and mixing state of the honey by determining the properties appearing applied to the pollen analysis tool.

At this time, the pollen analysis tool is to prepare a density gradient layer distinguished by the position of the band by the density of the pollen, and also to prepare a series of analysis tools to measure the protein concentration by measuring the content of the pollen. Furthermore, a series of pollen analysis tools PCR amplify the separated pollen genomic DNA with specific primers, and perform genetic verification to add a process to determine the type of honey by analyzing the position and size of major bands.

The mixed powder is characterized in that it is obtained by centrifuging the diluted honey, preferably centrifuged for 0.5 to 1 hour at 12,000 ~ 14,000rpm and is obtained by removing the supernatant. At this time, the content of honey is applied by diluting the same amount of honey, and it is possible to check the authenticity of the mixed honey to pure honey by analyzing the type and content of pollen in the same honey through protein concentration measurement.

In the first step, the pollen analysis tool may first determine the type of pollen through the pattern of the pollen analysis strip.

The pattern of the pollen analysis strip is formed by gathering the pollen in any one or more layers of the sucrose layer stacked on each other in the order of density, the sucrose layer is preferably stacked in the order of 10% lower concentration.

The pollen is gathered in the sucrose layer by centrifugation to form a pattern of the pollen analysis strip, preferably centrifugation for 2 to 4 hours at 0 ~ 10 ℃, 30,000 ~ 34,000rpm.

In addition, in the first step, the pollen analysis tool has a feature that can determine the content of a specific honey in the total content of the same honey through protein analysis of the pollen forming a specific band in the density gradient sucrose layer band centrifuged. .

The analytical solutions are prepared by pulverizing a single component in a crude protein state, adding an indicator to a protein solution produced by mixing a standard protein and physiological saline, and diluting it at a concentration difference.

In addition, the pollen analysis tool may be made by displaying the type of pollen through the protein gene pattern of the pollen, the protein gene pattern through the PCR using the Rop26sF (CCAGAAGCTGGGTCAGGTGCCC) primer and Rop26sR (GGACCAGATCCCCAGAAGCTG) primer as Forward and Reverse Amplify and confirm the location and size of the major band through electrophoresis.

As described above, the development of honey purity and incorporation analysis technology through the analysis of mixed pollen of single wheat honey according to the present invention induces honey market stabilization, which is the most important part of the beekeeping industry, and the production of solid fake honey and It can be used to establish standards for honey quality control by preventing distribution, contributing to stabilizing bee farm production and restoring consumer confidence in honey and contributing to the development of the ultimate bee farm and industry.

1 is a view showing a honey ultracentrifugation for honey mixed pollen analysis of the present invention.
Figure 2a is a view showing the purity analysis results of the mixed pots for the Akashi tree honey separated using the method of FIG.
Figure 2b is a view showing the purity analysis results of the mixed pots for the cherry honey separated using the method of FIG.
Figure 2c is a view showing the purity analysis results of the mixed pots for the chestnut honey separated using the method of FIG.
Figure 3 is a diagram showing a grading model using the honey incorporation pollen protein quantification technology of the present invention. At this time, the absorbance of each protein content can be applied to represent a protein standard curve (Protein standard curve).
Figure 4 is a diagram showing a primer set for genomic DNA PCR of honey incorporation.
5 is a view showing through the genetic verification method of the pollen separated in FIG.
1: 1st layer pollen mixed with Akashi honey
2: 2nd layer pot with Akashi honey
3: 3rd layer pot with Akashi honey
4: cherry flower pot
5: Sakura honey mixed pot

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will now be described in detail with reference to the accompanying drawings.

The present invention is to prepare a pollen analysis tool for analyzing the purity and mixing form of honey as a mixed pollen analysis method for analyzing the purity and mixing state of honey, and then apply the mixed pollen mixed in the honey of the purity and mixing form analysis target to the pollen analysis tool It provides a method for analyzing the purity and mixing state of the honey by determining the properties appearing.

The honey is extracted from one wheat source, and is commonly referred to as acacia nectar, cherry honey, chestnut honey, and the like.

At this time, the purity of the honey is determined according to the degree of pollen content of a particular flower.

For example, Akashi ( Robinia pseudoacacia ) For honey, also called acacia honey, purity is determined by how much acacia pollen is contained.

Specifically, first, the mixing characteristics of the specific honey are distinguished through ultracentrifugation by the sucrose density gradient of pollen that is naturally mixed by honey in honey produced in a single wheat source.

First, the pollen analysis tool produces a pollen analysis tool that can display the type of pollen through the pattern of the pollen analysis band.

In other words, the pattern of pollen analysis band that can determine the type of pollen by determining the type of pollen by ultra-centrifugation after producing a sucrose 30% ~ 90% density from the bottom to the ultracentrifuge tube from the bottom To prepare a pollen analysis tool.

Then, the mixed flower pot mixed with honey is compared with the pollen analysis tool prepared as described above to determine the mixing property of the mixed flower pot.

In other words, the ultracentrifuge tube was produced by giving a density gradient of 30% to 90% from the bottom to the sucrose from the bottom, and the mixed pollen collected by centrifugation of the diluted honey was injected thereafter, followed by ultracentrifugation. It is possible to determine the type and purity of the pollen mixed by comparing the pattern of the analysis bands with the pattern of the pollen analysis bands generated by the pollen analysis tool.

Here, preferably, the mixed pot is obtained by centrifuging for 0.5 to 1 hour at 12,000 to 14,000 rpm in order to cleanly separate from honey.

In addition, the pattern of the pollen analysis band is to form a pattern of the pollen analysis band by the single flower pot or the mixed flower pot in the sucrose layer by centrifugal separation, 0 ~ 10 ℃, 30,000 ~ Centrifugation at 34,000 rpm for 2 to 4 hours is recommended.

Second, the present invention is to invent a grading technique using the purity difference of honey according to the concentration of color development by measuring the protein concentration of the mixed pollen in order to analyze the purity of the honey, the separated mixed pollen After pulverizing to a crude protein state, the Lowry method prepared a quantification and grading standard through the degree of color development according to the protein content.

For use as a pollen analysis tool, prepare analytical solutions that vary in color depending on the protein content of the pollen.

That is, the monohydrate is pulverized in the crude protein state, and then the indicator is added to the protein solution produced by mixing the standard protein and physiological saline, and then diluted with a difference in concentration to prepare different assay solutions.

Then, after mixing the mixed flower in the state of crude protein, the indicator solution is added to the protein solution produced by mixing the standard protein and physiological saline, and the color solution produced by comparing the pollen analysis tool with the difference in the content of pollen according to the color development Check the honey purity will be able to grade.

Third, the present invention is to apply the method of analyzing the genotype of the separated potted genome after PCR in order to increase the accuracy of the technique, the separated mixed pot is separated by genomic DNA specific As a result of PCR using primers, the method of assaying the type of wheat source is characterized by the difference in the result of amplification in each wheat source.

That is, the pollen analysis tool displays the type of a single pot through the pattern of the pollen analysis band, which shows the protein gene pattern of the pollen.

In particular, the protein gene pattern is specifically expressed through Rop26sF (CCAGAAGCTGGGTCAGGTGCCC) primer and Rop26sR (GGACCAGATCCCCAGAAGCTG) primer.

Then, the honey to be analyzed is diluted in water, centrifuged, and then the supernatant is removed, and water is added to the resultant admixture to prepare a solution containing the admixture and the DNA of the solution containing the admixture. After extraction, PCR was performed to express the protein gene pattern of the mixed pot.

By comparing the protein gene pattern thus expressed with the pattern of the pollen analysis tool and confirming the corresponding pattern, the honey species of the pollen analysis band can be accurately identified.

Next will be described in detail with reference to the drawings and tables with respect to the mixing potted analysis for honey purity and mixing form analysis according to a preferred embodiment of the present invention.

Sucrose solution having a density gradient was placed in an ultracentrifuge centrifuge tube in order to analyze the mixed pollen for pollen analysis as shown in FIG.

These sucrose solutions are made of 90%, 80%, 70%, 60%, 50%, 40% and 30% solutions, respectively, and sterilized for 15 minutes at 124 ° C. 30% of the layers.

The mixed pot of honey was diluted to 50% by adding 300 ml of honey to 300 ml of honey, and then diluted to 50% concentration. The mixture was centrifuged at 1,4000rpm and 4 ℃ for 30 minutes, and the supernatant was carefully discarded. 5 ml of sterile water was added to the pot to loosen the pots using a stirrer (voltex) evenly.

These pollen solutions were carefully added to the top of the prepared ultracentrifugation sucrose gradient tube, and then ultracentrifuged for 4 hours at 34,000 rpm and 4 ° C using an ultracentrifuge centrifuge. .

As shown in FIG. 2a, it was confirmed that each of the honey-separated honeys separated into three layers in the case of the acacia nectar.

As shown in FIG. 2B, the cherry honey forms two layers, but in the case of the cherry honey, the cherry blossom bloom is similar to the flowering of the rhododendron, so that some of the azalea pollen is added, but the pollen collected only from the cherry and the rhododendron flowers. As a result of ultracentrifugation, the purity of honey could be measured by forming a layer on different sites to separate the single flowerpot and measuring the concentration.

As shown in FIG. 2c, four honey pots form four pollen layers, each of which is identified as a chestnut pollen. Analysis of the mixed pollen of the single honey was able to easily identify pollen under an optical microscope (× 4000) without the genetic test for chestnut honey.

Therefore, in the present invention, it was composed of a form having a specificity as a result of confirming the separation form of different forms, which is the result of ultracentrifugation of each honey.

The invention for the protein concentration measurement for protein quantification of the single honey infusions shown in Figure 3 and the preparation of protein quantitative standard reagents using the same is collected by the ultracentrifugation in the ultracentrifugation tube to collect the honey infusions ultrasonography ( The sonicator was sonicated 5 times for 1 minute to uniformly crush the mixed flower.

The crushed mixed flower was subjected to protein quantification based on the lowry method.

1. The reagents used in the lowry method are as described above.

1) Protein Standard (BSA, Bovine Serum albumin): 1 mg / ml

2) Biuret reagent: 75 mmol / l cupric sulfate, 94 mmol / l sodium chloride, tartrate, iodide, carbonate

3) Folin-Ciocalteu reagent: 2.0 Normal

4) Unknown protein

5) Saline solution (Saline solution, 0.85%)

6) Absorbance Measurement: S-3130 (PDA UV-Vis Spectrophotometer)

7) LabPro ® Plus S / W

8) Cuvettes (10 mm light path)

2. Concentration of Protein Standard Solution

Reagent (ml) Test tube no. One 2 3 4 5 6 1mg / ml standard protein
(standard Protein, ml) - 0.05 0.1 0.15 0.2 - Incorporated Pollen Protein
(Ml) 0.2 Saline solution
(Saline Solution, ml) 0.2 0.15 0.1 0.5 - - density
(Concentration, mg / dl) 0 25 50 75 100

As shown in Table 1, a protein solution was prepared by mixing a standard protein and a saline solution, and 2.2 ml of biuret was added thereto, and the mixture was left at room temperature for 10 minutes.

After addition of 0.1 ml of Folin-Ciocalteu reagent, the solution was immediately mixed and then reacted at room temperature for 30 minutes in a quantification standard mode in which the measurement wavelength was set to 725 nm. Absorbance was measured within 1 hour from tube 1 to 5.

The absorbance of the measured entrained flower was measured to calculate the concentration.

The standard solution as shown in FIG. 3 was prepared by diluting in 10 steps based on the sample with the highest concentration among the concentration-measured solutions. The standard for measuring the protein content through the protein standard curve and the grade with the naked eye by measuring absorbance Made.

This is a colorimetric method for measuring the concentration of the mixed pollen can be easily grading according to the colorimetric concentration.

The primer for the analysis of the mixed pollen gene shown in FIG. 4 was made of Rop26sF consisting of 22 base sequences of which the base sequence of the forward primer ends with the three ends of the CCAGAAGCTGGGTCAGGTGCCC 5-terminal, and the reverse primer is the 5-terminal GGACCAGATCCCCAGAAGCTG three-terminal. It consists of a primer for PCR made of Rop26R consisting of 21 nucleotide sequences ending in.

The PCR for the mixed potted gene analysis shown in FIG. 5 was performed at 94 ° C for 5 minutes, 33 cycles (94 ° C for 1 minute, 50 ° C for 30 seconds, and 72 ° C for 45 seconds) and 72 ° C for 5 minutes, and the result was 1%. Electrophoresis was carried out using agarose DNA electrophoresis gel to examine the gene amplification of the inflorescences of Akashi tree honey and the cherry honey infusions.

As a result, in the case of Akash tree pollen, the same gene amplification form was shown in the three layers, and the gene amplification result of the cherry pollen showed the same form of gene amplification as the pollen separated from the flower.

However, the mixed flower pots of the Akashi tree honey and the cherry flower honey pots showed different types of gene amplification even though PCR was carried out under the same conditions with the same primers.

As a result, the primer set shown in FIG. 4 can determine the type of the potted plant by gene amplification PCR results of pollen DNA incorporated in each honey.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention as defined by the appended claims. It will be possible. The scope of the present invention is defined by the appended claims, and all differences within the scope of the claims are to be construed as being included in the present invention.

Claims (15)

A first step of preparing a pollen analysis tool for analyzing purity and mixing state of honey; And
Comprising a second step of analyzing the purity and mixing state of the honey by judging the characteristics appearing by applying the mixed pots mixed in the honey of the purity and mixing state analysis target to the pollen analysis tool,
Mixed pollen analysis for the purity and mixing of honey.
The method of claim 1,
The mixed pot is obtained by centrifuging the diluted honey,
Mixed pollen assay for the purity and mixing of honey.
The method of claim 2,
The admixture was obtained by centrifugation at 12,000-14,000 rpm for 0.5-1 hour and removing the supernatant,
Mixed pollen assay for the purity and mixing of honey.
The method of claim 1,
In the first step, the pollen analysis tool to determine the type of pollen through the pattern of the pollen analysis band,
Mixed pollen assay for the purity and mixing of honey.
5. The method of claim 4,
The pattern of the pollen analysis band is formed by gathering pollen in any one or more layers of sucrose layers stacked on each other in density order,
Mixed pollen assay for the purity and mixing of honey.
The method of claim 5,
The pollen is collected in the sucrose layer by centrifugation to form a pattern of the pollen analysis band,
Mixed pollen assay for the purity and mixing of honey.
The method according to claim 6,
The centrifugation is carried out for 2 to 4 hours at 0 ~ 10 ℃, 30,000 ~ 34,000rpm,
Mixed pollen assay for the purity and mixing of honey.
The method of claim 5,
The second step is the step of diluting the honey to be analyzed in water and then centrifuging to remove the supernatant and adding water to the resultant mixture to prepare a solution containing the mixture;
Injecting the solution containing the mixed powder into the sucrose layer and centrifuging to form a band of the mixed powder collected; And
Analyzing the pollen analysis tool that satisfies the pattern of the strip to analyze the purity and mixing state of honey;
Mixed pollen assay for the purity and mixing of honey.
The method of claim 1,
In the first step, the pollen analysis tool is characterized in that the analysis solution different in color development from each other,
Mixed pollen assay for the purity and mixing of honey.
10. The method of claim 9,
The analytical solutions are different in color from each other depending on the protein content of the pollen,
Mixed pollen assay for the purity and mixing of honey.
10. The method of claim 9,
The analytical solutions were prepared by pulverizing a single component in a crude protein state, and then diluting the solution with a concentration difference after adding an indicator to a protein solution produced by mixing standard protein and physiological saline.
Mixed pollen assay for the purity and mixing of honey.
10. The method of claim 9,
The second step is a step of diluting the honey to be analyzed in water and then centrifuging to remove the supernatant and to obtain the resulting mixed fraction;
Pulverizing the mixed powder in a crude protein state;
Mixing a standard protein and physiological saline to the pulverized admixture and adding an indicator to form a colored protein solution; And
Investigating the pollen analysis tool satisfying the colored protein solution to analyze the purity and mixing state of honey;
Mixed pollen assay for the purity and mixing of honey.
5. The method of claim 4,
The pollen analysis tool displays the type of pollen through the protein gene pattern of the pollen,
Mixed pollen assay for the purity and mixing of honey.
The method of claim 13,
The protein gene pattern is expressed through Rop26sF (CCAGAAGCTGGGTCAGGTGCCC) primer and Rop26sR (GGACCAGATCCCCAGAAGCTG) primer,
Mixed pollen assay for the purity and mixing of honey.
15. The method of claim 14,
The second step is the step of diluting the honey to be analyzed in water and then centrifuging to remove the supernatant and adding water to the resultant mixture to prepare a solution containing the mixture;
Extracting DNA of the solution containing the mixed pot and performing PCR to express the protein gene pattern of the mixed pot; And
Investigating the pollen analysis tool that satisfies the protein gene pattern of the potted plant to analyze the purity and mixing state of honey;
Mixed pollen assay for the purity and mixing of honey.

Images