KR101255336B1 - Rice cultivar with enhanced metal contents and functional foods - Google Patents

Abstract

The present invention relates to a functional food containing a transformed plant in which the content of trace elements is increased by the activation of OsNAS2 gene of rice and a product produced from the transformed plant.

Paddy, OsNAS2, Iron

Description

Rice cultivar with enhanced metal contents and functional foods with increased trace element content

The present invention relates to a transgenic plant in which the content of trace elements is increased by activation of the OsNAS2 gene of rice and a functional food containing a product produced from the transgenic plant.

Iron is the fourth largest element on earth, but it is not readily available to plants. This is because most of the iron in the soil is in the form of oxyhydrate (oxyhydrate), solubility is very low. In addition, about 30% of the world's soils are basic. In soils with these properties, iron is present in the form of Fe ₂ O ₃ with very low solubility, making plant growth difficult (Mori, Curr Opin Plant Biol 2: 250-253, 1999). This lack of iron has a devastating effect on plants. In particular, iron deficiency affects the synthesis of chlorophyll and the development of chloroplasts, reducing the production of plants.

Iron is also important for human health. Iron is one of the indispensable trace metal elements required for various functions in the cell. According to the World Health Organization (WHO), about 30% of the world's population suffers from anemia due to iron deficiency, most of which are concentrated in underdeveloped countries. Lack of zinc inhibits plant growth, resistance to stress and chlorophyll production. Zinc is also known to play an important role in human immune response, increase resistance to infection, and contribute to cell growth and wound healing.

Plants are known to overcome iron deficiency in two ways (Marschner et al., J. Plant Nutr 9: 3-7, 1986). Most plants absorb Fe ³⁺ after reducing it to Fe ²⁺ , while rice plants such as rice and barley bind Fe ³⁺ by releasing an iron-binding substance called phytosiderophore into the soil when iron is deficient. To increase the solubility, so as to absorb a complex of iron and phytosideropores.

Rice is an important staple food for mankind, and the development of rice varieties containing large amounts of iron has important implications for human health. Therefore, the development of fertile rice varieties by genetic engineering has been suggested as an alternative to overcome the limitations of traditional breeding methods and to solve human health problems due to iron deficiency (Qu et al., Planta 222: 225-). 233, 2005).

As part of this effort, a method of increasing the iron content by increasing the amount of ferritin, an iron storage protein originally present in plants, has been proposed (Theil et al., Annu Rev Biochem 56: 289-315, 1997). In this method, the ferritin gene of soybean was transformed by using the glusperlin promoter of rice with endosperm-specific expression. (Goto et al., Nat Biotech 17: 282-286, 1999). In addition, overexpression of the ferritin gene of Gangnam bean ( Phase vulgaris ) in rice seeds resulted in a twofold increase in iron content (Lucca et al., Theor Appl Genet 102: 392-397, 2001).

According to Korean Patent No. 10-471679, the ferritin-expressing gene is isolated from soybean and rice, and then combined with an endosperm-specific promoter isolated from seed storage proteins globulin, glutelin and zein of rice and corn only in endosperm. An expression vector expressing a specific expression is prepared and transformed with this expression vector to describe a rice having a high iron production capacity. However, this method uses genes derived from soybeans, corn, and other crops other than rice.

According to the Republic of Korea Patent No. 10-454083, rice plants that have improved iron absorption by introducing a gene encoding nicotianamine aminotransferse (NAAT), an enzyme in the murine acid biosynthetic pathway, into rice plants It describes. However, this method uses genes encoding nicotianamine amino group transferases.

According to Korean Patent Laid-Open Publication No. 10-2003-84892, a method for producing a plant having enhanced iron deficiency resistance by introducing a gene encoding a reductase that reduces a keto body of nicotianamine to 2'-deoxymujinic acid is disclosed. Doing. However, this method uses a gene encoding a reductase that reduces the nicotoamine ketogen to 2'-deoxymujinic acid.

Nicotianamine (NA), on the other hand, is a chelator that binds to metal elements present in plants and plays an important role in the absorption and homeostasis of metal elements (Douchkov et al., Plant Cell Environ 28). : 365-374, 2005). NA is made from three S-adenosyl-L-methionine molecules by the Nicotianamine synthase (NAS) gene present in plants.

Hypertension is the most common disease among chronic circulatory diseases. Angiotensin converting enzyme (ACE), an important enzyme in the Renin-Angiotensin System (RAS), an important mechanism of blood pressure elevation, is angiotensin. An enzyme that converts I (angiotensin I: AngI) to angiotensin II (Ang II), which is known to convert Ang II to constrict blood vessels and raise blood pressure. Therefore, ACE inhibitors have been developed and commercially used for the purpose of improving hypertension, and there have been several reports showing that nicotianamine acts as an ACE inhibitor (Usuda et al., Plant Biotech J 7: 87-95, 2009).

The inventors have found that the content of trace elements was increased when activating the OsNAS2 gene originally present in rice to complete the present invention.

The present invention is to provide a functional food containing a transformed plant and a product produced from the transformed plant, the content of the trace element increased by the activation of the gene present in the rice itself, compared to the wild type.

Exemplary embodiments of the invention provide plants with increased content of trace elements.

The plant may be one or more metal content selected from iron, zinc and copper is increased compared to wild type plants. For example, the plant, iron and / or zinc may be increased compared to wild type plants. The increased degree of metal content may be at least 30%, at least 50%, at least 70%.

The plant may be that the expression of OsNAS2 gene is increased. The OsNAS2 gene may be a gene encoding a polypeptide having an amino acid sequence of SEQ ID NO: 2 (GenBank License No .: AB023818). For example, the gene may be one having a nucleotide sequence of SEQ ID NO: 1. However, the OsNAS2 gene includes anything encoding a polypeptide having OsNAS2 protein activity. For example, variants of proteins such as SEQ ID NO: 2 having OsNAS2 protein activity may be included, but are not limited to these examples.

The plant may be a monocotyledonous plant. For example, it can be rice, barley and corn. The plant may be a whole plant, roots, leaves, seeds, and cells isolated from the plant. The plant also includes seeds produced from the plant.

In such plants, increasing the expression of OsNAS2 gene may be by any method known in the art related to increasing expression of endogenous genes present in cells. For example, insertion mutagenesis may be used which introduces an insertion element such as a transposable element (TE) or T-DNA into the genome of the plant. Insertion mutagenesis has the advantage that the inserted element acts as a tag for gene identification. In addition, modified insertion mutations can be used. One example of a modified insertion mutagenesis is a gene trap system comprising fusion between the tagged gene and a reporter gene, such as β-glucuronidase (GUS) or green fluorescent protein (GFP). )to be. According to this system, genes can be identified based on expression patterns. Insertion of a reporter without a promoter not only destroys normal gene function, but if the inserted reporter gene is oriented correctly, the reporter is expressed and reflects the expression of the inserted gene, thereby enabling useful promoter separation. Another example of a modified insertion mutagenesis is the activation tagging system. The system uses T-DNA or TE with a multimerized CaMV 35S enhancer. Enhancers function at significant distances from the coding region regardless of orientation, resulting in transcriptional activation of adjacent genes, leading to the formation of dominant gain-of-function mutations. The plant can be obtained by selecting an individual having increased expression of OsNAS2 gene among mutants formed by the above methods (Jung et al., Plant Physiology 130: 1636-1644). The plant may include, for example, an enhancer introduced to increase expression of the OsNAS2 gene, or an amplified copy number of the gene. Examples of such enhancers may be CaMV 35S enhancers (Cauliflower mosaic virus 35S enhancer) or their linkages (eg, 4 linkages) and these enhancers are vectors, for example pGA2715 (Jung et al. , Plant Physiology 130: 1636-1644) and pGA2772 (Jung et al., Plant J 45: 123-132, 2006) may be introduced into the genome of the plant by an activation tagging vector (activation tagging vector). The enhancer may be located at an appropriate position with the OsNAS2 gene, depending on the nature of the selected enhancer. For example, the 5 ', 3' or 5 'and 3' ends of the OsNAS2 gene may be flanked or spaced apart. For example, the enhancer is a CaMV 35S enhancer and may be introduced downstream of the OsNAS2 gene, eg, within about 10 kb downstream of the stop codon of the gene, eg, about 2.06 kb. . In addition, the enhancer is a CaMV 35S enhancer, and may be introduced upstream of the OsNAS2 gene, for example, within about 10 kb upstream from the start codon of the gene, for example, about 2.06 kb. The enhancer may be one or a plurality of connected. For example, the enhancer may be four copies of the CaMV 35S enhancer connected in series.

Methods of introducing foreign nucleic acid constructs, such as enhancers, into plants are known. For example, the introduction of the construct can be introduced through Agrobacterium tumefaciens Ti plasmid, electroporation and bombardment. In addition, introduction of a foreign nucleic acid construct into a plant may be achieved by selecting a plant having a specific trait after being introduced at a specific position or introduced at a specific position.

An example of the plant may be rice deposited with seed accession number: KACC 98008P. The rice has an increased iron and zinc content compared to wild type rice. In addition, the rice can be grown with resistance under conditions of increased zinc, copper or nickel.

Another exemplary embodiment of the present invention provides a plant that is resistant to heavy metals. The above-mentioned plants are as described above. The heavy metal may be one or more selected from zinc, copper, and nickel. The degree of resistance may be grown in zinc at least 5 mM, copper at least 0.3 mM, or nickel at least 0.5 mM.

Another exemplary embodiment of the present invention comprises the steps of growing a plant according to the exemplary embodiments of the present invention described above under conditions lacking at least one selected from the group consisting of iron and zinc. To provide. The concentration of iron and zinc may be, for example, culture in MS medium or similar conditions that do not contain iron and zinc.

Another exemplary embodiment of the present invention provides a method of growing a plant, comprising the step of growing the plant according to the exemplary embodiment of the present invention described above in the presence of excess heavy metal. The heavy metal may be at least 5 mM zinc, at least 0.3 mM copper, or at least 0.5 mM nickel.

Another exemplary embodiment of the present invention provides a functional food comprising a product comprising or produced from the plant. The functional food is one or more selected from iron, zinc and copper. The functional food may be a product of the plant, for example, a product comprising or processed from rice.

Another exemplary embodiment of the present invention provides a method for producing a plant having an increased trace element content.

One example of the method includes introducing a construct comprising a foreign enhancer into a plant to obtain a plant with increased expression of the OsNAS2 gene. The enhancer, the plant, the method of introducing the construct into the plant, and the OsNAS2 gene are as described above. Whether the expression of the OsNAS2 gene is increased can be made by methods known in the art. For example, direct enzyme activity measurement, measurement of mRNA levels of OsNAS2 gene by nucleic acid amplification methods, or by measuring the amount of protein expressed. The nucleic acid amplification method includes PCR including RT-PCR. For measuring the amount of the protein, immunological methods such as ELISA, western blotting and the like can be used. The method may further comprise determining whether the expression of the OsNAS2 gene is increased, and whether at least one selected from iron, zinc and copper is increased compared to the wild type. Methods of measuring the content of iron and / or zinc are known.

For example, the method includes the steps of plant introduction of the Ti plasmid inserted with the 35S enhancer derived from the promoter of Cauliflower mosaic virus; The 35S enhancer may include selecting a plant inserted at one or more positions upstream and downstream of a gene encoding OsNAS2 activity.

The Ti plasmid is a circular plasmid contained in Agrobacterium tumefaciens, which is used to introduce genetic material into plants. Introduction of the 35S enhancer into the Ti plasmid can be easily prepared by those skilled in the art using appropriate restriction enzymes, ligases, and the like. The 35S enhancer may be located at the left and / or right border of the T-DNA of the Ti plasmid. One or more 35S enhancers, for example, may be adjacent to four. For example, it can be inserted by pGA2715 vector or pGA2772 vector. The introduction of the Ti plasmid into the plant can be accomplished by introducing the Ti plasmid into Agrobacterium tumefaciens and infecting the plant with the Agrobacterium tumefaciens into which the Ti plasmid is introduced. In general, the T-DNA region of the Ti plasmid is inserted into the chromosome of the plant.

The method includes selecting a plant wherein the 35S enhancer is inserted at one or more positions upstream and downstream of a gene encoding OsNAS2 activity. "OsNAS2 activity" means a reaction catalyzed activity that converts three molecules of S-adenosyl-L-methionine to 3 S-methyl-5'-thioadenosine + niconiaamine and vice versa. Preferably, the OsNAS2 activity may be due to a protein having an amino acid sequence of SEQ ID NO: 2. Gene encoding the OsNAS2 activity may be a gene encoding a protein having an amino acid sequence of SEQ ID NO: 2, for example, having a nucleotide sequence of SEQ ID NO: 1. Whether the 35S enhancer has been inserted at one or more positions upstream and downstream of the gene encoding OsNAS2 can be made by sequencing or nucleic acid amplification. The plant is preferably rice ( Oryza sativa ). For example, the 35S enhancer can be inserted at about 2.06 kb downstream of the nucleotide sequence of SEQ ID NO: 1 encoding OsNAS2 activity.

Figure 1 shows one form of the DNA construct inserted T-DNA. In Fig. 1, the boxes marked ATG to TGA represent the exons of the OsNAS2 gene. T-DNA can be inserted at about 2.06 kb after the TGA stop codon of the OsNAS2 gene ( OsNAS2 -D1 transgenic plant).

Another exemplary embodiment of the present invention provides a method for growing a plant, comprising growing the plant as described above at high pH conditions.

The pH may be 8.5 to 14, for example 8.5 to 12.

According to a plant according to an embodiment of the present invention, it may have an increased content of trace elements compared to wild type (WT).

In addition, according to the functional food according to an embodiment of the present invention, it has an increased content of trace elements compared to wild type (WT) can have a high agricultural and nutritional benefits.

In addition, according to the method for producing a plant with an increased trace element content according to an embodiment of the present invention, it is possible to effectively produce a plant with an increased trace element content.

In addition, according to the method for growing a plant according to an embodiment of the present invention, growth conditions in which the plant is contained in an amount insufficient for heavy metals such as iron or zinc or growth conditions in which heavy metals such as copper, zinc or nickel are excessively contained. Can grow plants.

Hereinafter, the present invention will be described in detail by way of examples. However, the present invention is not limited by the following examples.

Example 1: OsNAS2  Isolation of Transgenic Plants with Activated Gene Expression

(1) Nicothiaminamine synthase 2 present in rice ( OsNAS2 Expression Analysis of Genes

Rice has three Nicotianamine synthases ( OsNAS1 , OsNAS2 , OsNAS3 ), and has been reported to have activity as an enzyme (Inoue et al., Plant J 36: 366-381, 2003). The expression level of OsNAS2 gene was examined according to the iron concentration supplied from the outside. Seeds of rice were added with MS medium (including 0.1 μM CuSO ₄ , 100 μM Fe (III) -EDTA, 30 μM ZnSO ₄ , 10 μM MnSO ₄ ) and 0 μM, 1 μM, 10 μM and 500 μM Fe (III) -EDTA, respectively. Rice seeds were germinated in MS medium and grown for 7 days. In addition, rice seeds were grown in MS medium without 100 μM Fe (III) -EDTA for 7 days, and then transferred to MS medium with 100 μM Fe (III) -EDTA and planted and grown to confirm OsNAS2 expression change. .

RNA was prepared from the roots and leaves of rice and its expression was analyzed by quantitative real-time RT-PCR. PCR conditions were repeated 45 times for 15 seconds at 94 degreeC, 10 second at 56 degreeC, and 10 second at 72 degreeC after hold | maintaining 1 minute at 95 degreeC. The primers used are as follows. As an expression control, rice actin 1 gene was amplified.

Primer sequence

OsNAS2 -Forward primer: 5'- CGTCTGAgtgcgtgcatagta -3 '(SEQ ID NO: 3)

OsNAS2 -Reverse primer: 5'- GAAGCACAAACACAAACCGATA -3 '(SEQ ID NO: 4)

OsAct1 -Forward primer: 5'-TGGAAGCTGCGGGTATCCAT-3 '(SEQ ID NO: 5)

OsAct1 -reverse primer: 5'-TACTCAGCCTTGGCAATCCACA-3 '(SEQ ID NO: 6)

The results are shown in Fig. In Figure 2, the vertical axis represents the expression level based on the expression amount of the rice actin 1 gene.

As shown in Figure 2a, OsNAS2 gene was strongly induced in leaves when the rice grows in a medium containing no iron, but did not manifest in a medium containing Fe (III) -EDTA or more than 1μM. In the root, the expression was highest in the medium containing no iron, and expression decreased as the iron concentration increased. Figure 2b shows the expression of OsNAS2 over time after feeding 100μM Fe (III) -EDTA to the medium. The rice used in FIG. 2 is Dongjin rice.

(2) OsNAS2  Preparation and Isolation of Transgenic Plants with Activated Gene Expression

The pGA2715 vector, a T-DNA vector, was used as a construct for preparing transformed rice (Jeong et al., Plant Physiol 130: 1636-1644,2002). The vector contains a β-glucuronidase (GUS) reporter gene adjacent the right border and comprises a tetramerized transcriptional enhancer derived from the CaMV 35S promoter adjacent the left border. The pGA2715 vector was transformed into Agrobacterium and transformed into wild type Dongjin rice using the transformed Agrobacterium to prepare a rice plant population to which pGA2715 was transfected (Lee et al, J Plant Biol 42: 310-316 , 1999; Jeong et al., Plant Physiol 130: 1636-1644, 2002; Jeong et al., Plant Journal 45: 123-132, 2006).

Genomic DNA isolated from the transduced rice plants was identified by T-DNA insertion in the pGA2715 vector through inverse PCR (PCR). As a result, one transgenic plant ( OsNAS2-D1 ) in which T-DNA was inserted around the OsNAS2 gene was isolated.

OsNAS2-D1 transgenic plants have a T-DNA inserted at about 2.06 kb downstream of the OsNAS2 gene, including a 35S enhancer at the left border region. Figure 1 shows the insertion position of T-DNA in OsNAS2-D1 .

Example 2: In a Transgenic Plant OsNAS2 Increased expression of

The genotype of OsNAS2- D1 selected in Example 1 was determined by PCR. Genomic DNA was extracted from the leaves of T2 generation individuals of OsNAS2 -D1 and used as template DNA for PCR. For OsNAS2- D1, two gene-specific primers F (5'- ACCTTACTCCCCCGAACTAA-3 ': SEQ ID NO: 7) and R (5'-CAAGGAGCTGTCCGTCTAAC-3': SEQ ID NO: 8 and T-DNA specific primer RB ( 5'-CAAGTTAGTCATGTAATTAGCCAC-3 ': SEQ ID NO: 9) To determine the expression levels, 100 μM Fe (III) -EDTA of the homozygote of OsNAS2 -D1 and each wild type rice, namely Dongjin rice (WT) RNA was isolated from seedling leaves and roots, flag leaves, 10 cm flowers, and immature seeds grown for 7 days in medium with or without the addition of reverse transcriptase. Each cDNA was prepared using the prepared cDNA as a template, and real-time RT-PCR was performed using the primers of SEQ ID NOs: 1 and 2 to compare the amount of OsNAS2 gene transcription, and the results are shown in FIG. 3. In Figure 3 the vertical axis is relative to the rice actin 1 gene transcription amount The transfer amount is shown.

As shown in Figure 3, the expression of OsNAS2 gene was increased in all conditions tested in OsNAS2- D1 compared to wild-type (WT).

Example 3: Increase in Niconia Namine Levels in Seeds of Transgenic Plants

To determine the effect of increased expression of the OsNAS2 gene on the increase in the amount of nicotianamine, the product of agonist, the amount of nicotianamine in the seeds was measured. Seeds were crushed finely with Muilti-Beads Shocker (Yasui kikai, Osaka Japan), and 20 mg of powder was extracted three times for 15 minutes using 400 μl of 80% ethanol. The extracted nicotianamine was quantitatively analyzed using LC-ESI-TOF-MS. The results are shown in Table 1 below.

Table 1.

Genotype Nicothiaminamine (mg / g) WT 5.59 ± 3.06 OsNAS2-D1 110.45 ± 11.33

As shown in Table 1, the amount of nicotianamine in OsNAS2-D1 seed was increased by about 19.8-fold compared to wild type.

Example 4: Determination of Trace Element Content in Transgenic Plants

To determine the effect of OsNAS2 gene activation on the accumulation of trace elements in rice, trace elements were measured in wild type (WT), transgenic plants OsNAS2 -D1 . Mature seeds and flag leaves of wild-type and transgenic plants were used as samples, and the method of measuring trace elements was referred to the method described in Lee et al., Plant Physiol 150: 786-800, 2009. The sample was dried at 70 ° C. for 2 days, the dryness was recorded and the sample obtained was digested in a 180 ° C. oven for 3 days in 1 ml of 11N HNO ₃ . After dilution, the contents of trace elements iron and zinc in the sample were determined by atomic absorption spectroscopy (AAS) (SpectrAA-800, Varian, Palo Alto, Calif., USA). Table 2 shows the trace element content in the transgenic plant.

Table 2.

group Genotype Fe (μg / g-DW) Zn (μg / g-DW) Cu (μg / g-DW) Mature seeds WT 8.56 ± 0.22 19.61 ± 1.85 2.54 ± 0.33 OsNAS2-D1 25.54 ± 0.65 53.46 ± 4.42 3.12 ± 0.23 Leaf WT 103.86 ± 10.67 24.07 ± 1.53 3.69 ± 0.12 OsNAS2-D1 148.23 ± 13.56 34.19 ± 4.63 5.49 ± 1.09

As shown in Table 2, OsNAS2-D1 increased 3.0 times in iron, 2.7 times in zinc, and 1.2 times in copper in mature seeds. In the lobe , OsNAS2-D1 increased 1.4 times in iron and zinc and 1.5 times in copper compared to wild tongue.

Example 5 Analysis of Seedling Phenotypes of Transgenic Plants in a Lack of Iron and Zinc

The effects of OsNAS2 gene activation on iron and zinc deficiency were examined. 8 days after germination of wild type (WT) and OsNAS2 -D1 in MS solid medium containing both iron and zinc, MS solid medium without iron (Fe-), MS solid medium without zinc (Zn-) Were grown to observe the seedling phenotype. The results are shown in Table 3. In addition, the height of the phenotype and the content of chlorophyll were measured and shown in Table 3. The measurement of chlorophyll was taken leaves, weighed, and extracted with 80% acetone. After freezing with liquid nitrogen, finely crushed leaves and 80% acetone were mixed well (1 ml 80% acetone was added per 100 mg of leaves), and left on ice for 15 minutes, followed by centrifugation at 15,000 g. After absorbance was measured at 646 nm, the amount of chlorophyll including chlorophyll a and chlorophyll b was measured by the method described in Arnon, Plant Physiol 24: 1-15, 1949.

Table 3.

badge Genotype Phenotype Height (cm) Chlorophyll content
(Μg / ml-extract) MS WT 16.6 ± 0.9 138.87 ± 12.33 OsNAS2-D1 16.1 ± 1.3 145.22 ± 10.55 Fe- WT 14.1 ± 1.4 67.33 ± 7.98 OsNAS2-D1 17.1 ± 1.2 101.43 ± 10.22 Zn- WT 17.6 ± 0.9 120.33 ± 13.77 OsNAS2-D1 19.1 ± 0.6 125.43 ± 10.66

As shown in FIG. 4 and Table 3, in the medium (MS) conditions containing both iron and zinc, there was no difference in phenotype as described above. However, in iron-free medium (Fe-) conditions, OsNAS2-D1 is taller than wild - type (WT) and chlorophyll is increased by more than 50% compared to wild-type (WT). chlorosis) was also less advanced. Therefore, it can be seen that OsNAS2-D1 is better tolerated in iron-deficient growth conditions than wild type. OsNAS2-D1 grew faster than wild - type (WT) even in the medium containing no zinc (Zn-). Therefore, it can be seen that OsNAS2-D1 grows better in growth conditions deficient in zinc than wild type (WT).

In order to verify the experimental results, the stems and roots of wild type (WT) and OsNAS2-D1 of seedlings under each condition were collected and the concentrations of iron and zinc were measured in the same manner as in Example 4. The results are shown in Table 4.

Table 4

badge group Genotype Fe (μg / g-DW) Cu (μg / g-DW) MS


stem
WT 215.36 ± 27.96 61.87 ± 11.45 OsNAS2-D1 349.79 ± 34.86 113.14 ± 10.98 Root
WT 344.34 ± 46.36 103.83 ± 13.98 OsNAS2-D1 499.22 ± 27.36 143.64 ± 14.46 Fe-


stem
WT 91.62 ± 9.86 97.51 ± 8.31 OsNAS2-D1 154.15 ± 28.42 150.27 ± 7.63 Root
WT 94.81 ± 15.06 112.39 ± 29.30 OsNAS2-D1 173.33 ± 24.88 193.86 ± 13.95 Zn-


stem
WT 240.14 ± 24.24 30.41 ± 6.87 OsNAS2-D1 413.88 ± 41.38 52.14 ± 12.06 Root
WT 385.88 ± 42.16 22.60 ± 2.93 OsNAS2-D1 561.06 ± 39.30 38.06 ± 4.69

As shown in FIG. 3, in the medium (MS) conditions containing both iron and zinc, there was no difference in phenotype as described above. However, as shown in Table 4, OsNAS2-D1 showed 1.6- and 1.4-fold increase in iron concentrations in stem and root, respectively, compared to wild type (WT), and zinc concentrations were 1.8- and 1.4-fold in stem and root, respectively. Increased. In addition, in the medium containing no iron, OsNAS2-D1 increased the iron concentration by 1.9 and 1.8 times in the stem and root, respectively, compared to the wild type (WT), and the zinc concentration was 1.7 and 1.5 times in the stem and root. Increased. In addition, OsNAS2 - D1 showed a 1.7-fold increase in zinc concentration in both stem and root, and 1.5-fold and 1.7-fold increase in iron, respectively, in the medium containing no zinc. . Thus, it can be seen that OsNAS2 - D1 is better tolerated in growth conditions deficient in iron or zinc.

Example 6: Observation of Phenotype of Transgenic Plants at High pH

The pH of the soil has a great effect on the solubility of the elements necessary for plants. For example, if the pH is 8.0 or more, iron is changed to Fe ₂ O ₃ has a low solubility form, is in a state that can not be properly absorbed and the plant is used. The result is iron deficiency.

pH. Wild type (WT) and OsNAS2 - D1 were germinated in MS medium adjusted to 8.5 (MS / pH 8.5), grown for 10 days and observed for phenotype. In addition, the phenotype was observed by the same method in the iron-free MS medium (Fe- / pH 8.5). Phenotype and plant height are shown in FIG. 5. As shown in FIG. 5, it can be seen that OsNAS2 - D1 is larger in kidney and better tolerant than wild type (WT) in MS medium (MS / pH 8.5) adjusted to pH 8.5. This result is more evident in iron-free MS medium (Fe- / pH 8.5).

Example 7: Phenotypic analysis of transgenic plants under conditions containing excess heavy metals

The effect of OsNAS2 activation on the toxicity produced by the treatment of excess heavy metals was investigated. Wild type (WT) and OsNAS2 -D1 were germinated and grown for 10 days in solid MS medium supplemented with excess zinc (5 mM), copper (0.3 mM) or nickel (0.5 mM) to observe the seedling phenotype. Phenotypes and concentrations of plant kidneys and heavy metals are shown in Figure 6 and Table 5.

As shown in Figure 6 and Table 5, OsNAS2 -D1 is taller than the wild type, less whitening phenomenon. These results indicate that OsNAS2- D1 has improved resistance to toxicity by excess heavy metals compared to wild type (WT).

Table 5.

badge Genotype Phenotype Height (cm) Zn 5.0mM
WT 11.4 ± 1.1 OsNAS2-D1 14.0 ± 0.8 Cu 0.3mM
WT 9.4 ± 1.1 OsNAS2-D1 12.4 ± 1.4 Ni 0.5mM
WT 14.6 ± 1.0 OsNAS2-D1 18.6 ± 1.2

In particular, when grown in solid MS medium containing excess zinc, copper and nickel, the concentration of zinc, copper and nickel in the stem and root was measured in the same manner as in Example 4, the results are shown in Table 6. .

Table 6.

group Genotype Zn (μg / g-DW) Cu (μg / g-DW) Ni (μg / g-DW) stem WT 2.106 ± 0.335 27.295 ± 4.890 0.449 ± 0.072 OsNAS2-D1 2.876 ± 0.199 37.912 ± 5.436 0.621 ± 0.093 Root WT 9.758 ± 0.683 375.833 ± 31.188 3.925 ± 0.917 OsNAS2-D1 14.273 ± 1.895 461.196 ± 26.030 5.509 ± 0.738

As shown in Table 6, OsNAS2 - D1 increased 1.4-fold, 1.5-fold, 1.4-fold, 1.4-fold, and 1.4-fold, respectively, in zinc in stems and roots compared to wild-type (WT).

Example 7: Investigation of the bioavailability of iron

The mouse feeding assay was performed to determine whether the iron increase of OsNAS2-D1 seed increased the bioavailability of iron absorbed and used during seed intake.

Three-week-old female Balb / c mice were fed with iron-rich feed (AIN-93G Purified Diet-45 mgFe / kg feed, Control Diet (CD)) and iron-deficient feed (modified AIN-93G diet containing iron 3 mg / kg feed, Iron-depleted Diet (ID)) was supplied. Two weeks later, blood was drawn from these two groups of mice. This is to measure the hemoglobin (Hb) and hematocrit (Hct) of blood in order to induce anemia and to determine the degree of anemia. As a result, the hemoglobin (Hb) and hematocrit (Hct) levels of the mice fed the iron-deficient diet were reduced to 75 and 65%, respectively, compared to the rats fed the iron-deficient diet (Table 7). It was found that anemia was caused by feeding iron-deficient feed. Thereafter, rats fed the iron-deficient diet were divided into two groups, the first group (wild type, WT, n = 10) fed rice from wild type (WT) seeds, and the second group ( OsNAS2 - D1 , n). = 9) fed rice from the seeds of OsNAS2-D1 . In addition, the rat group fed normal feed from the beginning was measured as a control group (control group, CD). After 1 week, 2 weeks, 4 weeks after feeding rice, blood was collected and Hb and Hct were measured. The results are shown in Table 8. As shown in Table 8, Hb and Hct of the mice did not show a significant difference until rice from wild type (WT) or OsNAS2-D1 seed was fed. After 1 week, Hb and Hct of the two groups were measured, and the second group showed a slight increase in Hb and Hct compared to the first group. After one week, Hb and Hct were measured. In this case, the second group showed a significant increase in Hb and Hct compared to the first group, which was similar to that of the normal feed group. The Hb and Hct of the second group were significantly higher than those of the first group and were similar to the group fed the iron-rich feed.

Table 7.

Group of rats fed enough iron Group of rats fed iron-deficient feed Hb (g / L) 16.10 ± 0.37 10.50 ± 1.50 Hct (%) 49.60 ± 1.79 37.00 ± 4.80

Table 8

group When to measure ¹ Week 0 1 week 2 weeks 4 weeks Hb (g / L) CD 16.10 ± 0.37 17.00 ± 1.20 17.80 ± 0.42 16.00 ± 0.40 WT 9.90 ± 0.35 10.83 ± 0.57 11.00 ± 0.52 12.80 ± 0.57 OsNAS2-D1 11.00 ± 0.82 12.08 ± 1.25 16.10 ± 0.57 15.30 ± 0.17 Hct (%) CD 49.60 ± 1.79 51.40 ± 1.81 54.40 ± 0.90 52.00 ± 1.43 WT 34.80 ± 1.20 41.10 ± 3.14 40.80 ± 1.37 46.70 ± 1.55 OsNAS2-D1 37.10 ± 2.15 47.35 ± 2.27 52.30 ± 0.54 51.40 ± 0.92

1: Time elapsed from 3 weeks of age when mice were fed normal and iron-deficient diets for 2 weeks, then divided into two groups and replaced with WT or OsNAS2-D1 seeds in place of iron-deficient diets.

Example 8 Investigation of Bioavailability of Zinc

In order to know whether the increase in zinc of OsNAS2-D1 seeds increased the bioavailability of zinc absorbed and used when the seed was ingested, a mouse feeding assay was performed.

In mice weighing about 13 g, a diet rich in zinc (30 mg Zn / kg diet, Control Diet (CD)) and a diet lacking zinc (modified AIN-93G diet containing iron 3 mg / kg diet, Iron-depleted Diet) (ZD)). Two weeks later, blood was drawn from these two groups of rats. The content of zinc was measured. As a result of measurement, the level of zinc in the blood of mice fed a diet low in zinc was reduced to 66% compared to rats fed a diet rich in zinc (Table 9).

Table 9.

Rats fed a diet rich in zinc Group of rats fed zinc-deficient feed Zn (μg / ml) 2.017 ± 0.260 1.341 ± 0.187

Thereafter, the rats fed the zinc-deficient diet were divided into three groups, the first group fed a zinc-rich normal diet (Zn- / CD, n = 10), and the second group was derived from wild-type (WT) seeds. Rice was fed (Zn- / WT, n = 10) and the third group fed rice from the seeds of OsNAS2-D1 (Zn- / OsNAS2-D1 ). As a control, zinc levels of rats fed normal diet from the beginning were measured. Blood was collected at 2, 6, 10, 15, 20, and 30 days of normal feed and rice to measure the recovery of zinc levels. The results are shown in Table 10. As shown in Table 10, the zinc level increased from 2 days after the normal feed or rice. However, the rate of recovery showed that the group fed OsNAS2-D1 seed had similar zinc levels to the group fed normal diet in 10 days, but the group fed wild-type seed remained low after 30 days. In addition, the group that was fed a zinc-deficient diet and then changed to a normal diet also had zinc levels similar to those of the group fed the normal diet at the beginning of about 20 days.

Table 10.

Time of measurement
(Work) group CD Zn- / CD Zn- / WT Zn- / OsNAS2-D1 2 2.102 ± 0.017 1.658 ± 0.077 1.471 ± 0.033 1.706 ± 0.097 6 2.102 ± 0.017 1.802 ± 0.063 1.671 ± 0.076 1.836 ± 0.132 10 2.125 ± 0.086 1.889 ± 0.091 1.736 ± 0.081 2.013 ± 0.101 15 2.152 ± 0.155 1.948 ± 0.011 1.789 ± 0.072 2.164 ± 0.109 20 2.309 ± 0.073 2.204 ± 0.112 1.933 ± 0.182 2.237 ± 0.089 30 2.274 ± 0.278 2.015 ± 0.164 1.900 ± 0.211 2.182 ± 0.133

The inventors of the present invention deposited a rice seed OsNAS2-D1 with an increased trace metal content obtained in the above example to the National Agricultural Science Institute Agricultural Genetic Resource Center on April 30, 2009, and received the seed accession number KACC98008P. .

Figure 1 shows one form of the DNA construct inserted T-DNA.

Figure 2a is analyzed by using quantitative real-time RT-PCR expression of OsNAS2 gene expression in the leaves or roots of rice grown for 7 days in medium added 0, 1, 10, 500 μM Fe (III) -EDTA to MS medium, respectively It is. FIG. 2b shows that rice seeds were grown for 7 days in MS medium without 100 μM Fe (III) -EDTA, and then transferred to medium containing 100 μM Fe (III) -EDTA, and grown for a certain time. It is the result of measuring the expression of OsNAS2 from RNA extracted from the.

Figure 3 compares the expression level of OsNAS2 against OsNAS2-D1 and its wild type (WT).

4 shows wild type (WT) and OsNAS2 grown in MS solid medium (MS) containing both iron and zinc, MS solid medium without iron (Fe-), MS solid medium without zinc (Zn-) Representation of -D1 .

Figure 5 shows the phenotype and kidney of wild type (WT) and OsNAS2-D1 grown in MS medium (MS / pH 8.5) adjusted to pH 8.5, MS medium without iron (Fe- / pH 8.5) at pH 8.5 Drawing.

6 is a phenotype of wild type (WT) and OsNAS2-D1 grown in each solid MS medium to which excess zinc (5 mM), copper (0.3 mM) or nickel (0.5 mM) was added.

<110> Postech Academy-Industry Foundation <120> Rice cultivar with enhanced metal contents and functional foods <130> PN086713 <160> 9 <170> Kopatentin 1.71 <210> 1 <211> 1348 <212> DNA <213> Oryza sativa <400> 1 aagcattcca caagcttgcc gttttccact gacagctcaa gtgctcgtgc aacattagct 60 gatcagctcg tgttcccaac cgcgacaaag cttcacagat ggaggctcag aaccaagagg 120 tcgctgccct ggtcgagaag atcgccggcc tccacgccgc catctccaag ctgccgtcgc 180 tgagcccatc cgccgaggtg gacgcgctct tcaccgacct cgtcacggcg tgcgtcccgg 240 cgagccccgt cgacgtggcc aagctcggcc cggaggcgca ggcgatgcgg gaggagctca 300 tccgcctctg ctccgccgcc gagggccacc tcgaggcgca ctacgccgac atgctcgccg 360 ccttcgacaa cccgctcgac cacctcgccc gcttcccgta ctacggcaac tacgtcaacc 420 tgagcaagct ggagtacgac ctcctcgtcc gctacgtccc cggcattgcc cccacccgcg 480 tcgccttcgt cgggtcgggc ccgctgccgt tcagctccct cgtgctcgcc gcgcaccacc 540 tgccggacgc ggtgttcgac aactacgacc ggtgcggcgc ggccaacgag cgggcgagga 600 ggctgttccg cggcgccgac gagggcctcg gcgcgcgcat ggcgttccac accgccgacg 660 tggcgaccct gacgggggag ctcggcgcgt acgacgtcgt gttcctggcg gcgctcgtgg 720 gcatggcggc cgaggagaag gccggggtga tcgcgcacct gggcgcgcac atggcggacg 780 gcgcggcgct cgtcgtgcgg aggcacgggg cgcgcgggtt cctgtacccg atcgtcgatc 840 tcgaggacat ccggcggggc gggttcgacg tgctggccgt gtaccacccc gacgacgagg 900 tgatcaactc cgtcatcgtc gctcgcaagg ccgacccgcg tcgcggcggc gggctcgccg 960 gcgcacgcgg cgcggttcca gtggtgagcc cgccgtgcaa gtgctgcaag atggaggcgg 1020 ccgccggcgc gttccagaag gcggaagagt tcgccgccaa gaggctatcc gtctgagtgc 1080 gtgcatagta atcctggctg tgtctcgctg tccgtgacat cggccggctg aaacattatt 1140 ggtatcggtt tgtgtttgtg cttctgtggg gttcttgttc ttgttgtgtg gatgatgcta 1200 ggcgcctggg cattgatccg tgccaatgca ttccgtgttt cggtgcaact ctaggggaca 1260 acgacgagta aggtgctgag aaagcaagag gtgtttgtca ccgtctgaaa taataatgta 1320 aaagggttat ctaaaaaaaa aaaaaaaa 1348 <210> 2 <211> 325 <212> PRT <213> Oryza sativa <400> 2 Met Glu Ala Gln Asn Gln Glu Val Ala Ala Leu Val Glu Lys Ile Ala   1 5 10 15 Gly Leu His Ala Ala Ile Ser Lys Leu Pro Ser Leu Ser Pro Ser Ala              20 25 30 Glu Val Asp Ala Leu Phe Thr Asp Leu Val Thr Ala Cys Val Pro Ala          35 40 45 Ser Pro Val Asp Val Ala Lys Leu Gly Pro Glu Ala Gln Ala Met Arg      50 55 60 Glu Glu Leu Ile Arg Leu Cys Ser Ala Ala Glu Gly His Leu Glu Ala  65 70 75 80 His Tyr Ala Asp Met Leu Ala Ala Phe Asp Asn Pro Leu Asp His Leu                  85 90 95 Ala Arg Phe Pro Tyr Tyr Gly Asn Tyr Val Asn Leu Ser Lys Leu Glu             100 105 110 Tyr Asp Leu Leu Val Arg Tyr Val Pro Gly Ile Ala Pro Thr Arg Val         115 120 125 Ala Phe Val Gly Ser Gly Pro Leu Pro Phe Ser Ser Leu Val Leu Ala     130 135 140 Ala His His Leu Pro Asp Ala Val Phe Asp Asn Tyr Asp Arg Cys Gly 145 150 155 160 Ala Ala Asn Glu Arg Ala Arg Arg Leu Phe Arg Gly Ala Asp Glu Gly                 165 170 175 Leu Gly Ala Arg Met Ala Phe His Thr Ala Asp Val Ala Thr Leu Thr             180 185 190 Gly Glu Leu Gly Ala Tyr Asp Val Val Phe Leu Ala Ala Leu Val Gly         195 200 205 Met Ala Ala Glu Glu Lys Ala Gly Val Ile Ala His Leu Gly Ala His     210 215 220 Met Ala Asp Gly Ala Ala Leu Val Val Arg Arg His Gly Ala Arg Gly 225 230 235 240 Phe Leu Tyr Pro Ile Val Asp Leu Glu Asp Ile Arg Arg Gly Ghe Phe                 245 250 255 Asp Val Leu Ala Val Tyr His Pro Asp Asp Glu Val Ile Asn Ser Val             260 265 270 Ile Val Ala Arg Lys Ala Asp Pro Arg Arg Gly Gly Gly Leu Ala Gly         275 280 285 Ala Arg Gly Ala Val Pro Val Val Ser Pro Pro Cys Lys Cys Cys Lys     290 295 300 Met Glu Ala Ala Ala Gly Ala Phe Gln Lys Ala Glu Glu Phe Ala Ala 305 310 315 320 Lys Arg Leu Ser Val                 325 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OsNAS2 forward primer <400> 3 cgtctgagtg cgtgcatagt a 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OsNAS2 reverse primer <400> 4 gaagcacaaa cacaaaccga ta 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsAct1 forward primer <400> 5 tggaagctgc gggtatccat 20 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OsAct1 reverse primer <400> 6 tactcagcct tggcaatcca ca 22 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gene specific primer F <400> 7 accttactcc cccgaactaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gene specific primer R <400> 8 caaggagctg tccgtctaac 20 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> T-DNA specific primer RB <400> 9 caagttagtc atgtaattag ccac 24  

Claims (18)

A plant having an increased content of trace elements, wherein the trace element is a plant selected from the group consisting of iron, zinc and copper, wherein the plant is rice deposited with seed accession number KACC 98008P. delete delete delete delete delete Functional food for improving the bioavailability of iron or zinc containing rice produced from the plant of claim 1. A method of manufacturing a plant with an increased trace element content selected from the group consisting of iron, zinc and copper, comprising the step of introducing a construct comprising an exogenous enhancer into a plant to obtain a plant with increased expression of the OsNAS2 gene, The vector including the enhancer is a pGA2715 vector, the plant into which the construct is introduced is Dongjinbyeo, and the plant having increased expression of the OsNAS2 gene is a rice deposited with seed accession number KACC 98008P. How to. delete delete delete delete delete A method of growing a plant, comprising the step of growing the plant according to claim 1 in a condition lacking at least one selected from the group consisting of iron and zinc. A method for growing a plant, comprising growing the plant according to claim 1 in a condition in which excess heavy metal is present, wherein the heavy metal is at least 5 mM zinc, at least 0.3 mM copper, or at least 0.5 mM nickel. How to grow. delete A method of growing a plant, comprising the step of growing the plant according to claim 1 at high pH, wherein the pH is at least 8.5. delete

Images