KR101221003B1 - Methods for Modulating Thermostability and Acid Tolerance of Microbes - Google Patents

Abstract

The present invention comprises the steps of (a) performing substitutional mutation of homoserine o-succinyltransferase (MetA) -coding nucleotide sequence; And (b) transforming said mutated MetA-encoding sequence into microbial cells. Variant MetA of the present invention exhibits greatly improved stability to high temperature and / or acidic conditions, and microorganisms, particularly bacteria expressing variant MetA, exhibit improved growth rates under vigorous environments such as high temperature and / or acidic conditions. Indicates.

MetA, thermal stability, growth rate, acid resistance

Description

Method for Modulating Thermostability and Acid Resistance of Microorganisms {Methods for Modulating Thermostability and Acid Tolerance of Microbes}

The present invention relates to a method of controlling (ie, increasing or decreasing) the thermal stability or acid resistance of a microorganism and homoserine o-succinyltransferase (MetA) with increased thermal stability or acid resistance.

The growth of mesophilic bacteria Escherichia coli is limited by elevated temperature (13, 14). Quite unexpectedly, early studies found that E. coli did not grow at temperatures above 44 ° C because of the instability of a protein, homoserine o-succinyltransferase (MetA) (13, 14). , 15, 16). MetA (EC 2.1.3.46), the first enzyme in the process of methionine biosynthesis, catalyzes the transfer of succinate from succinyl-CoA to L-homoserine (3, 22). Recent studies report that MetA _{E. coli} tends to unfold even at 25 ° C. in vitro ; Unfolding is maximized at 44 ° C. after which the protein aggregates in bulk (5). In Vivo , The soluble fraction of cytoplasmic protein does not contain MetA _{E. coli} at temperatures higher than 44 ° C. (5). MetA _{E. coli} from Salmonella enterica is not only sensitive to temperature increase but also to weak organic acids including benzoate, propionate and acetate (11). Moreover, hydrogen peroxide increases the sensitivity to both heat and acid, oxidatively damaging unstabilized MetA (11). It argued that Carter and co-workers (11) is synthesized in the presence of an increased temperature and / or the weak organic acid is an excess MetA _S.enterica cause toxicity to the cells results in the accumulation of insoluble aggregates of inhibiting bacterial growth-Price .

Based on all previous data and the fact that MetA is the control point of methionine biosynthesis, it has been suggested that MetA plays a central role in the regulation of bacterial growth (2). MetA's high sensitivity to many stressors means that MetA can function as a metabolic fuse, allowing E. coli to detect unfavorable growth conditions (11). In this respect, it is noteworthy that methionine attenuates the high temperature and the inhibitory effects of acetic acid on the growth of E. coli (7, 12, 13 14).

However, no attempt has been made to improve the thermal stability of E. coli by improving the enzymes involved in the biosynthesis of methionine, especially MetA. The reason is that it is difficult to improve the thermostability of the enzyme itself by improving the enzyme of mesophilic bacteria, and it is very difficult to predict whether the result of such improvement can increase the high temperature growth rate of the bacteria.

For example, US Patent Application Publication No. 20050233308 discloses a method for improving the thermal stability of enzymes by substituting the Lys, Ser and Ser residues of the protein with Arg, Thr and Ala, respectively. However, the patent document only predicts amino acid residues involved in enzyme thermal stability by studying orthologs of mesophilic bacteria Corynebacterium glutamicum and thermophilic bacteria Corynebacterium efficiens . That is, this patent document does not provide practical data that the thermal stability of the enzyme itself can be improved by improving the enzyme, and does not disclose that the high temperature growth rate of bacteria can be improved by the improvement of the enzyme. Moreover, this patent document does not disclose at all about MetA which is the improvement object of this invention.

US Patent Application Publication No. 20020137094 discloses a method for predicting amino acid residues involved in thermal stability through multiple alignments of protein sequences. This patent document does not provide practical data that the thermal stability of the enzyme itself can be improved by improving the enzyme, and does not disclose that the high temperature growth rate of bacteria can be improved by improving the enzyme.

Therefore, the attempt of the present invention to widen the optimum growth temperature of microorganisms, in particular E. coli , by increasing the thermal stability of the MetA enzyme is of great interest.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop a method which can greatly increase / decrease the growth of bacteria, in particular E. coli, at moderate / high temperature and / or acid conditions. As a result, the invention found that substitution substitution of the amino acid sequence of wild-type homoserine o-succinyltransferase (MetA) can increase / decrease the growth of bacteria at moderate / high temperature and / or acid conditions. To complete.

Accordingly, it is an object of the present invention to provide a method of controlling the thermal stability or acid resistance of homoserine o-succinyltransferase (MetA).

Another object of the present invention is to provide a method for controlling the thermal stability or acid resistance of microorganisms.

It is still another object of the present invention to provide homoserine o-succinyltransferase (MetA) with controlled thermal stability or acid resistance.

Another object of the present invention is to provide a nucleic acid molecule encoding the above-mentioned homoserine o-succinyltransferase (MetA) mutant.

Another object of the present invention is to provide a recombinant vector comprising the above-described nucleic acid molecule mutants.

Another object of the present invention is to provide a host cell transformed with the nucleic acid molecule mutants imagined.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the invention, the invention provides a method of controlling the thermal stability or acid resistance of a microorganism comprising the following steps:

(a) subjecting a substitution variant of homoserine o-succinyltransferase (MetA) -coding nucleotide sequence; And (b) transforming the mutated MetA-coding sequence into a microbial cell.

According to another aspect of the present invention, the present invention provides for the thermal stability of a cell comprising the step of transforming the cell with a homoserine o-succinyltransferase (MetA) -coding nucleotide sequence comprising the following substitutional mutations: A method of increasing acid resistance is provided: (a) replacing the 61st amino acid Ser with Thr; (b) substituted 213th amino acid Glu with Val; (c) the 229th amino acid Ile is substituted with Thr; (d) replace the 267th amino acid Asn with Asp; (e) substitution of Lys for 271st amino acid Asn; (f) substitution of the 96th amino acid Gln with Lys; (g) replace 110th amino acid Leu with Val; (h) replacing the 124th amino acid Ile with Leu; (i) replacing the 160 th amino acid Arg with Leu; (j) substitution of the 195th amino acid Ala for Thr; (k) replacing the 200th amino acid Ala with Glu; (l) substitution of the 218th amino acid Asp with Gly; (m) substitution of the 229th amino acid Ile with Tyr; (n) substitution of the 247th amino acid Phe with Tyr; Or (o) a combination of the above (a)-(n) substitutions.

The inventors have sought to develop a novel method which can significantly increase / decrease the growth of microorganisms, preferably bacteria, preferably E. coli , at moderate / high temperature and / or acid conditions. As a result, it was found that substitution substitution of the amino acid sequence of wild-type homoserine o-succinyltransferase (MetA) can increase / decrease the growth of bacteria at moderate / high temperature and / or acid conditions.

The method of the present invention modifies MetA to increase / decrease the thermal stability or acid resistance of MetA, and transform the cells with these mutated MetA genes to enhance the growth of the cells in medium / high temperature and / or acid conditions. .

The present invention is the first invention to improve MetA to improve / reduce the thermal and / or acid stability of microorganisms.

The method of the present invention may be expressed as "a method of increasing / decreasing microbial thermal stability or acid resistance" or a "method of improving / decreasing the growth rate of microorganisms under medium / high temperature and / or acidic conditions". .

In accordance with the present invention, substitutions to increase / decrease the thermal and / or acid stability of microorganisms can be made at various positions of MetA.

Preferably, substitution of MetA comprises: (a) substitution of the 61st amino acid Ser with Thr; (b) substituted 213th amino acid Glu with Val; (c) the 229th amino acid Ile is substituted with Thr; (d) replace the 267th amino acid Asn with Asp; (e) substitution of Lys for 271st amino acid Asn; (f) substitution of the 96th amino acid Gln with Lys; (g) replace 110th amino acid Leu with Val; (h) replacing the 124th amino acid Ile with Leu; (i) replacing the 160 th amino acid Arg with Leu; (j) substitution of the 195th amino acid Ala for Thr; (k) replacing the 200th amino acid Ala with Glu; (l) substitution of the 218th amino acid Asp with Gly; (m) substitution of the 229th amino acid Ile with Tyr; (n) substitution of the 247th amino acid Phe with Tyr; Or (o) a combination of the above (a)-(n) substitutions.

According to a more preferred embodiment of the present invention, the substitutional variant of the present invention increases the thermal stability or acid resistance of the microorganism, which comprises: (a) replacing the 61st amino acid Ser with Thr; (b) substituted 213th amino acid Glu with Val; (c) the 229th amino acid Ile is substituted with Thr; (d) replace the 267th amino acid Asn with Asp; (e) substitution of Lys for 271st amino acid Asn; (f) substitution of the 96th amino acid Gln with Lys; (g) replace 110th amino acid Leu with Val; (h) replacing the 124th amino acid Ile with Leu; (k) replacing the 200th amino acid Ala with Glu; (m) substitution of the 229th amino acid Ile with Tyr; (n) substitution of the 247th amino acid Phe with Tyr; Or (o) a combination of the above substitutions.

According to a more preferred embodiment of the present invention, substitutional variants of the present invention reduce the thermal stability or acid resistance of the microorganism, and (i) substituting Leu for the 160 th amino acid Arg; (j) substitution of the 195th amino acid Ala for Thr; (l) substitution of the 218th amino acid Asp with Gly; Or (o) a combination of the above substitutions.

The position of amino acid residues used herein referring to the MetA amino acid sequence is described based on the MetA amino acid sequence (SEQ ID NO: 2) of E. coli .

According to a preferred embodiment of the present invention, the substitution of the present invention comprises (a) replacing the 61-th amino acid Ser with Thr, wherein the fourth Ser in the Leu-Ser-Asn-Ser-Pro-Leu-Gln-Val sequence of MetA. Is replaced by Thr; (b) substitution of the 213th amino acid Glu with Val replaces the fourth Glu with Val in the sequence Ile-Leu-Ala-Glu-Thr-Glu-Xaa ₁ -Gly (Xaa ₁ is Asp or Glu) of MetA; (c) substitution of the 229th amino acid Ile with Thr replaces Ile with Thr in the Asp-Lys-Arg-Ile-Ala-Phe-Val-Thr sequence of MetA; (d) substitution of the 267th amino acid Asn with Asp replaces Asn with Asp in the Tyr-Phe-Pro-Xaa ₁ -Asn-Asp-Pro-Gln (Xaa ₁ is Lys, His or Gln) sequence of MetA; (e) substitution of the 271st amino acid Asn with Lys replaces Asn with Lys in the Asp-Pro-Gln-Asn-Xaa ₁ -Pro-Arg-Ala (Xaa ₁ is Lys, Ile or Thr) sequence of MetA; (f) substitution of the 96th amino acid Gln with Lys replaces the fourth Gln with Lys in the Glu-Asp-Ile-Gln-Asp-Gln sequence of MetA; (g) substitution of the 110th amino acid Leu with Val replaces the fourth Leu with Val in the Gly-Ala-Pro-Leu-Gly-Leu-Val-Glu sequence of MetA; (h) substitution of Leu for the 124th amino acid Ile with Trp-Pro-Gln-Ile-Xaa ₁ -Gln-Val-Leu (Xaa ₁ Lys or Arg) replaces the fourth Ile with Leu in the sequence; (i) Lys-Gln-Thr-Arg-Xaa ₁ -Xaa ₂ -Lys-Xaa ₃ of MetA replaces 160th amino acid Arg with Leu (Xaa ₁ is Ile, Thr or Ala; Xaa ₂ is Asp or Glu; Xaa ₃ is Leu or Ile) replacing the fourth Arg with Leu; (j) Substituting the 195 th amino acid Ala for Thr replaces the fourth Ala with Thr in the Ser-Arg-Tyr-Ala-Asp-Phe-Pro-Xaa ₁ (Xaa ₁ is Arg or Gly) sequence of MetA; (k) substitution of the 200th amino acid Ala with Glu replaces the fourth Ala with Glu in the PPhe-Pro-Ala-Ala-Leu-Ile-Arg-Asp sequence of MetA; (l) substitution of the 218th amino acid Asp with Gly replaces the fourth Asp with Gly in the Glu-Xaa ₁ -Gly-Asp-Ala-Tyr-Leu-Phe (Xaa ₁ is Asp or Glu) sequence; (m) substitution of the 229th amino acid Ile with Tyr replaces the fourth Ile with Tyr in the Asp-Lys-Arg-Ile-Ala-Phe-Val-Thr sequence of MetA; (n) Substitution of 247 th amino acid Phe with Tyr replaces the fourth Phe with Tyr in the sequence Ala-Xaa ₁ -Glu-Phe-Phe-Arg-Asp-Val (Xaa ₁ is Ser, Gln or Gly) of MetA. Will; Or (o) a combination of the above (a)-(n) substitutions.

According to a more preferred embodiment of the invention, the substitution variants of the invention comprise (c) substitution of Thr for 229th amino acid Ile; (d) replace the 267th amino acid Asn with Asp; (e) substitution of Lys for 271st amino acid Asn; (h) replacing the 124th amino acid Ile with Leu; (i) replacing the 160 th amino acid Arg with Leu; (m) substitution of the 229th amino acid Ile with Tyr; Or (o) a combination of the above substitutions.

Substitutional variation of certain amino acids of MetA can be carried out through various methods known in the art. For example, substitutional mutations can be performed by PCR mutagenesis, transposon mutagenesis, location-directed mutagenesis, insertional mutagenesis and cassette mutagenesis (Sambrook, J. et al. , Molecular Cloning.A Laboratory Manual , 3rd ed.Cold Spring Harbor Press (2001)), preferably via site-directed mutagenesis, and site-directed mutagenesis can be via PCR and the like. When position-directed mutation is caused by PCR, a primer having a sequence substituted with a base at a specific position is used.

The process of transforming a mutated MetA-coding sequence into a cell can be carried out through various methods known in the art. For example, CaCl ₂ method (Cohen, SN et al. , Proc. Natl. Acac. Sci. USA , 9: 2110-2114 (1973)), one method (Cohen, SN et al. , Proc. Natl. Acac. Sci. USA , 9: 2110-2114 (1973); and Hanahan, D., J. Mol. Biol. , 166: 557-580 (1983)) and electroporation methods (Dower, WJ et al. , Nucleic Acids Res. , 16: 6127-6145 (1988)) can be used for the transformation process.

According to a preferred embodiment of the invention, MetA of the invention is derived from mesophilic bacteria. As used herein, the term “medium bacteria” means a bacterium that exhibits the highest growth rate in the mild temperature range, typically 15-40 ° C. Preferably, the mesophilic bacteria are Escherichia, Pseudomonas, Xanthomonas, Serratia, Lactobacillus, Bacillus, Citrobacter, Salmonella or Klebsiella , more preferably Escherichia coli, Pseudomonas aeruginosa, Xanthomonas rinicola, Serratia marcescenstis, Lactobacillus subtilis Citrobacter freundii, Salmonella enterica or Klebsiella pneumoniae , most preferably Escherichia coli .

According to a preferred embodiment of the invention, the cells transformed with MetA-coding nucleotide sequences are mesophilic bacteria, more preferably Escherichia, Pseudomonas, Xanthomonas, Serratia, Lactobacillus, Bacillus, Citrobacter, Salmonella or Klebsiella More preferably, Escherichia coli, Pseudomonas aeruginosa, Xanthomonas rinicola, Serratia marcescens, Lactobacillus lactis, Bacillus subtilis, Citrobacter freundii, Salmonella enterica or Klebsiella pneumoniae , and most preferably Escherichia coli .

According to the method of the present invention, the thermal stability and / or acid resistance of MetA is greatly increased / reduced, and eventually the thermal stability and / or acid resistance of transformed cells comprising the mutant MetA is greatly increased / reduced.

As used herein, the term “thermal stability” means to exhibit significant growth rates in the temperature range 20-60 ° C., preferably 30-50 ° C., more preferably 30-48 ° C., and most preferably 30-44 ° C. . The term "thermal stability" as used herein referring to MetA means the stability of the enzyme to thermal effects. All enzyme proteins destabilize and eventually degrade as the temperature increases, and each enzyme protein has a specific temperature range (ie, a temperature range in which the protein remains stable and active). Increased thermal stability means that the enzyme protein maintains enzymatic activity and / or retains relatively higher activity at increased temperatures.

The term “acid resistance” as used herein referring to microorganisms means that it can grow under acidic conditions (ie, low pH conditions). The term “acid resistance” as used herein referring to MetA refers to the stability of the enzyme at lower pH.

According to the method of the present invention, it is possible to efficiently carry out bioprocesses using microorganisms under high temperature and / or acidic conditions.

As can be seen in FIGS. 10 and 11, MetA of the present invention is responsible for thermal stability in various bacteria and has a conserved sequence. In this respect, the mutagenesis approach of the present invention that modulates the thermal stability or acid resistance of bacterial cells or MetA can be applied to many microorganisms, for example Escherichia, Pseudomonas, Xanthomonas, Serratia, Lactobacillus, Bacillus, Citrobacter, Salmonella or Klebsiella , more preferably Escherichia coli, Pseudomonas aeruginosa, Xanthomonas rinicola, Serratia marcescens, Lactobacillus lactis, Bacillus subtilis, Citrobacter freundii, Salmonella enterica or Klebsiellapneumonia can be applied to Escher , and most preferably Escherichia .

According to another aspect of the invention, the invention provides homoserine o-succinyltransferase (MetA) having increased / decreased thermal stability or acid resistance comprising the following amino acid substitutions: (a) 61 Th amino acid Ser is replaced by Thr; (b) substituted 213th amino acid Glu with Val; (c) the 229th amino acid Ile is substituted with Thr; (d) replace the 267th amino acid Asn with Asp; (e) substitution of Lys for 271st amino acid Asn; (f) substitution of the 96th amino acid Gln with Lys; (g) replace 110th amino acid Leu with Val; (h) replacing the 124th amino acid Ile with Leu; (i) replacing the 160 th amino acid Arg with Leu; (j) substitution of the 195th amino acid Ala for Thr; (k) replacing the 200th amino acid Ala with Glu; (l) substitution of the 218th amino acid Asp with Gly; (m) substitution of the 229th amino acid Ile with Tyr; (n) substitution of the 247th amino acid Phe with Tyr; Or (o) a combination of the above (a)-(n) substitutions.

According to a preferred embodiment of the present invention, the substitution of the present invention comprises (a) replacing the 61-th amino acid Ser with Thr, wherein the fourth Ser in the Leu-Ser-Asn-Ser-Pro-Leu-Gln-Val sequence of MetA. Is replaced by Thr; (b) substitution of the 213th amino acid Glu with Val replaces the fourth Glu with Val in the sequence Ile-Leu-Ala-Glu-Thr-Glu-Xaa ₁ -Gly (Xaa ₁ is Asp or Glu) of MetA; (c) substitution of the 229th amino acid Ile with Thr replaces Ile with Thr in the Asp-Lys-Arg-Ile-Ala-Phe-Val-Thr sequence of MetA; (d) substitution of the 267th amino acid Asn with Asp replaces Asn with Asp in the Tyr-Phe-Pro-Xaa ₁ -Asn-Asp-Pro-Gln (Xaa ₁ is Lys, His or Gln) sequence of MetA; (e) substitution of the 271st amino acid Asn with Lys replaces Asn with Lys in the Asp-Pro-Gln-Asn-Xaa ₁ -Pro-Arg-Ala (Xaa ₁ is Lys, Ile or Thr) sequence of MetA; (f) substitution of the 96th amino acid Gln with Lys replaces the fourth Gln with Lys in the Glu-Asp-Ile-Gln-Asp-Gln sequence of MetA; (g) substitution of the 110th amino acid Leu with Val replaces the fourth Leu with Val in the Gly-Ala-Pro-Leu-Gly-Leu-Val-Glu sequence of MetA; (h) substitution of Leu for the 124th amino acid Ile with Trp-Pro-Gln-Ile-Xaa ₁ -Gln-Val-Leu (Xaa ₁ Lys or Arg) replaces the fourth Ile with Leu in the sequence; (i) Lys-Gln-Thr-Arg-Xaa ₁ -Xaa ₂ -Lys-Xaa ₃ of MetA replaces 160th amino acid Arg with Leu (Xaa ₁ is Ile, Thr or Ala; Xaa ₂ is Asp or Glu; Xaa ₃ is Leu or Ile) replacing the fourth Arg with Leu; (j) substitution of the 195th amino acid Ala with Thr replaces the fourth Ala with Thr in the Ser-Arg-Tyr-Ala-Asp-Phe-Pro-Xaa ₁ (Xaa ₁ is Arg or Gly) sequence of MetA; (k) substitution of the 200th amino acid Ala with Glu replaces the fourth Ala with Glu in the PPhe-Pro-Ala-Ala-Leu-Ile-Arg-Asp sequence of MetA; (l) substitution of the 218th amino acid Asp with Gly replaces the fourth Asp with Gly in the Glu-Xaa ₁ -Gly-Asp-Ala-Tyr-Leu-Phe (Xaa ₁ is Asp or Glu) sequence; (m) substitution of the 229th amino acid Ile with Tyr replaces the fourth Ile with Tyr in the Asp-Lys-Arg-Ile-Ala-Phe-Val-Thr sequence of MetA; (n) Substitution of 247 th amino acid Phe with Tyr replaces the fourth Phe with Tyr in the sequence Ala-Xaa ₁ -Glu-Phe-Phe-Arg-Asp-Val (Xaa ₁ is Ser, Gln or Gly) of MetA. Will; Or (o) a combination of the above (a)-(n) substitutions.

According to a more preferred embodiment of the invention, the substitution variants of the invention comprise (c) substitution of Thr for 229th amino acid Ile; (d) replace the 267th amino acid Asn with Asp; (e) substitution of Lys for 271st amino acid Asn; (h) replacing the 124th amino acid Ile with Leu; (i) replacing the 160 th amino acid Arg with Leu; (m) substitution of the 229th amino acid Ile with Tyr; Or (o) a combination of the above substitutions.

Specific examples of amino acids of the variant MetA protein of the present invention are described in SEQ ID NO: 2.

According to another aspect of the present invention, the present invention provides a nucleic acid molecule encoding the above-described variant homoserine o-succinyltransferase (MetA) of the present invention.

As used herein, the term “nucleic acid molecule” is meant to encompass DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides, which are the basic building blocks of nucleic acid molecules, are modified from sugar or base sites, as well as natural nucleotides. Analogs are also included (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990)).

Specific examples of the nucleic acid molecule of the present invention include the nucleotide sequence represented by SEQ ID NO: 1.

According to another aspect of the present invention, the present invention provides a recombinant vector comprising a nucleic acid molecule encoding the above-described variant homoserine o-succinyltransferase (MetA).

The vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are described in Sambrook et al. , Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference.

The vector of the present invention can typically be constructed as a vector for cloning or as a vector for expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. It is preferable that the nucleic acid molecule of the present invention is derived from a prokaryotic cell, and the prokaryotic cell is used as a host in consideration of the convenience of culture. The vector of the present invention can typically be constructed as a vector for cloning or as a vector for expression.

For example, when the vector of the present invention is an expression vector and the prokaryotic cell is a host, a strong promoter (for example, a tac promoter, a lac promoter, a lac UV5 promoter, an lpp promoter, a p _L ^λ promoter) capable of promoting transcription , p _R ^λ promoters, rac 5 promoters, amp promoters, recA promoters, SP6 promoters, trp promoters and T7 promoters, etc.), ribosome binding sites for initiation of translation and transcription / detox termination sequences. When E. coli is used as the host cell, the promoter and operator sites of the E. coli tryptophan biosynthetic pathway (Yanofsky, C., J. Bacteriol. , 158: 1018-1024 (1984)), and the leftward promoter of phage λ ( p _L ^λ promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet. , 14: 399-445 (1980)) can be used as regulatory sites.

The vectors that can be used in the present invention include plasmids (e.g., pSClOl, ColEl, pBR322, pUC8 / 9, pHC79, pUC19, pET etc.), phage (e.g., λgt4λB, λ- And M13) or a virus (e.g., SV40 or the like).

The vectors of the invention may be fused with other sequences to facilitate purification of MetA expressed therefrom. Sequences to be fused include, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA), 6x His (hexahistidine; Quiagen, USA), and most preferably Is 6 × His. Because of the additional sequence for such purification, proteins expressed in the host are rapidly and easily purified through affinity chromatography.

According to a preferred embodiment of the present invention, the fusion protein expressed by the vector containing the fusion sequence is purified by affinity chromatography. For example, when glutathione-S-transferase is fused, glutathione, which is a substrate of this enzyme, can be used, and when 6x His is used, Ni-NTA His-binding resin column (Novagen, USA) can be used for desired MetA. Can be obtained quickly and easily.

Meanwhile, the vector of the present invention includes an antibiotic resistance gene commonly used in the art as an optional marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin And resistance genes for tetracycline.

According to another aspect of the present invention, the present invention provides a host cell transformed with the above-described variant nucleic acid molecule of the present invention.

Host cells capable of stable and continuous cloning and expression of the vectors of the present invention are known in the art and can be used with any host cell, for example E. coli JM109, E. coli BL21 (DE3), E. coli RR1. , Bacillus genus strains, such as E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcensons, and various Pseudomonas Enterobacteria such as species and strains.

The method of carrying the vector of the present invention into a host cell is performed by the CaCl ₂ method (Cohen, SN et al. , Proc. Natl. Acac. Sci. USA , 9: 2110-2114 (1973) when the host cell is a prokaryotic cell). ), One method (Cohen, SN et al. , Proc. Natl. Acac. Sci. USA , 9: 2110-2114 (1973); and Hanahan, D., J. Mol. Biol. , 166: 557-580 (1983)) and electroporation methods (Dower, WJ et al. , Nucleic. Acids Res. , 16: 6127-6145 (1988)) and the like.

Vectors injected into host cells can be expressed in host cells, in which case a large amount of MetA is obtained. For example, when the expression vector includes a lac promoter, the host cell may be treated with IPTG to induce gene expression.

As detailed above, the present invention is the first report to improve microbial (eg, E. coli ) growth rates at high temperatures with only MetA stabilization. Stabilization of MetA provides a new theoretical basis for the design of platform microorganisms, preferably bacteria (eg, E. coli ) strains, which grow at higher temperatures, and enable bioprocessing at reduced cost and time. To help.

The features and advantages of the present invention are summarized as follows:

(a) The present invention is the first invention in which MetA is improved to control (ie, increase / decrease) the thermal and / or acid stability of microorganisms.

(b) Variant MetA exhibits greatly increased stability at high and / or acidic conditions or reduced stability at mid temperature.

(c) Microorganisms expressing variant MetA, in particular bacteria, exhibit improved growth rates under vigorous environments such as very high temperature and / or low acidic conditions.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Experimental Materials and Experimental Methods

Bacterial strains and plasmids. The bacterial strains and plasmids used in the present invention are described in Table 1.

Bacteria Strain and Plasmids Strain or plasmid Related Technical Information ^a Source or Reference Escherichia coli W3110 Wild-type Laboratory stock DH5α
F-, supE44 hsdR17 recA1 gyrA96
endA1 thi-1 relA1 deoR λ- (17)
JW3973 Δ metA, Kan ^r Keio collection
(Japan) WE
JW3973, prototroph with non-mutated metA _{E. coli} on chromosome Invention
333
JW3973, Prototrop with mutated metA _{E. coli} -333 on chromosome Invention
T61
JW3973, Prototrop with metA _{E. coli} substituted for S61T on chromosome Invention
V213
JW3973, Prototrop with metA _{E. coli} replaced with E213V on chromosome Invention
T229
JW3973, Prototrop with metA _{E. coli} substituted with I229T on chromosome Invention
D267
JW3973, Prototrop with metA _{E. coli} substituted with N267D on chromosome Invention
K271
JW3973, Prototrop with metA _{E. coli} replaced with N271K on chromosome Invention
WG
JW3973, Prototrop with metA _Geo on Chromosome Invention
BL21 (DE3) F- ompT hsdS _B (r- _B m- _B gal dcm (DE3) Novagen, USA Geobacilli Caustophilus Wild-type KCTC 3397 Plasmid pACYC177 Plasmid Vectors, Amp ^r , Kan ^r New England Biolabs, USA pET22b Expression vector, Amp ^r Novagen, USA pKD46
λ Red ( gam bet exo ) ara C rep101 (Ts) Amp ^r (4)
pPmetA pACYC177 , Amp ^r with metAp _E.coli Invention pMetA pPmetA, Amp ^r with metA _E.coli Invention pMetA-333
PPmetA, Amp ^r with thermally stable metA _E.coli Invention
pGeo-MetA pPmetA, Amp ^r with metA _Geo Invention

^a Amp ^r , ampicillin resistance; Kan ^r , kanamycin resistance; metAp _{E. coli} , a promoter of the _E. coli metA gene; metA _{E. coli} , E. coli metA gene; metA _Geo , G.kaustophilus metA gene.

Growth conditions. E. coli strains were incubated in minimal M9 medium with glucose (0.2%), LB (Difco, USA) or 2 × YT. Antibiotics were used at the following concentrations: ampicillin-100 μg ml ^-1 , kanamycin-25 μg ml ^-1 . L-methionine was added at a final concentration of 50 μg ml ⁻¹ . Geobacillus kaustophilus KCTC 3397 strain was incubated at 50 ° C. in aerobic state in Difco, USA.

Preparation of Plasmid DNA. Plasmid DNA was extracted from the cells using a plasmid mini prep kit (SolGent Co, Ltd., Korea). All restriction enzymes used in the present invention were purchased from New England BioLabs Inc., USA.

E. coli metA cloning. The natural promoter of metA was metA1 (CGCCTA CTCGAG ) from genomic DNA of E. coli strain W3110 (Dong-Eun Chang et al., Journal of Bacteriology , 181 (21): 6656-6663 (1999), available from ATCC). PPmetA plasmids were prepared by amplification using ATCGCAACGAGTTCCTCC) and metA2 (GCCTC AAAGCTTCATATG CTGATTACCTCACTACATACGC) primers, followed by cloning between XhoI and HindIII of the pACYC177 plasmid vector. The pMetA plasmid was prepared by cloning the metA structural genes amplified from the genomic DNA of E. coli strain W3110 using metA3 (CGCCTC CATATG CCGATTCGTGTGCCG) and metA4 (CGCCTC AAGCTT GGTGCCTGAGGTAAGGTGCTG) primers between NdeI and HindIII of the pPmetA plasmid.

Cloning of metA from thermophilic strain G. kaustophilus KCTC 3397 . After the metA _Geo amplified using Geo1 (CGCCTC CCAATCAACATTCCAAAAG CATATG) and Geo2 (CAGGGCGATTGTCGAAACACG) primers from genomic DNA was cloned into the restriction enzyme NdeI position of pPmetA plasmid. The resulting pGeo-MetA plasmid was infected with E. coli JW3973 (Δ metA ) (Baba, T., et al., Mol Syst Biol 2: 1-11 (2006)). Transformed cells were cultured in minimal M9 plates added with glucose and ampicillin.

Library construction and selection of thermally stable metA mutants. to remove the metA from pMetA plasmid with the promoter region gel-purified and then, this error-was used as a template of the fluorocarbon (error-prone) PCR. Random mutagenesis was performed using a Diversify PCR Random Mutagenesis Kit (Clontech Laboratories, Inc., USA) to obtain 3, 5 and 8 nucleotide variations per kilobase. PCR conditions were performed as described in the manual using metA5 (GTAGTGAGGTAATCAG CATATG ) and metA4 primers. PCR products were purified using QIAquick PCR Purification Kit (Qiagen, USA) and amplified more than once using the same primers and TaKaRa Ex Taq polymerase. PCR products were cloned into the pPmetA plasmid after treatment with NdeI and HindIII restriction enzymes. Freshly prepared the resulting DNA mixture as electroporation (freshly prepared) was infected with E. coli JW3973 (Δ metA) cells. Transformed cells were incubated at 37 ° C. in minimal M9 plates supplemented with glucose and ampicillin. In order to select clones that grow at high temperature, they were incubated at 44 ° C. in solid M9 glucose medium. The fastest growing mutation was then identified by culturing at 44 ° C. in liquid M9 glucose medium.

Insertion of metA mutants into the E. coli chromosome . The metA mutant was infected with the chromosome of E. coli JW3973 (Δ metA ) using the lambda red recombination system (4). 50 bp flanking sequences having 50 bp flanking sequences up- and down-stream using metA8 (ATCTGGATGTCTAAACGTATAAGCGTATGTAGTGAGG) and metA9 (ATCGCTTAACGATCGACTATCACAGAAGATTAATCC) primers, Vent polymerase (New England BioLabs Inc., USA) and the corresponding plasmids as templates The gene was synthesized. G. kaustophilus the metA were amplified using Geo4 (ATCTGGATGTCTAAACGTATAAGCGTATGTAGTGAGGTAATCAGGTTATGCCAATCAACATTCC) and Geo5 (ATCGCTTAACGATCGACTATCACAGAAGATTAATCCAGCGTTGGATTCATCAGGGCGATTGTCGAAACACG) primers from a template of genomic DNA. Freshly-prepared competent cells freshly prepared with E. coli JW3973 (Δ metA ) with helper plasmid pKD46 were transformed using the electroporation method described above (4). .

Transformed cells were incubated at 37 ° C. in glucose supplemented M9 methionine deficient medium. Grown colonies were checked for loss of kanamycin resistance and cultured on non-selective LB plates at 43 ° C. to remove the pKD46 plasmid. Inserted metA mutants were amplified from chromosomes and sequenced.

site-directed mutagenesis of metA . The Quick Change Multi Site-Directed Mutagenesis kit (Stratagene, USA) was used to introduce a number of direct mutations into metA . MetT (GCCTGCTTTCAAACACACACCTTTGCAGGTCG), metD (CTATTTCCCGCACGATGATCCGCAAAATACACC), metK (GATCCGCAAAAGACACCGCGAGCGAGC), metT2 (GCCAGTAAAGATAAGCGCACTGGAGTCTGGG)

Other site-directed metA mutations were prepared using the KOD-Plus-Mutation Induction Kit (Toyobo Co., Ltd) according to the manufacturer's protocol. The pMetA plasmid was used as a template and the primers are listed in Table 2. Mutant Y229 was constructed by overlapping extension PCR using the QuickChange II-E position-directed mutagenesis kit (Stratagene) and the primers used were: MetY-forward, GCCAGTAAAGATAAGCGCTACGCCTTTGTGACGGG; And MetY-reverse, the complementary sequence of MetY-forward. Changes in sequence are underlined.

Primer Sequences Used to Construct MetA Mutants primer Mutation Primer sequence K3-forward
K3-reverse
V3-forward
V3-reverse
L2-forward
L2-reverse
L1-forward
L1-reverse
T4-forward
T4-reverse
E1-forward
E1-reverse
G1forward
G1reverse
Y2-forward
Y2-reverse Q96K
Q96K
L110V
L110V
I124L
I124L
R160L
R160L
A195T
A195T
A200E
A200E
D218G
D218G
F247Y
F247Y A AGGATCAGAACTTTGACGGTTTG
AATATCTTCAAAGTTACAGTAGAAG
G G TGGGCCTGGTGGAGTTTAATG
GGCGCACCAGTTACAATCAAACC
CAG C TCAAACAGGTGCTGGAGTG
CGGCCAGTAAGCGACATCATTAAAC
CTC T CACCGAAAAACTCTCTGGC
TTTGCTTAGGAATGCCGTAGAGG
CTAT A CTGACTTTCCGGCAGCGTTG
CGCGAATGCGGTGCCAGGAATGAATC
CAG A GTTGATTCGTGATTACACCG
CCGGAAAGTCAGCATAGCGCGAATG
G G TGCATATCTGTTTGCCAGTAAAG
CCCTTCTTCCGTCTCTGCCAGAATTTC
GAAT A TTTCCGCGATGTGGAAGCC
CTGCGCCAGCGTTTGCGCATCATATTC

Incubation of E. coli strains in a temperature gradient incubator . Growth of E. coli strain in M9 glucose medium at different temperatures was studied using a temperature gradient incubator (TVS126MA, Adventec MSF Inc., USA). One colony at each strain was incubated in 5 ml of M9 medium at 30 ° C. overnight. The culture solution was diluted to an OD ₆₀₀ value of 0.05 in 300 ml of fresh M9 medium, distributed in 15 ml tubes, and incubated with shaking at 30-47 ° C. for 12 hours. Growth was measured while monitoring the optical density at 600 nm every 5 minutes.

Purification of Aggregated and Soluble Proteins. The metA chromosomal mutations of E. coli were flask cultured at 75 ° C. at 75 ° C. to medium-index (OD ₆₀₀ of about 0.6) at 30 ° C. 25 ml of culture were each transferred from 40 ° C. to 45 ° C. or treated with 30 mM acetic acid at 30 ° C. for 3 hours. The remaining 25 ml of culture was used as a control. Aggregated and soluble protein fractions were purified as previously described (5, 19).

SDS-PAGE and immunoblotting. Gel electrophoresis was performed using 12% SDS-PAGE. After electrophoresis, the proteins were electrophoresed to nitrocellulose membranes (Bio-Rad, USA). Rabbit anti-MetA serum (Peptron Inc., Korea) against synthetic oligopeptides consisting of 74-94 amino acids (2) of MetA was subjected to primary antibodies and horseradish peroxidase-binding anti-rabbit IgG (Pierce, USA) MetA protein was detected using as a secondary antibody. Use the SuperSignal West Pico Chemiluminescent Substrate kit (Pierce, USA) to emit immunoblots, scan them with Image Reader Fujifilm LAS-3000, and then use LabWorks software. Analyzed.

Cloning, Expression and Protein Purification. 6 × histidine select the wild-type and mutated metA metA the C- terminal (tag) that is coupled (in frame) was cloned into a NdeI / HindIII restriction enzymes position of pET22b plasmid. The plasmid DNA was purified and sequenced from ampicillin-resistant clones to confirm that the correct genes were cloned. The resulting plasmids were transformed into competent E. coli BL21 (DE3) cells. Colonies of one of the E. coli BL21 (DE3) strains with the corresponding plasmids were incubated overnight at 15 ° C. in 15 ml LB medium containing ampicillin. The culture was then inoculated in 500 ml 2 × YT medium containing ampicillin and incubated at 30 ° C. to an OD ₆₀₀ value of 0.6. After inducing protein expression by treatment with IPTG (final concentration 1 mM), the cultures were cooled to 22 ° C. After 4 hours of induction with IPTG, cells were obtained by centrifugation and pellets were stored in cold buffer (50 mM Tris-HCl, 300 mM NaCl, 10 mM MgCl2, 5 mM imidazole, pH 7.5) 3 ml buffer per g of wet cells. Resuspended at the ratio of. Cells were lysed with 0.5 mg / ml lysozyme, 1 mM PMSF and DNase I by stirring incubation at 4 ° C. for 30 minutes, and then at 10 × 20 s at 20 second intervals using Branson Sonifier (model 450). Ultrasonic grinding. Cell debris is removed by centrifugation at 12,000 × g for 40 minutes. Protein was purified from the supernatant using Ni-NTA agarose (Qiagen, USA). 2 ml of agarose suspension was incubated overnight at 4 ° C. with 6 ml of supernatant with vigorous rocking. Unbound proteins were removed by gravity filtration. The agarose was washed with 4 ml buffer (50 mM Tris-HCl, 300 mM NaCl, 100 mM imidazole, pH 7.5). Extract protein from agarose using 6 ml buffer (50 mM Tris-HCl, 300 mM NaCl, 250 mM imidazole, pH 7.5) and dialysate (2 l, 50 mM K-phosphate buffer, 150 mM NaCl, pH 7.6) The eluate was dialyzed by changing twice. It was then dialyzed for 6 hours with 50 mM potassium-phosphate buffer (pH 7.6) containing 150 mM NaCl and 50% glycerol. SDS-PAGE confirmed the presence of pure protein in all samples.

Determination of Enzyme Activity. The reaction rate was determined using an ND1000 UV / Vis spectrophotometer (Nanodrop Technologies, USA), monitoring the absorbance decrease at 232 nm (3) caused by the hydrolysis of the thioester bonds of succinyl-CoA. In a final 20 μl assay solution containing 50 mM potassium-phosphate buffer (pH 7.5), 200 μM succinyl-CoA, 5 mM L-homoserine, 1 μM protein at 40, 45, 50 and 58 ° C. Incubate for 30 minutes or incubation for 30 minutes in the presence of acetic acid at 25 ℃. Enzyme was added to initiate the reaction. The consumption of succinyl-CoA in the reaction was calculated by the difference between the values obtained in the presence and absence of L-homoserine. Three independent measurements were taken at each point.

Differential scanning calorimetry. The thermal stability of the MetAs was measured at a 90 ° C./h scan rate at temperatures between 15-90 ° C. intervals. 10 μM protein was measured in 50 mM potassium-phosphate buffer using a VP-DSC calorimeter (MicroCal Inc., USA). Proteins that were independent of each other were prepared to obtain three scan results.

Experiment result

L-methionine stimulates E. coli growth. To confirm the stimulation effect of methionine on E. coli growth at elevated temperatures, the temperature of W3110 strain in M9 glucose medium with or without L-methionine (50 μl ml ⁻¹ ) in the temperature range of 30-49 ° C. Incubation was done with a gradient incubator. Methionine promoted E. coli growth at temperatures above 30 ° C. (FIG. 2). In the absence of methionine, E. coli strain W3110 grew very slowly at 45 ° C. and completely stopped growing above 46 ° C. (FIG. 2), which was identical to previous results (16). When methionine was added to the culture, growth occurred at 45 ° C. and 46 ° C., but not above 47 ° C. (FIG. 2). As expected, the methionine effect was even more pronounced at higher growth temperatures: specific growth rates doubled at 44 ° C. and 10-fold at 45 ° C. (FIG. 2).

MetA from thermophilic strain Geobacillus caustophilus promotes E. coli growth at elevated temperatures . We investigated whether MetA extracted from thermophilic strain simply improves E. coli growth at higher temperatures. We used metA derived from the G. kaustophilus KCTC 3397 strain as a heat stable gene. KCTC 3397 is an aerobic Gram-positive endospore-forming bacterium that can grow at 37-75 ° C., suitably 55-65 ° C. (21). The metA _Geo was cloned to be subject to E. coli metAp of the pPmetA plasmid. The resulting plasmid, pGeo-metA, compensated for the growth of metA-deleted mutants in M9 medium. However, the specific growth rate of E. coli strain JW3973 (pGeo-MetA) was about 20% lower than that of E. coli JW3973 (pMetA) at 37 ° C. We prepared WG strain by inserting metA _Geo into the E. coli chromosome. MetA _Geo of the present invention stimulated E. coli growth on solid M9 medium at 44 ° C. (FIG. 4).

Directional evolution of MetA results in a heat resistant E. coli strain. Since Kiki weakened when damage to the methionine and heat stable MetA _Geo the E. coli growth at higher temperatures, the inventors have found that while monitoring the increase in the growth of E. coli cells having the metA _E.coli in higher temperature more heat Efforts were made to obtain stable MetA _{E. coli} . The inventors have estimated that as well as in comparison to MetA _Geo lower the specific growth rate of the E. coli heat stable at 37 ℃ MetA _E.coli temperature high mild (mild) a temperature promoting the E. coli growth. Random mutagenesis of metA _{E. coli} was performed using error-prone PCR as described in Experimental Materials and Experimental Methods. The present inventors were to construct a library by inserting a mutated metA pPmetA plasmid, which was fully restored the growth of E. coli JW3973 metA- deletion mutation in M9-glucose medium. The library consisting of 490 clones was incubated in M9 minimal plates at 44 ° C. to select clones to grow. The 23 clones selected were incubated in liquid M9 glucose medium at 44 ° C. to identify the fastest-growing clones. One prospective clone that grows faster than other clones at elevated temperatures is designated strain 333 (FIG. 3). The sequencing analysis indicated that MetA _{E. coli} -333 replaced five amino acids-S61T, E213V, I229T, N267D and N271K-. To determine whether amino acid residues were responsible for improved thermal stability, only one of the amino acids found in MetA _{E. coli} -333 was replaced and introduced into the wild type enzyme by site-directed mutagenesis. We integrated all mutated metA _{E. coli} into the E. coli JW3973 (Δ metA ) chromosome to produce strains 333, T61, V213, T229, D267 and K271. To investigate the thermal stability of these metA mutants, we incubated them on solid M9 glucose plates at 44 ° C. In FIG. 4, the left panel shows that the control strain WE with non-mutated metA on the chromosome grows weaker at 44 ° C. compared to mutations 333 and WG. Of the one amino acid replacement mutants, only two strains, T229 and D267, grew better than the control at elevated temperatures (FIG. 4). All strains grew normally at 37 ° C. except for WG, which grew more slowly than the other strains (FIG. 4, right panel).

Heat resistant E. coli metA mutations grow faster at elevated temperatures. To investigate the growth of heat stable mutations at different temperatures, we cultured them in a temperature gradient incubator. As can be seen in FIG. 5A, strain 333 grew 5-12% faster than non-mutated strain WE at temperatures ranging from 30-42 ° C. However, the difference in specific growth rates between heat stable strain 333 and control strain WE increased by 30% at 43 ° C. and 64% at 44 ° C. (FIG. 5A). Single amino acid mutated metA strains T229 and D267 grew 48% and 31% faster at 44 ° C and 18% and 10% faster at 43 ° C, respectively. Differences in specific growth rates between single-site mutants and control strains decreased by 4-12% at 39-41 ° C and to 0 in the 30-38 ° C range (Fig. 5A). All strains tested did not grow above 45 ° C.

Exogenous metA _Geo reduced host strain growth by about 10% at mild temperature in liquid M9 medium, ie 30-42 ° C. (FIG. 5A). The specific growth rate of WG at 43 ° C. was the same as the control strain WE and grew 20% faster at 44 ° C. (FIG. 5A).

In addition, we incubated different one-position mutants at different temperatures. Two of them, V213 and K271, showed lower specific growth rates than the wild type at 44 ° C (64% and 22% of the control strain, respectively) (no results), but non-mutations in the range of 36-41 ° C. It grew 15-20% faster than the strain was shown (no results shown). One-position mutant T61 grew identically to the control at elevated temperature, but specific growth rates in the range of 36-41 ° C. were similar to the mutants V213 and K271 (not shown). Clearly, many metA mutations 333 had both the ability of thermosensitive mutations to promote growth at mild temperatures and the ability of thermally stable mutations to grow faster at higher temperatures.

To explore the effect of methionine on the growth of heat stable E. coli 333 strains, we incubated the strains of the present invention in the presence or absence of methionine at different temperatures and used a non-mutated WE strain as a control (FIG. 5B). Despite the presence of the heat stable MetA _{E. coli} -333, this mutant strain could not reach the specific growth rate seen in the presence of methionine. Although the non-mutated strain grew 1.6-fold and 2-fold slower at 43 ° C and 44 ° C in methionine-deficient media, respectively, the thermally stable strains reduced the difference by 1.4-fold at both temperatures. This is because other thermolabile proteins are present in the methionine biosynthetic pathway. In addition, previous investigations have shown that MetE, which catalyzes the last step of methionine biosynthesis, is sensitive to elevated temperatures (9).

Heat stable metA mutations show resistance to acetic acid. Since about organic acid may destabilize the MetA _S.enterica (11) is not known, the inventors have estimated that exhibit resistance to heat are also stable metA mutants acetate. Strains 333, D267, T229 and WE were incubated in M9 glucose medium supplemented with 30 mM acetic acid at 30 ° C. using a BioScreen C incubator (Labsystems, Finland). As can be seen in FIG. 6, the wild-type strain reached a stationary phase 29 hours after starting the culture. In contrast, the heat stable E. coli strains 333 and T229 grew actively for an additional 11 hours, showing 1.4 times greater cell density than the control strain. Another mutant, D267, grew more slowly than other thermostabilized strains and its cell density increased only 16% more than the control.

Heat stable MetA enzymes are less sensitive to in vivo aggregation under heat or acetic acid stress conditions . To determine the effect of elevated temperature or acetic acid treatment on heat stable MetA _{E. coli} proteins in vivo , mutation and control strains were heated for 40 minutes from 30 ° C. to 45 ° C. or 30 mM at 30 ° C. After acetic acid was treated for 3 hours, the relative amount of MetA _{E. coli} protein was measured using an immunoblot. Brian and co-workers (2) found that E. coli cells do not contain soluble MetA _{E. coli} proteins at temperatures above 44 ° C. Surprisingly, we found wild-type MetA _{E. coli} protein in the soluble fraction after heat stress: their levels were about 35% compared to the culture without stress (FIG. 7A). It is estimated that some of the unfolded MetA _{E. coli} protein has been separated from the soluble fraction. The relative amounts of soluble heat stable MetA _{E. coli} -333 and MetA _{E. coli} -D267 proteins were 58% and 67%, respectively (FIG. 7A). In contrast, at 45 ° C., the soluble MetA _{E. coli} -T229 protein was only 29% compared to the control without heat (FIG. 7A). The relative amount of non-mutated insoluble MetA _{E. coli} protein increased 44 fold after heat treatment (FIG. 7B). The insoluble fraction of all the mutations tested was 13-19 times richer after high temperature treatment than without heat (FIG. 7B). Through these experimental results, the inventors confirmed that the MetA _{E. coli} -333 and MetA _{E. coli} -D267 mutations of the present invention are more resistant to formation of aggregates against heat. In the case of MetA _{E. coli} -T229, we estimate that the resistance to aggregation is greater because of the more stable secondary structure.

Treatment of exponentially grown cultures with acetic acid produced 1.5-3 fold higher relative amounts of soluble MetA _{E. coli} in all tested mutants than in wild type strains (FIG. 7C). Relative amounts of insoluble MetA _{E. coli} were about 15-fold higher in wild-type strains, 8-9-fold in D267 and 333 strains and 2.6-fold higher in T229 strains. These results confirm that the mutated MetA _{E. coli} protein is more resistant than the wild type protein in forming aggregates when challenged with acetic acid.

Thermally stable MetA enzymes have an increased transition midpoint. Differential scanning calorimetry (DSC) was used to compare the transition midpoint (Tm) of the mutated MetA protein and wild-type MetA protein. Tm is an indicator of thermal stability and proteins with higher Tm values are less sensitive to unfolding and denaturation. Non-mutated MetA and mutated MetAs including C-terminal 6x histidine tag were purified as described in Experimental Materials and Experimental Methods. As can be seen in FIG. 8, wild type 6 × histidine tag MetA _{E. coli} had a Tm value of 47.075 ± 0.082 ° C., while MetA _{E. coli} −333 had a higher Tm value (48.76 ± 0.026 ° C.) (FIG. 8). ). The highest Tm value (67.68 ± 0.055 ° C.) was seen in MetA _Geo (FIG. 8). The one-position mutated proteins MetA _{E. coli} -D267 and MetA _{E. coli} -T229 stimulated E. coli growth at elevated temperatures, but their Tm values were very similar to wild type MetA _{E. coli} (each, 47.36 ± 0.0014 ° C. and 46.99 ± 0.063 ° C.). This is inferred because these mutant enzymes are not more stable than wild type but are more resistant to aggregate formation after heat stimulation. We will explore these possibilities in the near future.

Mutated MetA enzymes have increased activity in elevated temperature and in the presence of acetic acid. The activity of the purified 6x histidine tack MetA _{E. coli} enzyme as described in Experimental Materials and Experimental Methods was monitored at 40-58 ° C. while monitoring the change in absorbance at 232 nm caused by the hydrolysis of succinyl-CoA thioester bonds. It was measured at the temperature of. The results obtained from the heat stable MetA protein are shown in the top panel of FIG. 9. MetA _{E. coli} -333 was about 2.5 times more active than non-mutated protein at 40-55 ° C. but completely lost its activity at 58 ° C. In contrast to MetA _E.coli -333, MetA _Geo , MetA _E.coli -D267 and MetA _E.coli -T229 showed lower activity at 40-45 ° C. but at 50 ° C. and above, the temperature of all heat stabilized MetAs. The profiles were similar. Surprisingly, the catalytic activity of MetA _Geo gradually decreased with increasing temperature, presumably due to the thermal instability of succinyl-CoA.

We tested the catalytic activity of these mutated MetAs in the presence of acetic acid at 25 ° C. Acetic acid, a final concentration of 10 mM, changed the pH of the reaction buffer from pH 7.5 to pH 7.0; For 20 mM, to pH 6.6; For 30 mM, to pH 6.2; For 40 mM, to pH 5.8; For 50 mM it was lowered to pH 5.4. FIG. 9B shows that when the concentration of acetic acid was treated at 30 mM (pH 6.2) or higher, the activity of wild-type MetA _{E. coli} was greatly reduced and not detected when treated with 50 mM (pH 5.4). The results of the present invention confirmed earlier investigations (3) that the activity of wild type MetA _{E. coli} dropped significantly at pH in the range of 6.0-6.5. In addition, acetic acid inhibited the activity of MetA _{E. coli} -333 from 30 mM, but was somewhat less severe than wild type enzyme. Moreover, MetA _{E. coli} -333 remained active even at 50 mM acetic acid (FIG. 9B).

The other two enzymes, MetA _{E. coli} -D267 and MetA _{E. coli} -T229, did not change catalytic activity at all concentrations of acetic acid tested. Interestingly, MetA _Geo showed almost inertness at 25 ° C. (FIG. 9B).

Finally, we compared the catalytic activity of wild type MetA _{E. coli} enzymes and heat stable MetA _{E. coli} mutant enzymes at 25 ° C. and 40 ° C. (FIGS. 9A and 9B). Wild-type enzyme activity was as low as 80% at 40 ℃. In contrast, MetA _{E. coli} -333 showed about 50% activity at 40 ° C. and MetA _Geo showed 3.5-fold increased activity at elevated temperatures (FIGS. 9A and 9B). The results of the present invention for wild type enzymes are consistent with previous findings; The activity of MetA _{E. coli} decreased to 70% at 37 ° C and 42 ° C (14).

Single-mutated MetA enzymes stimulate E. coli growth at elevated temperatures . To further elucidate the mutation studies of MetA _{E. coli} , we conducted a multiple alignment of the MetA amino acid sequences of E. coli and thermophilic bacteria (FIG. 10). As a result, the inventors found eight amino acid residues that were not present in MetA _{E. coli} but all in thermophilic MetAs (FIG. 10). To investigate whether these amino acid residues increase the thermal stability of MetA _{E. coli} , single-amino acid substitutions (Q96K, L110V, I124L, R160L, A195T, A200E, D218G and F247Y) were performed by site-directed mutagenesis. Was inserted. We integrated all mutated metA _{E. coli} into E. coli JW3973 ( metA ) chromosomes to prepare K96, V110, L124, L160, T195, E200, G218 and Y247 strains, respectively. To study the thermal stability of single-position metA _{E. coli} mutants, we cultured the mutations in 44 ° C. M9 glucose liquid medium. The results presented in Table 3 show that the five mutations (K96, V110, L124, E200 and Y247) grow faster at increased temperature compared to the control WE strain. Cultures of five thermostable metA mutations at 32 ° C. and 37 ° C. showed no difference from the non-mutated WE strain (Table 3). Surprisingly, the other three single-position metA mutants failed to maintain E. coli growth at elevated temperatures, but at 37 ° C, G218 decreased by 50%, L160 by 32% and T195 by 17% (Table 1). 3). In addition, all thermosensitive mutations grew later at 32 ° C. compared to the control strain (Table 3).

Previously, we obtained thermostable T229 mutations carrying I229T substitutions. Using the program, we found that replacement of isoleucine with tyrosine may additionally increase MetA _{E. coli} protein stability. In addition, single-position mutant Y229 showed accelerated growth at 44 ° C. (Table 3) but was not higher than other mutants T229 (not shown).

Effect of single amino acid substituted metA gene on E. coli growth at different temperatures Mutation
name Mutation Specific growth rate (μ, h ^-1a ) 32 ℃ 37 ℃ 44 ℃ WE Wild type 0.43 ± 0.007 0.59 ± 0.01 No growth K96 O96K 0.48 ± 0.007 ▲ 0.58 ± 0.007 0.52 ± 0.007 ▲ V110 L110V ND 0.55 ± 0.008 0.19 ± 0.07 ▲ L124 I124L 0.46 ± 0.007 0.6 ± 0.06 0.51 ± 0.02 ▲ L160 R160L 0.37 ± 0.014 ▼ 0.4 ± 0.03 ▼ No growth T195 A195T 0.37 ± 0.007 ▼ 0.49 ± 0.007 ▼ No growth E200 A200E ND 0.56 ± 0.014 0.37 ± 0.09 ▲ G218 D218G 0.36 ± 0.004 ▼ 0.29 ± 0.03 ▼ No growth Y229 I229Y 0.45 ± 0.014 0.61 ± 0.024 0.31 ± 0.1 ▲ Y247 F247Y ND 0.6 ± 0.007 0.1 ± 0.03 ▲

Additional discussion

The unusual instability of MetA, the first enzyme in the methionine biosynthetic pathway, is a major factor limiting E. coli growth at elevated temperatures (2, 5, 13, 14, 15). The formation of aggregates at temperatures above 33 ° C. reduces the activity of MetA _{E. coli} (2). Because the addition or alternative to the heat stable MetA of methionine is sikyeotgi weaken the inhibition of growth at higher temperatures, substituted (evolution) of the indicated MetA _E.coli to give a wider temperature range in which to grow the E. coli strain. Using the indicated substitutions, we obtained the heat resistant enzyme MetA _{E. coli} -333 with five amino acids replaced (S61T, E213V, I229T, N267D and N271K), which showed growth of the host strain at higher temperatures. Not only promoted, but also promoted growth at a normal growth temperature of 37 ℃. Differential scanning calorimetry results confirmed higher thermal stability of MetA _{E. coli} -333 in vivo and showed higher activity at elevated temperatures. In addition, using Proparam software ( http://ca.expasy.org/ ), MetA _{E. coli} -333 was stably classified: compared to wild type MetA _E.coli with an instability index of 42.26. MetA _{E. coli} -333 has an instability index of 39.79. Instability index provides a measure of protein stability. Proteins with an instability index less than 40 are considered stable and values above 40 predict that the protein is unstable (6).

By analyzing the accelerated growth of the one-position metA _{E. coli} mutants at 44 ° C., important amino acid residues included in the thermal instability of MetA _{E. coli} could be identified. The replacement of the 267th asparagine with aspartate was expected to increase thermal stability, since MetA proteins known from thermophilic strains have amino acids that are positively charged at that position (multiple alignments are shown in FIGS. 10 and 11). have). In general, these findings confirm previous observations that proteins in thermophilic strains contain more charged amino acid residues than proteins in mesophilic strains (18). Replacement of the 229th isoleucine with threonine is the 'opposite' case: it was not expected to increase the thermal stability of the MetA protein because the proteins of the thermophilic strain always contain low levels of polar amino acids. (18). Secondary structure prediction of MetA _{E. coli} protein ( http://www.igb.uci.edu/ ) revealed that the 229th isoleucine belongs to one of the beta strands. Generally, several beta strands laterally connected by three or more hydrogen bonds form a twisted, pleated sheet (20). Association between beta sheets is involved in the formation of protein aggregates and fibrils observed in many human diseases, particularly amyloidoses (10). We estimate that replacement of 229th isoleucine with threonine shortens the length of the beta strand ( http://www.igb.uci.edu/ ) to reduce aggregation of MetA _{E. coli} protein under stress conditions. do. These mutant enzymes can improve the growth of E. coli at higher temperatures, not because of increased heat stabilization but because they are more resistant to forming aggregates after heat challenge.

Brian and co-workers (2) attempted to stabilize the MetA _{E. coli} protein. They showed that the amino terminus portion of the protein (the first 23 amino acids) was responsible for stabilization, indicating that this sequence binds to proteolytic sites or proteins that convert MetA _{E. coli} proteins into proteolytic substrates. It was argued that it constitutes a site (2). Based on these findings, we predicted that the heat stable MetA _{E. coli} had a mutation at the N-terminal site. However, the heat stable MetA _{E. coli} -333 mutation of the present invention did not contain any amino acid substitutions at this site.

Very surprisingly, the heat stable E. coli MetAs of the present invention showed more resistance to acetic acid in vivo than the wild type protein. Previous studies have known that methionine attenuates the inhibition of E. coli growth by acetic acid (7, 12). Extended exponential growth of the metA _{E. coli} mutants of the present invention in the presence of acetic acid can be considered as further evidence of their increased acid resistance, which is the mid-exponentially increasing mid This is because it has been found that the exponential phase culture is more acid-sensitive than the stationary phase culture (1). Price-Carter and co-workers found that the MetA protein of Salmonella enterica is unstable at elevated temperatures, such as in the presence of weak organic acids including acetate, benzoate and propionate (11). Earlier, Fur and co-workers (12) concluded that inhibition of E. coli growth by acetate treatment results from the accumulation of homoserine, a substrate of MetE. We estimate that the instability of both enzymes affects E. coli growth under heat and stress conditions of acetate.

In the present invention, we have shown that methionine stimulates E. coli growth not only at elevated temperatures (42-46 ° C.) but also at formal growth temperatures (37 ° C.). The heat resistant MetA _{E. coli} -333 of the present invention significantly increased the growth of the host strain at 44 ° C., but did not recover at 45 ° C. The same effect was found on the WG strain with metA of thermophilic bacteria G. kaustophilus . Supplementation of methionine resulted in additional E. coli growth at 45 ° C. and 46 ° C., indicating that there is at least one heat sensitive enzyme in the methionine biosynthetic pathway. We estimate that MetE, which catalyzes the last step in methionine biosynthesis, is one candidate because MetE is known to be sensitive to high temperatures (9) and oxidative stress (8).

The present invention describes the first experimental results showing that E. coli growth is promoted under normal and stress conditions with increased stability of one cytoplasmic enzyme, MetA. The present invention can improve the productivity of the microbial plant by providing a method for obtaining novel platform E. coli strains that grow at higher rates at normal growth temperatures. More directly, being able to grow E. coli cells at higher temperatures means reducing the cost factors considered in bioprocessing.

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

references

Arnold, KW, and CW Kaspar. 1995. Starvation- and stationary phase-induced acid tolerance in Escherichia coli 0157: H7. Appl.Environ.Microbiol. 61 : 2037-2039.

2. Biran, D., E. Gur, L. Gollan, and EZ Ron. 2000. Control of methionine biosynthesis in Escherichia coli by proteolysis. Mol. Microbiol. 37 : 1436-1443.

Born, TL, and JS Blanchard. Enzyme-catalyzed acylation of homoserine: Mechanistic characterization of the Escherichia coli met A-encoded homoserine transsuccinylase. Biochemistry 38 : 14416-14423.

4. Datsenko, K., and BL Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97 : 6640-6645.

5.Gur, E., D. Biran, E. Gazit, and EZ Ron. 2002. In vivo aggregation of a single enzyme limits growth of Escherichia coli at elevated temperature. Mol. Microbiol. 46 : 1391-1397.

6. Guruprasad, K., BVB Reddy, and MWPandit. 1990. Correlation between stability of a protein and its dipeptide composition: a novel approach for predicting in vivo stability of a protein from its primary sequence. Protein Eng. 4 : 155-161.

7.Han, K., J. Hong, and HC Lim. 1993. Relieving effects of glycine and methionine from acetic acid inhibition in Escherichia coli fermentation. Biotechnol. Bioeng. 41 : 316-324.

8. Hondorp, ER, and RG Matthews. 2004. Oxidative stress inactivates cobalamin-independent methionine synthase (MetE) in Escherichia coli. PLoS Biol. 2 : 1738-1753.

9. Mogk, A., T. Tomoyasu, P. Goloubinoff, S. Rudiger, D. Roder, H. Langen, and B.Bukau. 1999. Identification of thermolabile Escherichia coli proteins: Prevention and reversion of aggregation by DnaK and ClpB. EMBO J. 18 : 6934-6949.

10. Nelson, R, MR Sawaya, M. Balbirnie, AO Madsen, C. Riekel, R. Grothe, and D. Eisenberg. 2005. Structure of the cross-beta spine of amyloid-like fibrils. Nature 435 : 773-778.

11. Price-Carter, M., TG Fazzio, EI Vallbona, and JR Roth. 2005. Polyphosphate kinase protects Salmonella enterica from weak organic acid stress. J. Bacteriol. 187 : 3088-3099.

12. Roe, AJ, C. O'Byrne, D. McLaggan, and IRBooth. 2002.Inhibition of Escherichia coli growth by acetic acid: a problem with methionine biosynthesis and homocysteine toxicity. Microbiology 148 : 2215-2222.

13. Ron, EZ, and BD Davis. 1971. Growth rate of Escherichia coli at elevated temperatures: limitation by methionine. J. Bacteriol. 107 : 391-396

14. Ron, EZ, and M. Shani. 1971. Growth rate of Escherichia coli at elevated temperatures: reversible inhibition of homoserine trans-succinylase. J. Bacteriol. 107 : 397-400.

15. Ron, EZ 1975. Growth rate of Enterobacteriaceae at elevated temperatures: limitation by methionine. J. Bacteriol. 124 : 243-246.

16 Ron, EZ, S. Alajem, D. Biran, and N. Grossman. 1990. Adaptation of Escherichia coli to elevated temperatures: The metA gene product is a heat shock protein. Antonie van Leeuwenhoek 58 : 169-174.

17. Sambrook, J, EF Fritsch, and T. Maniatis. 1989. Molecular cloning: A laboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press. Cold Spring, NY

18. Scandurra, RV, V. Consalvi, R. Chiaraluce, L. Politi, and PC Engel. 2000. Protein stability in extremophilic archaea. Front. Biosci. 5 : 787-795.

19. Tomoyasu, T., A. Mogk, H. Langen, P. Goloubinoff, and B. Bukau. 2001. Genetic dissection of the roles of chaperones and proteases in protein folding and degradation in the Escherichia coli cytosol. Mol. Microbiol. 40 : 397-413.

20. Voet, D., and JG Voet. 2004. Biochemistry. 3rd ed. John Wiley & Sons. NY.

21.White , D., RJ Sharp, and FG Priest. 1993. A polyphasic taxonomic study of thermophilic bacilli from a wide geographical area. Antonie van Leeuwenhoek 64 : 357-386.

22. Ziegler, K., SM Noble, E. Mutumanje, B. Bishop, DP Huddler, and TL Born. 2007. Identification of catalytic cysteine, histidine, and lysine residues in Escherichia coli homoserine transsuccinyllase. Biochemistry 46 : 2674-2683.

1 is a schematic showing the biosynthetic pathway of L-methionine and S-adenosyl-L-methionine in E. coli . Abbreviation: 5′-methyl-THPTG-5′-methyltetrahydroterroyl-tri-L-glutamate; 5′-methyltetrahydropteroyl-tri-L-glutamate; THPTG-tetrahydroopteroyl-tri-L-glutamate.

2 is a graph showing the effect of methionine supplementation on the growth of E. coli strain W3110 at different temperatures. The strains were incubated using a temperature gradient incubator in M9 glucose minimal medium supplemented (open circles) or not supplemented (closed circles) with L-methionine at temperatures ranging from 30-49 ° C. The columns show the ratio of specific growth rate between methionine-rich (50 μg ml ⁻¹ ) and methionine-deficient medium.

3 is metA _E.coli Is a graph showing the selection of the thermally stable MetA _{E. coli} -333 of the present invention from a library of mutations. 23 E. coli JW3973 strains carrying pMetA plasmids with mutated metA _{E. coli} and non-mutated controls were flask cultured in M9 glucose medium at 44 ° C. Optical density was measured every hour at 600 nm. Symbol: pMetA-control, •; pMetA-333, ▼; pMet A-334, ○. The growth curves of the other metA _{E. coli} mutants are similar to the control strain.

4 shows the thermal stability of E. coli metA mutants. Samples were taken from a culture grown logarithmically in M9 glucose medium at 30 ° C., adjusted to the same density, and subsequently diluted in M9 medium (exclude glucose). Aliquots (5 μl) were spotted onto M9 glucose plates. Cells were incubated for 24 hours at the indicated temperature.

5 is a graph showing the effects of different temperatures (A) and methionine supplement (B) on the growth of E. coli metA mutants. Non-mutated metA and mutated metA were integrated into the chromosome of E. coli strain JW3973 instead of the kanamycin resistance gene. The strain was incubated for 12 hours in a temperature range of 30-47 ℃ using a temperature gradient incubator in M9 glucose medium. Methionine was added at a final concentration of 50 μg ml ⁻¹ . Symbol A: WE,. 333, ○; WG, ▼; D267, Δ; T229, ■. Symbol B: WE,. 333, ○; WE + methionine, ▼; 333 + methionine, △.

6 is a graph showing the effect of acetic acid on the growth of heat stable E. coli mutants. Strains were incubated for 49 hours in a 100 μl M9 glucose medium using a BioScreen C incubator at 30 ° C. with shaking at 15 min intervals in the presence (open symbol) or absence (solid symbol) of 30 mM acetic acid. Symbol: WE, circular; 333, triangle; D267, square; T229, diamonds.

7 is a graph showing density measurement analysis of MetA in heat stress (A, B) or acetic acid stress (C, D) cultures. Exponential phase of WE (white column), 333 (grey column), D267 (dark gray column) and T229 (black column) strain in M9 glucose medium at 30 ° C. (approximately OD ₆₀₀ = 0.6 After incubation at), it was incubated at 45 ° C. for 40 minutes or at 30 ° C. for 3 hours in the presence of 30 mM acetic acid. Soluble fractions (A, C) and cohesive fractions (B, D) of MetA were purified from 25 ml cultures as described in Experimental Materials and Experimental Methods. 3 μg of total protein was loaded into 12% SDS-PAGE followed by Western blotting using rabbit anti-MetA serum. MetA was quantified by density measurement using Labworks software and normalized to total protein amount. MetA purified from non-stressed cultures was identified as 1 (plane column). The average of two independent experiments is shown.

FIG. 8 is a thermogram of heat-tack MetA obtained by differential scanning calorimetry. FIG. All proteins were scanned as described in Experimental Materials and Experimental Methods. The Tm value indicated above the corresponding curve is the midpoint of the unfolding transition in the differential scanning calorimetry; Tm values were determined from three independent experiments.

9 is a graph showing the temperature dependence (A) and the acetic acid resistance (B) of heat-tack MetA. Temperature (A) in the range 40-58 ° C. and in the presence of acetic acid at 25 ° C. (B) while monitoring the decrease in absorbance at 232 nm caused by the hydrolysis of the thioester bonds of succinyl-CoA, the substrate of MetA, Activity of the mutated MetA _{E. coli} , non-mutated MetA _Geo and mutated MetA _{E. coli} proteins was measured. The mean value of three independent measurements is shown at each point. Symbol: MetA _{E. coli} ,; MetA _{E. coli-} 333,; MetA _Geo ,; MetA _{E. coli} -D267,? MetA _{E. coli} -T229, ■.

, 매우 유사 아미노산.Figure 10 shows the results of analyzing the phylogeny (A) and similarity (B) between the MetA protein sequence from E. coli and thermophilic bacteria. The mutated amino acids are shown as square boxes. Abbreviations: Geobacillus- Geobacillus kaustophilus HTA426 (YP_147640.1), Clostridium- Clostridium thermocellum ATCC 27405 (YP_001038259.1), Thermotoga- Thermotoga maritima ATCC 43589 (NP_228689.1), Streptococcus- Streptococcus thermophilus ATCC 51oc Methylococcus capsulatus str. Bath (YP_114313.1). Symbols: *, match amino acids, _* , analog amino acids,

, Very similar amino acids.

, 매우 유사 아미노산.11 shows the results of analyzing phylogeny (A) and similarity (B) between MetA protein sequences of mesophilic bacteria. The mutated amino acids are shown as square boxes. Red underline refers to a sequence comprising mutated amino acids. Abbreviations: Citrobacter- Citrobacter koseri ATCC BAA-895 (YP_001455419.1), Salmonella- Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 (YP_153079.1), Escherichia- Escherichia coli (CAG29901), Klebsiella- Klebsiella pneumoniae subsp. pneumoniae MGH 78578 (YP_001338016.1). Symbols: *, match amino acids, _* , analog amino acids,

, Very similar amino acids.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Methods for Modulating Thermostability and Acid Tolerance of          Microbes <150> KR 10-2008-0126505 <151> 2008-12-12 <160> 36 <170> Kopatentin 1.71 <210> 1 <211> 930 <212> DNA <213> Escherichia coli <400> 1 atgccgattc gtgtgccgga cgagctaccc gccgtcaatt tcttgcgtga agaaaacgtc 60 tttgtgatga caacttctcg tgcgtctggt caggaaattc gtccacttaa ggttctgatc 120 cttaacctga tgccgaagaa gattgaaact gaaaatcagt ttctgcgcct gctttcaaac 180 acacctttgc aggtcgatat tcagctgttg cgcatcgatt cccgtgaatc gcgcaacacg 240 cccgcagagc atctgaacaa cttctactgt aactttgaag atattcagga tcagaacttt 300 gacggtttga ttgtaactgg tgcgccgctg ggcctggtgg agtttaatga tgtcgcttac 360 tggccgcaga tcaaacaggt gctggagtgg tcgaaagatc acgtcacctc gacgctgttt 420 gtctgctggg cggtacaggc cgcgctcaat atcctctacg gcattcctaa gcaaactcgc 480 accgaaaaac tctctggcgt ttacgagcat catattctcc atcctcatgc gcttctgacg 540 cgtggctttg atgattcatt cctggcaccg cattcgcgct atgctgactt tccggcagcg 600 ttgattcgtg attacaccga tctggaaatt ctggcagtga cggaagaagg ggatgcatat 660 ctgtttgcca gtaaagataa gcgcactgcc tttgtgacgg gccatcccga atatgatgcg 720 caaacgctgg cgcaggaatt tttccgcgat gtggaagccg gactagaccc ggatgtaccg 780 tataactatt tcccgcacga tgatccgcaa aagacaccgc gagcgagctg gcgtagtcac 840 ggtaatttac tgtttaccaa ctggctcaac tattacgtct accagatcac gccatacgat 900 ctacggcaca tgaatccaac gctggattaa 930 <210> 2 <211> 309 <212> PRT <213> Escherichia coli <400> 2 Met Pro Ile Arg Val Pro Asp Glu Leu Pro Ala Val Asn Phe Leu Arg   1 5 10 15 Glu Glu Asn Val Phe Val Met Thr Thr Ser Arg Ala Ser Gly Gln Glu              20 25 30 Ile Arg Pro Leu Lys Val Leu Ile Leu Asn Leu Met Pro Lys Lys Ile          35 40 45 Glu Thr Glu Asn Gln Phe Leu Arg Leu Leu Ser Asn Thr Pro Leu Gln      50 55 60 Val Asp Ile Gln Leu Leu Arg Ile Asp Ser Arg Glu Ser Arg Asn Thr  65 70 75 80 Pro Ala Glu His Leu Asn Asn Phe Tyr Cys Asn Phe Glu Asp Ile Gln                  85 90 95 Asp Gln Asn Phe Asp Gly Leu Ile Val Thr Gly Ala Pro Leu Gly Leu             100 105 110 Val Glu Phe Asn Asp Val Ala Tyr Trp Pro Gln Ile Lys Gln Val Leu         115 120 125 Glu Trp Ser Lys Asp His Val Thr Ser Thr Leu Phe Val Cys Trp Ala     130 135 140 Val Gln Ala Ala Leu Asn Ile Leu Tyr Gly Ile Pro Lys Gln Thr Arg 145 150 155 160 Thr Glu Lys Leu Ser Gly Val Tyr Glu His His Ile Leu His Pro His                 165 170 175 Ala Leu Leu Thr Arg Gly Phe Asp Asp Ser Phe Leu Ala Pro His Ser             180 185 190 Arg Tyr Ala Asp Phe Pro Ala Ala Leu Ile Arg Asp Tyr Thr Asp Leu         195 200 205 Glu Ile Leu Ala Val Thr Glu Glu Gly Asp Ala Tyr Leu Phe Ala Ser     210 215 220 Lys Asp Lys Arg Thr Ala Phe Val Thr Gly His Pro Glu Tyr Asp Ala 225 230 235 240 Gln Thr Leu Ala Gln Glu Phe Phe Arg Asp Val Glu Ala Gly Leu Asp                 245 250 255 Pro Asp Val Pro Tyr Asn Tyr Phe Pro His Asp Asp Pro Gln Lys Thr             260 265 270 Pro Arg Ala Ser Trp Arg Ser His Gly Asn Leu Leu Phe Thr Asn Trp         275 280 285 Leu Asn Tyr Tyr Val Tyr Gln Ile Thr Pro Tyr Asp Leu Arg His Met     290 295 300 Asn Pro Thr Leu Asp 305 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> metA1 <400> 3 cgcctactcg agatcgcaac gagttcctcc 30 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> metA2 <400> 4 gcctcaaagc ttcatatgct gattacctca ctacatacgc 40 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> metA3 <400> 5 cgcctccata tgccgattcg tgtgccg 27 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> metA4 <400> 6 cgcctcaagc ttggtgcctg aggtaaggtg ctg 33 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> metA5 <400> 7 gtagtgaggt aatcagcata tg 22 <210> 8 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> metA8 <400> 8 atctggatgt ctaaacgtat aagcgtatgt agtgagg 37 <210> 9 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> metA9 <400> 9 atcgcttaac gatcgactat cacagaagat taatcc 36 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Geo1 <400> 10 cgcctccata tgccaatcaa cattccaaaa g 31 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Geo2 <400> 11 cagggcgatt gtcgaaacac g 21 <210> 12 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> Geo4 <400> 12 atctggatgt ctaaacgtat aagcgtatgt agtgaggtaa tcaggttatg ccaatcaaca 60 ttcc 64 <210> 13 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Geo5 <400> 13 atcgcttaac gatcgactat cacagaagat taatccagcg ttggattcat cagggcgatt 60 gtcgaaacac g 71 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> metT <400> 14 gcctgctttc aaacacacac ctttgcaggt cg 32 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> metT2 <400> 15 gccagtaaag ataagcgcac tgcctttgtg acg 33 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> metD <400> 16 ctatttcccg cacgatgatc cgcaaaatac acc 33 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> metK <400> 17 gatccgcaaa agacaccgcg agcgagc 27 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> metV <400> 18 ctggaaattc tggcagtgac ggaagaaggg 30 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> K3-forward <400> 19 aaggatcaga actttgacgg tttg 24 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> K3-reverse <400> 20 aatatcttca aagttacagt agaag 25 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> V3-forward <400> 21 ggtgggcctg gtggagttta atg 23 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> V3-reverse <400> 22 ggcgcaccag ttacaatcaa acc 23 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> L2-forward <400> 23 cagctcaaac aggtgctgga gtg 23 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> L2-reverse <400> 24 cggccagtaa gcgacatcat taaac 25 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> L1-forward <400> 25 ctctcaccga aaaactctct ggc 23 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> L1-reverse <400> 26 tttgcttagg aatgccgtag agg 23 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> T4-forward <400> 27 ctatactgac tttccggcag cgttg 25 <210> 28 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> T4-reverse <400> 28 cgcgaatgcg gtgccaggaa tgaatc 26 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> E1-forward <400> 29 cagagttgat tcgtgattac accg 24 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> E1-reverse <400> 30 ccggaaagtc agcatagcgc gaatg 25 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> G1-forward <400> 31 ggtgcatatc tgtttgccag taaag 25 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> G1-reverse <400> 32 cccttcttcc gtctctgcca gaatttc 27 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Y2-forward <400> 33 gaatatttcc gcgatgtgga agcc 24 <210> 34 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Y2-reverse <400> 34 ctgcgccagc gtttgcgcat catattc 27 <210> 35 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> MetY-forward <400> 35 gccagtaaag ataagcgcta cgcctttgtg acggg 35 <210> 36 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> MetY-reverse <400> 36 cccgtcacaa aggcgtagcg cttatcttta ctggc 35  

Claims (16)

delete delete delete delete delete delete delete delete delete delete delete delete delete Homoserine o-succinyltransferase (MetA) with increased thermal stability or acid resistance, including the following amino acid substitutions: (a) Substituting the 61st amino acid Ser for Thr in SEQ ID NO: 1; (b) substituted 213th amino acid Glu with Val; (c) the 229th amino acid Ile is substituted with Thr; (d) replace the 267th amino acid Asn with Asp; (e) substitution of Lys for 271st amino acid Asn; (f) substitution of the 96th amino acid Gln with Lys; (g) replace 110th amino acid Leu with Val; (h) replacing the 124th amino acid Ile with Leu; (k) replacing the 200th amino acid Ala with Glu; (m) substitution of the 229th amino acid Ile with Tyr; (n) substitution of the 247th amino acid Phe with Tyr; Or (o) homoserine o-succinyltransferase (MetA), characterized in that a combination of the above substitutions. 15. The method of claim 14, wherein in the first sequence (a) the substitution of the 61 th amino acid Ser to Thr in the Leu-Ser-Asn-Ser-Pro-Leu-Gln-Val sequence of MetA to Thr To substitute; (b) substitution of the 213th amino acid Glu with Val replaces the fourth Glu with Val in the sequence Ile-Leu-Ala-Glu-Thr-Glu-Xaa ₁ -Gly (Xaa ₁ is Asp or Glu) of MetA; (c) substitution of the 229th amino acid Ile with Thr replaces Ile with Thr in the Asp-Lys-Arg-Ile-Ala-Phe-Val-Thr sequence of MetA; (d) substitution of the 267th amino acid Asn with Asp replaces Asn with Asp in the Tyr-Phe-Pro-Xaa ₁ -Asn-Asp-Pro-Gln (Xaa ₁ is Lys, His or Gln) sequence of MetA; (e) substitution of the 271st amino acid Asn with Lys replaces Asn with Lys in the Asp-Pro-Gln-Asn-Xaa ₁ -Pro-Arg-Ala (Xaa ₁ is Lys, Ile or Thr) sequence of MetA; (f) substitution of the 96th amino acid Gln with Lys replaces the fourth Gln with Lys in the Glu-Asp-Ile-Gln-Asp-Gln sequence of MetA; (g) substitution of the 110th amino acid Leu with Val replaces the fourth Leu with Val in the Gly-Ala-Pro-Leu-Gly-Leu-Val-Glu sequence of MetA; (h) substitution of Leu for the 124th amino acid Ile with Trp-Pro-Gln-Ile-Xaa ₁ -Gln-Val-Leu (Xaa ₁ Lys or Arg) replaces the fourth Ile with Leu in the sequence; (k) substitution of the 200th amino acid Ala with Glu replaces the fourth Ala with Glu in the PPhe-Pro-Ala-Ala-Leu-Ile-Arg-Asp sequence of MetA; (m) substitution of the 229th amino acid Ile with Tyr replaces the fourth Ile with Tyr in the Asp-Lys-Arg-Ile-Ala-Phe-Val-Thr sequence of MetA; (n) Substitution of 247 th amino acid Phe with Tyr replaces the fourth Phe with Tyr in the sequence Ala-Xaa ₁ -Glu-Phe-Phe-Arg-Asp-Val (Xaa ₁ is Ser, Gln or Gly) of MetA. Will; Or (o) homoserine o-succinyltransferase (MetA), characterized in that a combination of the above substitutions. The method of claim 14, wherein the substitution is performed by: (c) substituting Thr for 229 th amino acid Ile for SEQ ID NO: 1; (d) replace the 267th amino acid Asn with Asp; (e) substitution of Lys for 271st amino acid Asn; (h) replacing the 124th amino acid Ile with Leu; (m) substitution of the 229th amino acid Ile with Tyr; Or (o) homoserine o-succinyltransferase (MetA), characterized in that a combination of the above substitutions.

Images