KR101240133B1 - Preparation method of interpenetrating polymer network （IPN）scaffold for cell delivery comprising sodium hyaluronate and sodium alginate - Google Patents

Abstract

The present invention relates to a method for preparing a cell-transfer support of an interpenetrating polymer network structure including hyaluronic acid and alginate, wherein the support for cell delivery is a combination of hyaluronic acid and alginate with an interpenetrating polymer network structure, and cell regeneration. It has a structure with excellent physical properties, which is suitable for nutrients and sufficient nutrients can be delivered, thereby improving the differentiation and proliferation of specific cells, thereby providing a biocompatible three-dimensional support that can contribute to the regeneration of various cells such as chondrocytes. have.

Description

Preparation method of interpenetrating polymer network (IPN) scaffold for cell delivery comprising sodium hyaluronate and sodium alginate

The present invention relates to a method for preparing a cell delivery support for cartilage regeneration, and more particularly, to a method for preparing a cell delivery support having an interpenetrating polymer network structure including hyaluronic acid and alginate.

Joints are areas where bones meet and are composed of cartilage, joints, ligaments, synovial membranes, tendons, and muscles so that bones can move smoothly. Among them, cartilage is a bone made of chondrocytes and a large amount of substrate, and articular cartilage consisting of supernatural bones covers the ends of joints and prevents the friction of the ends. However, when arthritis occurs, the production of hyaluronic acid, which lubricates the joints, is reduced, and the breakdown by proteinases is increased, thereby decreasing the hyaluronic acid in the joints. In other words, joint damage may be severe because the external shocks may not be absorbed or dispersed in the joints. Articular cartilage does not have blood vessels, nerves and lymphatic tissues, and thus does not cause inflammatory reactions even when damaged. Therefore, various treatment methods have been studied for the treatment of aging or worn joints.

Hyaluronic acid serves to reduce pain by increasing the lubricity of the joint surface in the treatment of osteoarthritis. Hyaluronic acid injections, which were approved by the FDA in 1997, are frequently used because they are similar to the components of joint fluids, lubricating and shock absorbing when they are inserted into joints. It has also been reported to exhibit anti-inflammatory activity and play a role in inhibiting the breakdown of chondrocytes in several in vitro studies. However, since hyaluronic acid injections have a temporary effect in treating arthritis, autologous or homogenous cartilage tissues, cells, and stem cells are collected to treat damaged cartilage and cultured in vitro using a biocompatible 3D scaffold. The method of replanting cartilage by transplanting it into cartilage locations has received great attention.

Biocompatible three-dimensional scaffolds have the role of cell transport as well as a template to fill in the defect site of tissue. The ideal support should be non-immune, non-toxic, biocompatible, biodegradable and easy to handle. Various studies are being conducted on such a three-dimensional support using synthetic polymers and natural polymers. As the support using synthetic polymer, polylactic acid (PLA: poly (lactic acid)), polyglycolic acid (PGA: poly (glycolic acid)) and polylactic acid-polyglycolic acid copolymer (PLGA) supports are typically used. Synthetic polymer support has excellent properties such as physical properties, biodegradability and processability, but has a disadvantage of low interaction between cells and support. In contrast, natural polymers such as hyaluronic acid, collagen, gelatin, and chitosan may induce differentiation and proliferation of chondrocytes, but have physical disadvantages such as low physical properties and rapid degradation.

Therefore, in order to overcome the disadvantages that may occur in the support made using a single polymer, a method of forming a chain structure or interpenetrating polymer network structure between polymers or increasing physical properties by using a crosslinking agent, a suitable ratio of natural polymer and synthetic polymer Various studies have been conducted, such as mixing or combining, but the development of a three-dimensional support showing excellent effects is still required.

Therefore, the present inventors have studied a support that is excellent in the differentiation and proliferation of chondrocytes and has excellent physical properties. As a result, the present inventors have developed a support that combines hyaluronic acid and alginate in an interpenetrating macromolecular network structure. The present invention was completed by confirming the improvement.

Accordingly, it is an object of the present invention to provide a method for producing a porous hyaluronic acid-alginate support having an interpenetrating polymer network structure having excellent physical properties that can regenerate chondrocytes, and are suitable for cartilage regeneration and are capable of delivering nutrients sufficiently. It is done.

Dissolving step of dissolving hyaluronic acid and alginate in aqueous sodium hydroxide solution to achieve the above object; A homogenization step of homogenizing the hyaluronic acid-alginate solution after adding an epoxy-based crosslinking agent to an aqueous sodium hydroxide solution in which the hyaluronic acid and the alginate are dissolved; A hydrogelation step of hydrogelizing the homogenized hyaluronic acid-alginate solution; Washing the hydrogelized hyaluronic acid-alginate hydrogel with an aqueous calcium chloride solution; Expanding the washed hyaluronic acid-alginate in an aqueous calcium chloride solution to form an interpenetrating macromolecular structure and expand to obtain porosity; Removing calcium chloride remaining in the expanded hyaluronic acid-alginate support with distilled water; And a freeze-drying step of freeze-drying the hyaluronic acid-alginate hydrogel to obtain a porous hyaluronic acid support.

The hyaluronic acid is used to have a number average molecular weight of 1 million to 5 million daltons, alginate is used to have a number average molecular weight of 100,000 to 1 million daltons.

In particular, the support for cell delivery preferably contains 70 to 90% by weight of hyaluronic acid and 10 to 30% by weight of alginate, and more preferably includes 70% by weight of hyaluronic acid and 30% by weight of alginate. If the hyaluronic acid is out of the content range, the pore size may be difficult to adhere to the cell with a pore size of 500 μm or more, and if the alginate is out of the content range, the pore size becomes very small to attach the cells. This hard problem can be caused.

The concentration of the aqueous sodium hydroxide solution used in the dissolution step is It is preferable that it is 0.05N-1.0N, and it is more preferable that it is 0.1N-0.3N. By adjusting the concentration of sodium hydroxide in this way, it is possible to adjust the pore size of the prepared support for cell delivery. Here, when the sodium hydroxide aqueous solution has a concentration of less than 0.05N, the strength of the support is greatly reduced, which may cause problems in the injection and culture of cells, and when the concentration of the aqueous sodium hydroxide solution exceeds 1.0N As a result, the strength of the support may be increased so much that a problem of making a support that is too rigid may be caused.

The homogenization step is a step of homogenizing after adding a crosslinking agent to the dissolved hyaluronic acid-alginate solution. Here, the homogenization is carried out using a mechanical stirrer for 5-20 minutes at 800-1200 rpm.

As described above, the porous hyaluronic acid-alginate support is easily dissolved in water by performing each step of the method for preparing a support for cell delivery according to an embodiment of the present invention to be described later without adding a crosslinking agent.

The porous hyaluronic acid-alginate support thus made is easily soluble in water and thus cannot serve as a stable support for proliferating cells. Therefore, the method for preparing a porous hyaluronic acid-alginate support according to the present invention performs the step of adding a crosslinking agent to improve the insolubility of the porous hyaluronic acid-alginate support.

As such a crosslinking agent, it is not cytotoxic and economical epoxy compounds such as polyethylene glycol diglycidyl ether, epichlorohydrin, methylglycidyl ether, phenylglycidyl ether, lauryl alcohol glycidyl ether, Preference is given to using any one selected from the group consisting of ethylene glycol dimethacrylate, 1,4-butadiol diglycidyl ether and ethylene glycol diglycidyl ether.

The epoxy crosslinking agent is preferably used in an amount of 1 to 80 parts by weight, more preferably 3 to 10 parts by weight, based on 100 parts by weight of the hyaluronic acid in the hyaluronic acid-alginate solution. If the epoxy-based crosslinking agent is used in a small amount out of the above range, a crosslinking reaction may not occur, thereby causing a problem that the support is broken. In addition, in the case where the epoxy-based crosslinking agent is used in a large amount out of the above range, a large amount of epoxy-based crosslinking agent is left after the reaction is completed, and thus the remaining epoxy-based crosslinking agent should be removed in the washing step to be described later, which is preferable in terms of economical efficiency or efficiency. Not.

The hydrogelation step is a step of hydrogelization by crosslinking the homogenized solution in the homogenization step. The hydrogelation step is preferably reacted for 1 to 6 hours at 40-80 ℃, more preferably for 1 to 3 hours at 55-65 ℃.

If the temperature is outside the above temperature range or time range, even if the crosslinking reaction does not occur at all or the crosslinking reaction occurs, since the produced hyaluronic acid-alginate support is decomposed in a short time, the cells in the pores of the produced hyaluronic acid-alginate support are sufficiently Problems that cannot grow can be caused.

The washing step is washing the hydrogelled hyaluronic acid-alginate hydrogel. In this step, unreacted residues of the hyaluronic acid-alginate hydrogel, such as excess crosslinker and sodium hydroxide, are removed to create an environment suitable for the culture of the cells. Here, as the washing water, an aqueous calcium chloride solution is preferably used.

The network formation and expansion step is an expansion step of forming interpenetrating polymer network structure on the washed hyaluronic acid-alginate hydrogel and securing pores of the hydrogel. Here, the network forming step is a hyaluronic acid-alginate hydrogel 6 hours to 7 days It is preferable to form a cross-penetrating polymer network structure and to secure pores using an aqueous calcium chloride solution.

In the case of the hyaluronic acid-alginate support prepared after inflating the hyaluronic acid-alginate hydrogel for a period of less than 6 hours, the expansion of the hyaluronic acid-alginate support is additionally generated by the medium used for cell culture. The problem of changing the pore size during culture can be caused.

In particular, if the expansion step is not performed, the pore size becomes so small that the cells are not completely filled in the support, and the process of nourishing the cells or removing waste products does not occur smoothly. Is caused.

In addition, although depending on the type of support, the hyaluronic acid-alginate hydrogel is expanded for a long time of more than 7 days, and then the pores of the prepared support are expanded for 7 days, and then the pore size is compared with that of the prepared support. The difference is not so large that it is not efficient in terms of time and money.

The washing step is a step of removing calcium chloride remaining in the produced hyaluronic acid-alginate hydrogel with distilled water, especially tertiary distilled water.

The freeze-drying step is a step of lyophilizing the hyaluronic acid-alginate hydrogel to obtain a porous hyaluronic acid-alginate support. The lyophilization is frozen for approximately 24 hours in a freezer at -20--152 ℃, and then lyophilized for more than 48-72 hours at a temperature of -50--80 ℃ and a pressure of 8-15 μmHg.

A scanning electron micrograph of the hyaluronic acid-alginate support obtained through the above steps is shown in FIG. 1. Referring to the drawings, the porous hyaluronic acid-alginate support prepared by the above process has a plurality of pores therein.

In addition, the present invention comprises a hyaluronic acid and alginate, and is obtained by the above method, and provides a support for cell transfer of interpenetrating polymer network structure, characterized in that it has a pore of 30-500㎛.

The cells may be selected from the group consisting of chondrocytes, stem cells, neurons, brain cells, muscle cells, sensory cells and hematopoietic cells, and in particular, the support for cell delivery may be used as a support for chondrocyte regeneration. .

The support for cell delivery contains an epoxy crosslinking agent in an amount of 3 to 10 parts by weight based on 100 parts by weight of the hyaluronic acid solution in which the hyaluronic acid is dissolved in an aqueous sodium hydroxide solution. With gel phase.

According to the present invention, a support for cell delivery combining hyaluronic acid and alginate in an interpenetrating high molecular network structure is suitable for cell regeneration and has excellent physical properties to allow sufficient nutrients to be delivered, thereby improving differentiation and proliferation to specific cells. Since it can be made, it is possible to provide a biocompatible three-dimensional support that can contribute to the regeneration of various cells such as chondrocytes.

1 shows a hyaluronic acid-alginate support with a scanning electron microscope [A: HA / SA (100: 0), B: HA / SA (90:10), C: HA / SA (80:20), D : HA / SA (70:30)].
Figure 2 shows the average pore size inside the hyaluronic acid-alginate support.
Figure 3 shows the degree of expansion for the hyaluronic acid-alginate support.
Figure 4 shows the compressive strength for hyaluronic acid-alginate support.
Figure 5 shows the degree of proliferation after chondrocyte culture in hyaluronic acid-alginate support as the amount of deoxyribonucleic acid.
Figure 6 shows the results of scanning electron microscopy after culturing rabbit chondrocytes on hyaluronic acid-alginate support for two weeks.
Figure 7 shows the RT-PCR results of type 2 collagen after culturing chondrocytes on hyaluronic acid-alginate scaffold for 2 weeks.
Figure 8 shows the results of quantifying the amount of s-GAG and collagen after culturing chondrocytes on the hyaluronic acid-alginate support.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not limited by these examples.

≪ Example 1 >

First, in order to prepare a hyaluronic acid-alginate support according to the first embodiment of the present invention, hyaluronic acid (HA) having a molecular weight of 1,500 kilodaltons (kDa) and alginate (SA) having 250 kilodaltons (kDa) are 0.1 normal ( It was dissolved in N) aqueous sodium hydroxide solution. A crosslinking reaction was performed by adding 1 ml of PEGDG (polyethyleneglycoldiglycidylether) as a crosslinking agent to the solution prepared as described above.

Each of the crosslinked solutions was reacted at a temperature of 60 ° C. for 6 hours to perform a hydrogelation step. Thus, each of the hyaluronic acid-alginate hydrogels obtained in the hydrogelation step was washed with an aqueous solution of calcium chloride to remove unreacted residue present in the hyaluronic acid hydrogel.

In order to form an internal network in the hydrogel from which the unreacted residues were removed and expanded, an expansion process was performed in an aqueous solution of calcium chloride at 0.01 mol (M) for 18 hours. In order to remove the calcium chloride contained in the expanded hyaluronic acid-alginate hydrogel, the mixture was washed three times or more by using distilled water three times for 1 minute, and then each was frozen in a -80 ° C freezer for 24 hours and then again -90 ° C. , Lyophilized for 48 hours under a pressure of 10 μmHg or less to obtain a hyaluronic acid-alginate support.

Table 1 shows the composition of the hyaluronic acid-alginate support made by Example 1.

HA (g) SA (g) HA90 / SA10 1.13 0.12 HA80 / SA20 1.00 0.25 HA70 / SA30 0.88 0.37

≪ Comparative Example 1 &

0.25 g hyaluronic acid having a molecular weight of 1,500 kilo daltons (kDa) was dissolved in 0.1 normal sodium (N) aqueous solution. After the crosslinking process was carried out in the same manner as in Example 1.

<Experimental Example 1>

The hyaluronic acid support prepared in Comparative Example 1 and the hyaluronic acid-alginate support prepared in Example 1 were thinly coated on a grid, coated with gold foil, and then shaped using a scanning electron microscope (JSM-5310LV, JEOL, Japan). Confirmed.

In FIG. 1, A shows Comparative Example 1, and B, C, and D show the support prepared in Example 1 at 100 times magnification using a scanning electron microscope.

2 is a numerical representation of the size of the pores inside the support shown in FIG.

As shown in FIGS. 1 and 2, the hyaluronic acid support shown in Comparative Example 1 was found to have irregular pores and a size of 500 μm or more in the support, but the hyaluronic acid-alginate support prepared in Example 1 was made of alginate. As the ratio increases, the pores inside the support decrease in size. When the hyaluronic acid / alginate ratio is 70/30, the pores inside the support were found to have the smallest size of 200 μm, which is useful as a cell support.

<Experimental Example 2>

In order to measure the expansion rate, which is one of physical properties as a cell support, the hyaluronic acid-alginate support prepared in Example 1 was hydrated with 25 ° C. distilled water and weighed for 60 seconds to determine the weight of the dried hyaluronic acid-alginate support and The expansion rate was measured in comparison. Tensile strength was also measured through a compression test using AG-400NL (Shimadzu Co., Japan).

Figure 3 shows the expansion rate of the hyaluronic acid support prepared by Comparative Example 1 and the hyaluronic acid-alginate support prepared by Example 1 by water. The hyaluronic acid-alginate support prepared in Example 1 decreased the expansion rate as the amount of alginate increased. Through this phenomenon, it was found that the alginate formed an interpenetrating polymer network inside the hyaluronic acid-alginate support, thereby reducing the degree of hydration of the support. On the other hand, the hyaluronic acid support prepared by Comparative Example 1 showed the highest expansion rate.

Figure 4 shows the tensile strength of the hyaluronic acid support prepared by Comparative Example 1 and the hyaluronic acid-alginate support prepared by Example 1. The tensile strength of the hyaluronic acid-alginate support prepared in Example 1 increased with increasing alginate content and showed the highest tensile strength when the alginate ratio was 30%. This means that the alginate forms an internally interpenetrating macromolecular network structure and has enhanced physical properties and can be used as a cell support. On the other hand, when the support was formed of a single material such as hyaluronic acid or alginate, it was confirmed that the tensile strength was weak compared to the hyaluronic acid-alginate support.

<Experimental Example 3>

In order to check the proliferation of chondrocytes in the pores inside the cell support, the DNA of the cells in the support was taken using DNase on the day, 7 and 14 of the culture period, and a bis-benzimidazole dye (Hoechst dye 33258, Polyscience) was used. Inc., Northampton, UK) and the amount of DNA was measured and compared using a fluorescence spectrometer.

FIG. 5 shows that the rabbit chondrocytes were proliferated in the pores of the hyaluronic acid support prepared in Comparative Example 1 and the hyaluronic acid-alginate support prepared in Example 1, respectively, and then DNA was taken from the DNA. It is the result of quantification. As shown in FIG. 5, the amount of DNA of chondrocytes cultured on the hyaluronic acid-alginate support prepared in Example 1 is higher than that of the chondrocytes cultured on the hyaluronic acid support prepared by Comparative Example 1, which is said to be larger. Can be. And as the content of alginate increases when the cells are cultured in the hyaluronic acid-alginate support, it can be confirmed that the proliferation of the cells increases.

<Experimental Example 4>

In order to confirm the appearance of the cells attached to the pores of the hyaluronic acid-alginate support prepared in Example 1 was observed using a scanning electron microscope.

1x10 ⁶ chondrocytes were proliferated on the hyaluronic acid support prepared in Comparative Example 1 and the hyaluronic acid-alginate support prepared in Example 1, and then a sample was taken and washed once with PBS. Next, soaked in formaldehyde solution for 4 hours to fix the cells and lyophilized. Then, the prepared sample was attached to a metal stub, coated with gold, and then magnified 1000 times with a scanning electron microscope.

6 is a view of chondrocytes attached to the hyaluronic acid support and B is a view of chondrocytes attached to the hyaluronic acid-alginate support. As shown in FIG. 6, the amount of chondrocytes attached to the hyaluronic acid-alginate support was higher than that of the hyaluronic acid support.

<Experimental Example 5>

In order to determine the degree of differentiation of cells in the pores inside the cell support, the amount of type 2 collagen and s-GAG (sulfate-glycosaminoglycan), which are characteristic of differentiated cells, was compared with different culture periods.

7 is 7 days, 14 and 21 days after the proliferation of rabbit chondrocytes in the pores of the hyaluronic acid support prepared in Comparative Example 1 and the hyaluronic acid-alginate support prepared in Example 1, Whether or not they were differentiated into chondrocytes was confirmed by the presence of type 2 collagen gene. Presence of collagen type 2 was performed using RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) using primers paired with the nucleotide sequences shown in Table 2 below. Reverse transcription polymerase chain reaction was initiated by polymerase chain reaction using reverse transcriptase and oligo- (dT) priming. In the case of type 2 collagen, polymerase chain reaction was repeated 38 times under conditions such as 30 seconds (denaturation) at 94 ° C, 30 seconds (annealing) at 62 ° C, and 1 minute (elongation) at 72 ° C. In the case of GAG, polymerase chain reaction was repeated 30 times under conditions such as 30 seconds (denaturation) at 94 ° C, 30 seconds (annealing) at 60 ° C, and 1 minute (elongation) at 72 ° C.

gene Primer sequence (5 '→ 3') Annealing temperature Product length Number of cycles Type 2 collagen AACTGGCAAGCAAGGAGACA (SEQ ID NO: 1) AGTTTCAGGTCTCTGCAGGT (SEQ ID NO: 2) 62 ℃ 472 bp 38 GAPDH TGGTATCGTGGAAGGACTCATGAC (SEQ ID NO: 3)
ATGCCAGTGAGCTTCCCGTTCAGC (SEQ ID NO: 4) 60 ° C 190 bp 30

As shown in FIG. 7, in the case of type 2 collagen, an amplified 379 bp band was observed, and it was confirmed that differentiation of hyaluronic acid-alginate support into chondrocytes was well performed. In addition, in the case of the hyaluronic acid-alginate support prepared according to Example 1, it was found that differentiation was smoothly performed because the band indicating the presence of type 2 collagen gradually increased as the incubation time elapsed. The higher the higher the differentiation rate was confirmed. On the other hand, in the case of the hyaluronic acid support prepared by Comparative Example 1, the band was not visible until 14 days and the weak band was confirmed on the 21st day.

FIG. 8 shows that the chondrocytes were differentiated into chondrocytes after 21 days of proliferation of rabbit chondrocytes in the pores of the hyaluronic acid support prepared in Comparative Example 1 and the hyaluronic acid-alginate support prepared in Example 1. FIG. Whether s-GAG and collagen will be confirmed by quantification.

The amount of s-GAG was taken on the 21st day of the hyaluronic acid-alginate support in which chondrocytes were cultured and hydrolyzed for 48 hours in a 60 ° C papain solution. After hydrolysis, 100 μL and 2.5 mL of a dye solution in which 16 mg dimethylmethylene blue (DMMB) was dissolved in 1 liter of distilled water were mixed and measured at an absorbance of 525 nm. The amount of collagen was taken on the 21st day of hyaluronic acid-alginate scaffolds in which chondrocytes were cultured, and hydrolyzed in 115 ° C., 6 N hydrogen chloride solution for 18 hours, followed by dimethylaminobenzaldehyde and chloramine-T. The amount was measured at absorbance 550 nm.

The amount of s-GAG of chondrocytes cultured on the hyaluronic acid-alginate support prepared in Example 1 was higher than the amount of s-GAG of chondrocytes cultured on the hyaluronic acid support prepared in Comparative Example 1. However, the amount of s-GAG did not show significant difference according to the content of alginate when standardized by DNA amount. In addition, the amount of collagen was confirmed that there is no difference in both the support prepared by Comparative Example 1 and Example 1.

As can be seen from the above results, the hyaluronic acid-alginate support did not show a significant difference in the differentiation of the hyaluronic acid support, but the adhesion of chondrocytes inside the hyaluronic acid-alginate support was higher than that of the hyaluronic acid support. The amount of GAG was measured higher than the hyaluronic acid support.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Seoul National University Industry Foundation <120> Preparation method of interpenetrating polymer network (IPN)          scaffold for cell delivery comprising sodium hyaluronate and          sodium alginate <130> DP-2010-0712 <160> 4 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for collagen II <400> 1 aactggcaag caaggagaca 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for collagen II <400> 2 agtttcaggt ctctgcaggt 20 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for GAPDH <400> 3 tggtatcgtg gaaggactca tgac 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for GAPDH <400> 4 atgccagtga gcttcccgtt cagc 24

Claims (10)

Dissolving hyaluronic acid and alginate in an aqueous sodium hydroxide solution;
A homogenization step of adding and homogenizing an epoxy-based crosslinking agent to the dissolved hyaluronic acid-alginate solution;
A hydrogelation step of hydrogelizing the homogenized hyaluronic acid-alginate solution;
Washing the hydrogelized hyaluronic acid-alginate hydrogel with an aqueous calcium chloride solution;
Expanding and swelling the washed hyaluronic acid-alginate hydrogel in an aqueous calcium chloride solution to form an interpenetrating polymer network structure and expand the network to obtain porosity;
Removing calcium chloride remaining in the expanded hyaluronic acid-alginate hydrogel with distilled water; And
A freeze-drying step of lyophilizing the hyaluronic acid-alginate hydrogel to obtain a porous hyaluronic acid support, characterized in that it comprises a freeze-drying step of producing a support for cell delivery of the interpenetrating polymer network structure. The method of claim 1, wherein the dissolved hyaluronic acid-alginate solution comprises 70 to 90% by weight of hyaluronic acid and 10 to 30% by weight of alginate. The method of claim 1, wherein the concentration of the aqueous sodium hydroxide solution used in the dissolution step Method for producing a support for cell delivery of interpenetrating polymer network structure, characterized in that 0.05N to 1.0N. The method of claim 1, wherein the hydrogelation step of the homogenized hyaluronic acid-alginate solution is reacted for 1 to 6 hours at 40-80 ° C. The method of claim 1, wherein the network formation and expansion step of the interpenetrating polymer network structure of the hyaluronic acid-alginate hydrogel to form and expand the interpenetrating polymer network structure using calcium chloride aqueous solution for 6 hours to 7 days Method for preparing a support for cell delivery. The method of claim 1, wherein the epoxy crosslinking agent used in the homogenization step is polyethylene glycol diglycidyl ether, epichlorohydrin, methyl glycidyl ether, phenyl glycidyl ether, lauryl alcohol glycidyl ether, ethylene glycol Dimethacrylate, 1,4-butadiol diglycidyl ether and ethylene glycol diglycidyl ether any one selected from the group consisting of a method for producing a support for cell delivery of interpenetrating polymer network structure. The method of claim 1, wherein the support for cell delivery comprises an epoxy-based crosslinking agent in an amount of 1 to 80 parts by weight based on 100 parts by weight of the hyaluronic acid-alginate solution. A support for cell transfer of an interpenetrating polymer network structure comprising hyaluronic acid and alginate, obtained by the method of any one of claims 1 to 7, and having a pore of 30 to 500 µm. The support according to claim 8, wherein the cells are selected from the group consisting of chondrocytes, stem cells, neurons, brain cells, muscle cells, sensory cells and hematopoietic cells. The support for cell delivery according to claim 8, wherein the support for cell transfer contains 3 to 10 parts by weight of an epoxy-based crosslinking agent with respect to 100 parts by weight of a hyaluronic acid-alginate solution. A support for cell delivery of interpenetrating polymer network structure, characterized in that it is changed to.

Images