JP2005080519A - Method for stabilizing phospholipase d - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a phospholipase D (PLD) stabilized against heat and the like, and to provide a method for stabilizing a phospholipase D. <P>SOLUTION: This method for stabilizing the PLD is characterized by introducing (a) the replacement of an amino acid corresponding to the 426 position of a specific amino acid sequence originated from a Streptomyces bacterium by glycine, phenylalanine, tyrosine or histidine and/or (b) the replacement of an amino acid corresponding to the 433 position of the specific amino acid sequence by threonine, serine, cysteine, arginine, histidine or aspartic acid, in the specific amino acid sequence originated from the Streptomyces bacterium or its derived sequence. The method for stabilizing the phospholipase D is characterized by introducing (a) and/or (b), and (c) the replacement of an amino acid corresponding to the 188 position of the specific amino acid sequence originated from the Streptomyces bacterium by phenylalanine, valine, tryptophane, or serine, in the specific amino acid sequence originated from the Streptomyces bacterium or its derived sequence. The stabilized phospholipase D obtained by the stabilization method. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a method for stabilizing phospholipase D and a stabilized phospholipase. More specifically, the present invention relates to a method for stabilizing phospholipase D useful for the creation of phospholipase D exhibiting stability, particularly excellent thermal stability, and the synthesis of phospholipids and various derivatives of phospholipids. The present invention relates to a stabilized phospholipase D exhibiting excellent stability.

  Phospholipase D is an enzyme that exists in plants, microorganisms, mammalian cells, etc., and hydrolyzes phospholipids into phosphatidic acid and bases (for example, choline, ethanolamine, etc.). In the presence of alcohols such as ethanol, phosphatidyl is used. It is an enzyme that catalyzes a group transfer reaction.

  The phospholipase D is known to cause activation of neutrophil functions.

  In addition, the phospholipid hydrolysis reaction or phosphatidyl group rearrangement reaction by the phospholipase D is used, for example, in the production of phospholipid derivatives (Patent Document 1, etc.).

However, when the phospholipase D is used for the synthesis of phospholipids, various derivatives of phospholipids, etc., it has the disadvantage that it is unstable to heat and the life of the enzyme is short.
Special table 2000-513586

  The present invention improves the stability of phospholipase, is useful for cosmetic substrates, pharmaceuticals, etc., has properties useful for the production of phospholipids and derivatives of the phospholipids, in particular, obtains phospholipase D exhibiting stability, etc. It is an object of the present invention to provide a method for stabilizing phospholipase D that enables Another object of the present invention is to provide a stabilized phospholipase D exhibiting properties useful for the production of phospholipids and derivatives of the phospholipids, particularly, stability, useful for cosmetic base materials, pharmaceuticals and the like. To do.

That is, the gist of the present invention is as follows.
[1] The following (A) to (C):
(A) the amino acid sequence shown in SEQ ID NO: 2,
(B) an amino acid sequence of a polypeptide that is aligned by the BLAST algorithm with respect to the amino acid sequence shown in SEQ ID NO: 2 and has a calculated sequence identity of at least 50% and exhibits phospholipase D activity; ) In the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence of a polypeptide having at least one amino acid residue substitution, deletion, addition or insertion and exhibiting phospholipase D activity;
In one amino acid sequence selected from the group consisting of:
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid A method for stabilizing phospholipase D, comprising introducing a substitution with one amino acid residue selected from the group consisting of residues,
[2] The following (A) to (C):
(A) the amino acid sequence shown in SEQ ID NO: 2,
(B) an amino acid sequence of a polypeptide that is aligned by the BLAST algorithm with respect to the amino acid sequence shown in SEQ ID NO: 2 and has a calculated sequence identity of at least 50% and exhibits phospholipase D activity; ) In the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence of a polypeptide having at least one amino acid residue substitution, deletion, addition or insertion and exhibiting phospholipase D activity;
In one amino acid sequence selected from the group consisting of:
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, and a threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid Substitution with one amino acid residue selected from the group consisting of residues;
c) an amino acid residue corresponding to position 188 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of phenylalanine residue, valine residue, tryptophan residue and serine residue; A method for stabilizing phospholipase D, characterized in that
[3] Stabilized phospholipase D obtained by the method for stabilizing phospholipase D according to [1] or [2],
[4] The following (A) to (C):
(A) the amino acid sequence shown in SEQ ID NO: 2,
(B) the amino acid sequence of a polypeptide that is aligned by the BLAST algorithm with respect to the amino acid sequence shown in SEQ ID NO: 2, has a calculated sequence identity of at least 50%, and exhibits phospholipase D activity; ) In the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence of a polypeptide having at least one amino acid residue substitution, deletion, addition or insertion and exhibiting phospholipase D activity;
In one amino acid sequence selected from the group consisting of:
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid The stabilized phospholipase D according to the above [3] having a substitution with one amino acid residue selected from the group consisting of residues, and [5] the following (A) to (C):
(A) the amino acid sequence shown in SEQ ID NO: 2,
(B) an amino acid sequence of a polypeptide that is aligned by the BLAST algorithm with respect to the amino acid sequence shown in SEQ ID NO: 2 and has a calculated sequence identity of at least 50% and exhibits phospholipase D activity; ) In the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence of a polypeptide having at least one amino acid residue substitution, deletion, addition or insertion and exhibiting phospholipase D activity;
In one amino acid sequence selected from the group consisting of:
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid Substitution with one amino acid residue selected from the group consisting of residues,
When,
c) an amino acid residue corresponding to position 188 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of phenylalanine residue, valine residue, tryptophan residue and serine residue; The stabilized phospholipase D according to the above [3] or [4],
About.

  According to the method for stabilizing phospholipase D of the present invention, it is possible to improve the stability of phospholipase D and to be useful for cosmetic substrates, pharmaceuticals, etc., useful for the production of phospholipids and derivatives of the phospholipids, In particular, there is an excellent effect that phospholipase D exhibiting stability, specifically, excellent thermal stability can be obtained. In addition, according to the stabilized phospholipase D of the present invention, properties useful for the production of phospholipids and derivatives of the phospholipids, which are useful for cosmetic bases, pharmaceuticals, etc., in particular, stability, specifically, excellent It has an excellent effect of exhibiting high thermal stability. In addition, according to the present invention, it is possible to improve the optimum temperature of phospholipase D, and there is an excellent effect that improvement in substrate solubility is achieved by raising the reaction temperature.

  In the present invention, when various chimeric enzymes are produced using phospholipase D (K1PLD) exhibiting low thermal stability and phospholipase D (TH-2PLD) exhibiting high thermal stability, TH exhibiting high thermal stability. The present inventors are surprised that there is an amino acid residue that can cause a chimeric enzyme exhibiting high thermostability and a chimeric enzyme exhibiting low thermostability regardless of the ratio of the portion derived from -2PLD. Factors that cause significant differences in thermal stability between each chimeric enzyme even when various chimeric enzymes are produced using phospholipase D (K6PLD and TH-2PLD) exhibiting the same knowledge and high thermal stability Based on the inventors' surprising finding that there is an amino acid residue.

  The TH-2PLD is phospholipase D derived from Streptomyces septatus TH-2 (Streptomyces septatus TH-2), and K1PLD is phospholipase D derived from Streptomyces halstedii K1. Yes, K6PLD is phospholipase D derived from the Streptomyces halstedii subsp. Scabies K6 strain.

  In the method for stabilizing phospholipase D of the present invention, the amino acid residue corresponding to position 426 in the amino acid sequence of TH-2PLD is selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue, and a histidine residue. From the group consisting of a threonine residue, a serine residue, a cysteine residue, an arginine residue, a histidine residue, and an aspartic acid residue. This is a method of stabilizing phospholipase D by substituting one selected amino acid residue.

  In the present specification, “amino acid residue corresponding to position (188, 426, or 433)” refers to an amino acid sequence shown in SEQ ID NO: 2 as a reference sequence and a sequence aligned by the BLAST algorithm. It means a residue aligned as a residue corresponding to a specific position (position 188, position 426, or position 433) in the amino acid sequence shown in No. 2.

Specifically, the stabilization method of the present invention includes the following (A) to (C):
(A) the amino acid sequence shown in SEQ ID NO: 2,
(B) an amino acid sequence of a polypeptide that is aligned by the BLAST algorithm with respect to the amino acid sequence shown in SEQ ID NO: 2 and has a calculated sequence identity of at least 50% and exhibits phospholipase D activity; ) In the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence of a polypeptide having at least one amino acid residue substitution, deletion, addition or insertion and exhibiting phospholipase D activity;
In one amino acid sequence selected from the group consisting of:
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid A method of introducing substitution with one amino acid residue selected from the group consisting of residues [also referred to as Method 1].

  In the stabilization method of the present invention, in the amino acid sequence of wild-type phospholipase, the amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 is substituted with glycine, phenylalanine residue, tyrosine residue and histidine residue. Substituting with one amino acid residue selected from the group consisting of and / or an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2 as a threonine residue, a serine residue, a cysteine residue One major feature is substitution with one amino acid residue selected from the group consisting of arginine residue, histidine residue and aspartic acid residue. Therefore, according to the stabilization method of the present invention, the phospholipase D has an excellent effect of being able to impart higher stability, specifically, high thermal stability, compared to the wild-type phospholipase D. Demonstrate. Therefore, according to the stabilization method of the present invention, phospholipase D (hereinafter referred to as “stable”), which exhibits properties useful for the production of phospholipids and derivatives of the phospholipids, which are useful for cosmetic substrates, pharmaceuticals, and the like, in particular, stability. This also exhibits an excellent effect that it is also possible to obtain a modified phospholipase D ”.

  Furthermore, according to the stabilization method of the present invention, in addition to the amino acid residue corresponding to position 426 and / or the amino acid residue corresponding to position 433, the amino acid sequence of wild-type phospholipase is represented by SEQ ID NO: 2. By further substituting the amino acid residue corresponding to position 188 in the amino acid sequence with one amino acid residue selected from the group consisting of phenylalanine residue, valine residue, tryptophan residue and serine residue Stabilized phospholipase D exhibiting stability, specifically, high thermal stability can be obtained.

That is, in one amino acid sequence selected from the group consisting of (A) to (C), the substitution of the a) and / or the substitution of the b)
c) an amino acid residue corresponding to position 188 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of phenylalanine residue, valine residue, tryptophan residue and serine residue; A method characterized by introducing a substitution of the above (also referred to as method 2) is also included in the present invention.

  In the present specification, the “wild-type phospholipase D” refers to natural phospholipase D naturally occurring in an organism and a nucleic acid encoding the natural phospholipase D introduced into an organism different from the original origin and expressed. It refers to the obtained recombinant phospholipase D.

  In the stabilization method of the present invention, examples of the wild-type phospholipase D include (A) phospholipase D containing the amino acid sequence represented by SEQ ID NO: 2.

  The amino acid sequence of (A) is the amino acid sequence of phospholipase D derived from Streptomyces septatus TH-2 strain.

In the present invention, the wild-type phospholipase D is any one that exhibits phospholipase D activity.
(B) the amino acid sequence of a polypeptide that is aligned by the BLAST algorithm with respect to the amino acid sequence shown in SEQ ID NO: 2, and has a calculated sequence identity of at least 50% and exhibits phospholipase D activity, or ( C) a phospholipase D comprising the amino acid sequence of a polypeptide having the substitution, deletion, addition or insertion of at least one amino acid residue and exhibiting phospholipase D activity in the amino acid sequence shown in SEQ ID NO: 2 There may be.

  As conditions for calculating the “sequence identity” in the amino acid sequence of (B) by the BLAST algorithm, expected value 10, Wordsize 3, Gap Costs (Existence: 11, Extension: 1) and the like can be mentioned.

  The sequence identity is at least 50%, preferably at least 70%, more preferably at least 79%, even more preferably at least 90%, even more preferably at least 95%.

  In the amino acid sequence (C), the number of substitutions, deletions, additions or insertions is at least 1, preferably 1 or more, more preferably 1 or several.

The activity of phospholipase D can be assessed by hydrolysis activity and / or transfer activity.
The hydrolysis activity is, for example,
(I) The reaction solution [Composition: 2 mM phosphatidylparanitrophenol, 100 mM sodium acetate buffer (pH 5.5), 0.625% Triton ^™ X 100) was added to 0.1 ml of an aqueous solution equivalent to 100 ng of the protein to be measured. Adding to 9 ml and determining absorbance change at 360 nm per minute with incubation at 37 ° C .;
(II) A step of calculating the amount of paranitrophenol produced per minute based on the millimolar extinction coefficient 6.8 of paranitrophenol at pH 5.5 from the absorbance change obtained in step (I). It can be evaluated by doing. In addition, 1 U of hydrolysis activity of phospholipase D is defined as an enzyme activity that liberates 1 μmol of paranitrophenol per minute.
The metastatic activity is, for example,
(I) Protein to be measured: 0.05 ml of an aqueous solution equivalent to 200 ng of an emulsion for reaction [11.42 mM paranitrophenol, 7.5 mM sodium acetate buffer (pH 5.5), 57.14 w / w% benzene] 2. A mixture containing 2.86 mg / ml bovine serum albumin is ultrasonically dispersed for 15 minutes, emulsified, and heated at 37 ° C. for 5 minutes.] Added to 0.35 ml, resulting mixture Incubating at 37 ° C. for 10 minutes,
(Ii) adding 0.1 ml of 1N hydrochloric acid to the product obtained in step (i) to stop the reaction;
(iii) 0.15 ml of 1N sodium hydroxide solution and 0.4 ml of chloroform / methanol (3/1) solution are added to the mixture obtained in the above step (ii), and then the resulting mixture is heated to 4 ° C. And (iv) 0.02 ml of the aqueous phase obtained in the above step (iii) and 0.18 ml of 0.1 M Tris-HCl buffer (pH 8.0) were obtained. Measuring the absorbance at 405 nm for the mixture;
Can be evaluated. In addition, 1 U of the transfer activity of phospholipase D is defined as an enzyme activity that liberates 1 μmol of paranitrophenol per minute.

  Examples of the wild-type phospholipase D include actinomycetes, specifically, phospholipase D derived from Streptomyces spp., Actinomadura spp., Kitasasspora spp, Streptoverticillium spp. It is done.

  More specifically, the wild-type phospholipase D includes the TH-2PLD [base sequence (SEQ ID NO: 1), amino acid sequence (SEQ ID NO: 2), gene bank accession number: AB05873], the K1PLD [base]. Sequence (SEQ ID NO: 3), amino acid sequence (SEQ ID NO: 4), gene bank accession number: AB062136], K6PLD [base sequence (SEQ ID NO: 5), amino acid sequence (SEQ ID NO: 6), gene bank access Session number: AB074305], phospholipase D derived from Streptoverticillium cinnamoneum [base sequence (SEQ ID NO: 7), amino acid sequence (SEQ ID NO: 8), gene bank accession number: AB007132], streptomy Seth Antibioticus (Streptomyces antibioticus) -derived phospholipase D [base sequence (SEQ ID NO: 9), amino acid sequence (SEQ ID NO: 10), gene bank accession number: D1644] and the like.

The stabilization method of the present invention includes, for example, in the case of the method 1, (I) in the nucleic acid encoding phospholipase D containing one amino acid sequence selected from the group consisting of (A) to (C), ) And / or mutagenesis to cause the substitution of b) above to obtain a nucleic acid construct,
(II) introducing the nucleic acid construct obtained in the step (I) into a host to obtain a transformant; and (III) culturing the transformant obtained in the step (II) to obtain a nucleic acid construct. Obtaining a stabilized phospholipase D as an expression product of
It can be done by.

In the case of the method 2, instead of the step (I),
(I ′) in the nucleic acid encoding phospholipase D containing one amino acid sequence selected from the group consisting of (A) to (C) above, the substitution of a) and / or the substitution of b), A step of obtaining a nucleic acid construct may be performed by introducing a mutation to cause the substitution in c).

  In the steps (I) and (I ′), mutagenesis is performed by, for example, a conventional site-directed mutagenesis method, specifically, a gaped duplex method, a Kunkel method, or PCR. It can be performed by a mutagenesis method or the like. The nucleic acid used for amino acid residue substitution can be designed in accordance with the codon usage of the host for expressing the stabilized phospholipase D.

  For the production of the nucleic acid construct, a conventional vector can be used depending on the host to be used. Examples of the vector include pUC18 and derivatives thereof, pBR322 and derivatives thereof, pBluescript (registered trademark) II and derivatives thereof, pGEM (registered trademark) and derivatives thereof, plasmid vectors such as λZAPII and λgt11. Phage vectors such as pYAC derivatives when the host is yeast. The nucleic acid construct may contain factors such as an inducible promoter, a selection marker gene, and a terminator. The nucleic acid construct may contain a sequence that allows the polypeptide to be expressed to be expressed as a His tag polypeptide or a GST fusion polypeptide so that the polypeptide to be expressed can be easily isolated and purified. .

  In the steps (I) and (I ′), in the case of the substitution in the above a), the amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 is substituted with a glycine residue, phenylalanine residue, tyrosine residue. One amino acid residue selected from the group consisting of a group and a histidine residue, from the viewpoint of improving thermal stability, preferably one selected from the group consisting of a glycine residue, a phenylalanine residue and a tyrosine residue Substitution with amino acid residues is desirable. In the step (I) and (I ′), in the case of the substitution in b), an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2 is a threonine residue, a serine residue, One amino acid residue selected from the group consisting of a tyrosine residue, a cysteine residue, an arginine residue, a histidine residue and an aspartic acid residue. From the viewpoint of improving thermal stability, preferably a threonine residue, tyrosine It is desirable to substitute one amino acid residue selected from the group consisting of a residue, a cysteine residue, an arginine residue and a histidine residue. Furthermore, in the case of the substitution of c), the amino acid residue corresponding to position 188 in the amino acid sequence shown in SEQ ID NO: 2 is selected from the group consisting of phenylalanine residue, valine residue, tryptophan residue and serine residue From the viewpoint of improving the thermal stability of one amino acid residue, it is preferable to substitute a phenylalanine residue.

  From the viewpoint of improving thermal stability, a combination of an amino acid residue substitution corresponding to position 426 and an amino acid residue substitution corresponding to position 433 in the amino acid sequence represented by SEQ ID NO: 2 is desirable. More preferably, the combination of the substitution of the amino acid residue corresponding to position 426, the substitution of the amino acid residue corresponding to position 433 and the substitution of the amino acid residue corresponding to position 188 in the amino acid sequence shown in SEQ ID NO: 2 Is desirable. Although it does not specifically limit as said combination, For example, the substitution to the phenylalanine residue of the amino acid residue corresponding to position 426 in the amino acid sequence shown by sequence number: 2, and the threonine residue of the amino acid residue corresponding to position 433 In combination with the substitution to, amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2, substitution to phenylalanine residue, substitution of amino acid residue corresponding to position 433 to threonine residue, and 188 Combination of substitution of amino acid residue corresponding to position with phenylalanine residue, substitution of amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 to amino acid corresponding to position 433 Substitution of residue to threonine residue and phenylalanine residue of amino acid residue corresponding to position 188 Mentioned combination of a substitution of.

  In the step (II), the introduction of the nucleic acid construct into the host includes conventional transformation methods such as, but not limited to, electroporation method, calcium phosphate method, DEAE-dextran method and the like.

  Although it does not specifically limit as said host, For example, colon_bacillus | E._coli, yeast, Bacillus subtilis, green bacterium, Salmonella, L cell, COS cell, CHO cell, sf9 cell etc. are mentioned. Specific examples of the Escherichia coli include HB101 strain, C600 strain, JM109 strain, DH5α strain, BL21 (DE3) strain, and the like. Of these, Escherichia coli BL21 (DE3) is preferred from the viewpoint of expression control.

  In the step (III), the culture conditions for the transformant can be appropriately set according to the host, the vector and the like used.

  Examples of the medium used for the culture include Luria-Bertani medium, SOC medium, L medium, and the like.

  As the culture conditions, specifically, when Escherichia coli BL21 (DE3) strain is used as the host and pETKmS2 is used as the vector, Naoto Mishima et al., Biotechnol. Prog., 13 (1997) 864- The medium described in 868 is used, and the transformant is cultured at 30 ° C. for 12 hours, and then IPTG (1 mM) is added to the medium and cultured at 16 ° C. for 96 hours.

  In the step (III), the stabilized phospholipase D, which is the expression product of the nucleic acid construct, can be isolated and purified from the transformant culture by a general purification method.

  Examples of the purification method include salting out, ultracentrifugation, ion exchange column chromatography, adsorption column chromatography, hydrophobic column chromatography, affinity column chromatography and the like.

In the step (III), the stabilized phospholipase D is purified by appropriately combining the purification methods, and the phospholipase D activity is measured by the hydrolysis activity and / or transfer activity evaluation method in each purification step. In addition, the expression product of the nucleic acid construct can be obtained by evaluating the purity of the purified product by conventional SDS-polyacrylamide gel electrophoresis and native polyacrylamide gel electrophoresis. Subsequently, the residual activity of the expression product when incubated at 60 ° C., 65 ° C., and 70 ° C. for 10 minutes is calculated, and the following i) to iii):
i) At 60 ° C., it has a residual activity of at least 95%, preferably 97% or more, more preferably 100% or more of the activity before incubation.
ii) At 65 ° C., it has a residual activity of at least 70%, preferably 80% or more, more preferably 90% or more of the activity before incubation.
iii) In the case of 70 ° C., satisfy at least one selected from the group consisting of having a residual activity of at least 50%, preferably 70% or more, more preferably 90% or more of the activity before incubation. The desired stabilized phospholipase D can be selected using as an index.

  The stabilization method of the present invention can be applied to phospholipases (mutant phospholipases) having a mutation excluding the substitutions a) to c) in addition to wild-type phospholipases. It can also be applied to artificially produced chimeric phospholipases.

  The stabilized phospholipase D obtained by the stabilization method of the present invention has higher stability, specifically, higher thermal stability than the wild-type phospholipase D containing the amino acid sequence shown in SEQ ID NO: 2. It exhibits an excellent property of showing. The present invention also includes a stabilized phospholipase D obtained by the stabilization method of the present invention.

  Specifically, the stabilized phospholipase D of the present invention includes a) substitution and / or b) substitution in one amino acid sequence selected from the group consisting of (A) to (C). In the stabilized phospholipase D having one amino acid sequence selected from the group consisting of (A) to (C), the substitution of a) and / or the substitution of b), and the substitution of c) Stabilized phospholipase D having

  Since the stabilized phospholipase D of the present invention has the substitution in one amino acid sequence selected from the group consisting of (A) to (C), the temperature range giving the maximum activity in the enzymatic reaction is high (for example, 55 to 75 ° C). Therefore, the stabilized phospholipase D of the present invention exhibits an excellent effect that an enzyme reaction can be performed at a high temperature.

  Therefore, the stabilized phospholipase D obtained by the stabilization method of the present invention is stable in activity under the reaction conditions in the production of phospholipids and derivatives of the phospholipids useful for cosmetic bases, pharmaceuticals, etc. It can be held and expressed, and exhibits an excellent effect that it can be used repeatedly.

The stabilized phospholipase D of the present invention is not particularly limited, and for example, 1 selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 and SEQ ID NO: 10. In one amino acid sequence,
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, and a threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid A stabilized phospholipase D having a substitution with one amino acid residue selected from the group consisting of residues; from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 and SEQ ID NO: 10 In one amino acid sequence selected from the group consisting of
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, and a threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid Substitution with one amino acid residue selected from the group consisting of residues,
When,
c) an amino acid residue corresponding to position 188 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of phenylalanine residue, valine residue, tryptophan residue and serine residue; And stabilized phospholipase D having the following substitution.

  EXAMPLES Hereinafter, although an Example etc. demonstrate this invention in detail, this invention is not limited to this Example.

(1) Production of chimeric phospholipase D (chimeric PLD) Streptomyces septatus TH-2 (Streptomyces septatus TH-2, which exhibits high thermal stability as a nucleic acid encoding phospholipase D to be fused for production of chimeric PLD ) Nucleic acid (DDBJ accession number: AB05873) encoding phospholipase D (hereinafter referred to as TH-2PLD), and phospholipase D (Streptomyces halstedii K1), which exhibits low thermal stability. A nucleic acid (DDBJ accession number: AB062136) encoding K1PLD was used. The amino acid sequence of the TH-2PLD is shown in SEQ ID NO: 2, and the nucleotide sequence of the nucleic acid encoding TH-2PLD is shown in SEQ ID NO: 1. The amino acid sequence of the K1PLD is shown in SEQ ID NO: 4, and the nucleotide sequence of the nucleic acid encoding K1PLD is shown in SEQ ID NO: 3.

  Chimeric PLD using a nucleic acid encoding K1PLD and a nucleic acid encoding TH-2PLD, wherein a polypeptide derived from K1PLD is arranged on the N-terminal side and a polypeptide derived from TH-2PLD is arranged on the C-terminal side A group (hereinafter collectively referred to as K1 / TH-2) was prepared.

  For the production of the chimeric PLD group K1 / TH-2, the nucleic acid encoding the K1PLD, the fljB gene that is a flagellin gene derived from Salmonella typhimurium expressed under the control of the tac promoter (Ptac), and TH-2PLD are encoded. Nucleic acid and lacZ expressed in frame are arranged in tandem on pACYC184 in this order, and a streptomycin and spectinomycin resistance gene is inserted between these nucleic acids to prepare a vector for preparing a K1 / TH-2 fusion gene Built. Since the region after aspartic acid of the HKD motif on the C-terminal side of TH-2PLD is toxic to the host cell, the region corresponding to the region after aspartic acid of this HKD motif was removed. Nucleic acid (base numbers: 151 to 1479 of SEQ ID NO: 1 was used.

  The fusion gene preparation vector is introduced into E. coli strain MK1019 which is resistant to streptomycin and has a ssb-3 mutation in the single-stranded DNA binding protein gene by electroporation, and the resulting transformant is transformed into glucose. Minimal medium [composition: minimal containing glucose (2 g / L), phenyl-β-D-galactopyranoside (0.5 g / L), and 5-bromo-4-chloro-3-galactopyranoside A medium (written by JHMiller, A Short Course in Bacterial Genetics. A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY)] and seeded blue papillae A single colony was obtained by sorting.

  Chimeric PLDs were obtained from the obtained single colonies by conventional methods.

(2) Measurement of phospholipase D activity of chimeric PLD group K1 / TH-2 For the chimeric PLD group K1 / TH-2 obtained in (1) above, measurement of phospholipase D hydrolysis activity and transfer activity as follows: Was measured.

(I) Measurement of phospholipase D hydrolysis activity 0.1 ml of an aqueous solution equivalent to 100 ng of the protein to be measured was added to a reaction solution [composition: 2 mM phosphatidylparanitrophenol, 100 mM sodium acetate buffer (pH 5.5), 0.625. % TritonTMX100] was added to 0.9 ml, and the amount of change in absorbance at 360 nm per minute was determined while incubating at 37 ° C. From the obtained amount of change in absorbance, the molar molecular absorption of paranitrophenol at pH 5.5 was determined. Based on a coefficient of 6.8, the amount of paranitrophenol produced per minute was calculated. In addition, 1 U of hydrolysis activity of phospholipase D was defined as an enzyme activity that liberates 1 μmol of paranitrophenol per minute.

(Ii) Measurement of transfer activity of phospholipase D Absorbance at 405 nm was measured for dilution series of paranitrophenol at various concentrations to prepare a calibration curve. 0.05 ml of an aqueous solution equivalent to 200 ng of the protein to be measured was added to the emulsion for reaction [11.42 mM paranitrophenol, 7.5 mM sodium acetate buffer (pH 5.5), 57.14 w / w% benzene, 2. A mixture containing 86 mg / ml bovine serum albumin was dispersed by ultrasonication for 15 minutes, emulsified, and heated at 37 ° C. for 5 minutes) and added to 0.35 ml. Incubated for minutes. To the obtained product, 0.1 ml of 1N hydrochloric acid was added to stop the reaction. After adding 0.15 ml of 1N sodium hydroxide solution and 0.4 ml of chloroform / methanol (3/1) solution to the obtained mixture, the obtained mixture was centrifuged at 4 ° C. for 10 minutes. 0.02 ml of the obtained aqueous phase and 0.18 ml of 0.1 M Tris-HCl buffer (pH 8.0) were mixed, and the absorbance at 405 nm was measured for the obtained mixture. From the obtained measurement value, the amount of paranitrophenol produced by the transfer reaction was calculated based on the calibration curve. In addition, 1 U of the transfer activity of phospholipase D was defined as an enzyme activity that liberates 1 μmol of paranitrophenol per minute.

  As a result, hydrolytic activity and transfer activity of phospholipase D were not detected for the chimeric PLD group K1 / TH-2.

(3) Production of chimera PLD exhibiting activity From the result of (2) above, phospholipase D activity could not be detected. Therefore, the chimer PLD group K1 / TH-2 had a C-terminal side of K1 on the C-terminal side 67 An attempt was made to create a chimeric PLD group (hereinafter collectively referred to as K1 / TH-2 / K1) having amino acids (amino acid numbers: 438 to 504 of SEQ ID NO: 4).

  A plasmid was isolated from each strain obtained in (1) by a conventional method, and a fragment encoding a chimeric PLD was obtained from each of the plasmids.

  Then, in each of the obtained fragments, immediately after the position corresponding to the C-terminus of K1 / TH-2, a nucleic acid encoding the C-terminal 67 amino acids of K1PLD (base numbers: 1523 to 1721 of SEQ ID NO: 3), respectively The ligated product was inserted into the expression vector pETKmS2 (provided by Prof. Yusuke Iwasaki, Nagoya University, described in Naoto Mishima et al., Biotechnol. Prog., 13 (1997) 864-868). Thus, a vector for expression of the chimeric PLD group K1 / TH-2 / K1 was obtained.

  Escherichia coli BL21 (DE3) strain was transformed with the obtained expression vector, and a strain expressing K1 / TH-2 / K1 was obtained using the hydrolysis activity of phospholipase D as an index.

  Subsequently, chimera PLD was obtained from each of the obtained strains by a conventional method.

  For the chimeric PLD group K1 / TH-2 / K1, the hydrolysis activity of phospholipase D was measured in the same manner as in the activity measurement method of (i) in (2) above.

  Subsequently, a plasmid was isolated from a strain producing a chimeric PLD exhibiting the activity of phospholipase D, and then the plasmid was used for sequencing to determine the position of the recombination point of the chimeric PLD.

  As a result, it was found that the chimeric PLD A to F shown in the left panel of FIG. 1 exhibited phospholipase D activity.

  Subsequently, 0.02 ml of K5PLD, TH-2PLD, chimera PLD AF each 0.005U equivalent amount aqueous solution was incubated at 60 degreeC for 10 minute (s). The hydrolytic activity of K1PLD, TH-2PLD, and chimeric PLD A to F after incubation was measured in the same manner as in (i) of (2) above. In addition, as a control, hydrolytic activity was measured in the same manner as described above using 0.02 ml of K5PLD, TH-2PLD, and chimeric PLD A to F equivalent to 0.005 U each without incubation at 60 ° C. for 10 minutes. The result is shown in the right panel of FIG. In the right panel of FIG. 1, the residual activity calculated with the hydrolysis activity without incubation as 100 is shown.

  As a result, as shown in the right panel of FIG. 1, it was found that the chimeric PLD A to F showed high thermal stability independent of the content of the peptide derived from TH-2PLD exhibiting high thermal stability. It was. In particular, the chimeric PLD C has a peptide portion consisting of 265 amino acids derived from TH-2PLD exhibiting high thermal stability, but unexpectedly, it has a remarkable residual activity after incubation at 60 ° C. for 10 minutes. It was found to be low and exhibit low thermal stability.

  As a result of examining the recombination point of the chimeric PLD C obtained in Example 1, it was suggested that the amino acid residues around position 188 of the chimeric PLD C are involved in thermal stability. In the α-helix in which the amino acid residue at the position is present, the mutation shown in the left panel of FIG. 2 with respect to the four residues that differ between the chimeric PLD C and the chimeric PLD D that exhibits low thermal stability following the chimeric PLD C Enzymes C1-C4 were prepared.

  Subsequently, 0.02 ml of an aqueous solution equivalent to 0.005 U each of the chimeric PLD C and the mutant enzymes C1 to C4 was incubated at 60 ° C. for 10 minutes. For the chimeric PLD C and the mutant enzymes C1 to C4 after the incubation, the hydrolysis activity was measured in the same manner as in (i) of (2) of Example 1 above. As a control, hydrolytic activity was measured in the same manner as described above using 0.02 ml of an aqueous solution equivalent to 0.005 U each of chimeric PLD C and mutant enzymes C1 to C4 not incubated at 60 ° C. for 10 minutes. The results are shown in the right panel of FIG. In the right panel of FIG. 2, the residual activity calculated with the hydrolysis activity without incubation as 100 is shown.

  As a result, as shown in the right panel of FIG. 2, the one having low thermostability at 60 ° C. is a mutant enzyme whose residue corresponding to position 188 is the same glycine as TH-2. It was found that the ones with significantly improved thermal stability in were mutant enzymes that are the same serine as K1.

(1) Preparation of TH-2PLD Mutant Enzyme In TH-2PLD, the position corresponding to the serine residue corresponds to glycine (G) at position 188 in the amino acid sequence shown in SEQ ID NO: 2. Accordingly, 19 mutant enzymes were prepared by substituting G at position 188 with each of the other 19 amino acids.

  Specifically, first, a GC-RICH PCR System kit using a primer T1 [AGCGCGAAGAAGCACGTCGA (SEQ ID NO: 11) and primer T2 [GGATCCGAGCCCTGGCAGAGGCC (SEQ ID NO: 12)] and using a nucleic acid encoding TH-2PLD as a template. PCR was performed using (Roche).

  The primer T1 is a primer having a sequence corresponding to the base number: 1132-1115 of the base sequence of TH-2PLD (SEQ ID NO: 1). The primer T2 has a sequence in which CGGATCC (SEQ ID NO: 13) is added downstream of base numbers 1663 to 1667 of the base sequence of TH-2PLD (SEQ ID NO: 1), and the obtained amplified fragment is restricted. This primer is designed to insert a His tag in-frame by digesting with the enzyme BamHI and inserting it into the BamHI recognition site of pETKmS2.

  The PCR conditions were according to the protocol attached to the kit except that the primer concentration was 1 μM, the annealing temperature was 50 ° C., and the extension time was 30 seconds.

  The amplification product of about 540 bp obtained by PCR was cloned into pGEM (registered trademark) -T Easy of TA cloning kit (Promega), and the nucleotide sequence was confirmed. Thereafter, the amplification product was excised with restriction enzymes BglII and BamHI. By substituting the obtained fragment for a portion excised by restriction enzymes BglII and BamHI in the nucleic acid encoding TH-2PLD on pETKmS2, a polypeptide having a His tag added to the C-terminus of TH-2PLD was obtained. An expression vector carrying the encoding nucleic acid was obtained. Using the expression vector, a His-tagged TH-2PLD was obtained in the same manner as in Example 2.

  Further, a primer T3 [TCGGACGTCGATCTCGCGCT (SEQ ID NO: 14)] and a primer T4 [GTCGTAGAGGCGGACGTCGTA (SEQ ID NO: 15)] were used, and a nucleic acid encoding TH-2PLD was used as a template to produce a GC-RICH PCR System kit (Roche). ) Was used to perform PCR.

  The primer T3 changes the amino acid residue (Asp) by substituting C at base number 762 for T in base numbers 751 to 770 of the base sequence of TH-2PLD (SEQ ID NO: 1). It is a primer that eliminates the restriction enzyme SalI recognition site (base number: 757 of SEQ ID NO: 1) without causing it. The primer T4 is a primer corresponding to nucleotide numbers 1198 to 1218 of the base sequence of TH-2PLD.

  The PCR conditions were according to the protocol attached to the kit except that the primer concentration was 1 μM, the annealing temperature was 50 ° C., and the extension time was 30 seconds.

  The amplified product of about 470 bp obtained by PCR was cloned into pGEM (registered trademark) -T Easy of TA cloning kit (manufactured by Promega), and the nucleotide sequence was confirmed. Thereafter, the amplification product is excised with the restriction enzyme AatII, and the obtained fragment is replaced with the portion of the His-tagged TH-2PLD gene on pETKmS2 which is excised with the restriction enzyme AatII. An expression vector carrying a nucleic acid encoding a polypeptide to which a His tag was added and retaining the restriction enzyme SalI site (position 757) was obtained.

  Furthermore, using the primer T5 [GAACGCCCGGGCACGAAGCGGCTG (SEQ ID NO: 16) and primer T6 [GTGTCGACGTAGTCGTCCTTCCANNNGTTGAT (SEQ ID NO: 17)], using the nucleic acid encoding TH-2PLD as a template, GC-RICH PCR System kit (Roche) PCR was performed using

  The primer T5 is a primer having a sequence corresponding to base numbers 337 to 360 of the base sequence of TH-2PLD (SEQ ID NO: 1). The primer T6 is a primer corresponding to the base number: 706 to 737 of the base sequence (SEQ ID NO: 1) of TH-2PLD, and the base number: 712 of the base sequence of TH-2PLD (SEQ ID NO: 1). This primer is designed so that the amino acid residue at position 188 of TH-2PLD can be substituted by substituting the base sequence of ˜714.

  The PCR conditions were according to the protocol attached to the kit except that the primer concentration was 1 μM, the annealing temperature was 50 ° C., and the extension time was 30 seconds.

  The amplification product of about 400 bp obtained by PCR was cloned into pGEM (registered trademark) -T Easy of TA cloning kit (manufactured by Promega), and the nucleotide sequence was confirmed. Thereafter, the amplified product is excised with the restriction enzyme SalI, and the fragment obtained is replaced with a portion excised with the restriction enzyme SalI in the nucleic acid encoding His-tagged TH-2PLD on pETKmS2, thereby obtaining a TH-2PLD. A His-tagged PLD expression vector was obtained in which a His tag was added to the C-terminus of TH-2PLD and Gly at position 188 of TH-2PLD was substituted with another amino acid. Using the expression vector, a His-tagged mutant TH-2PLD was expressed in the same manner as in Example 2.

  Subsequently, 0.02 ml of an aqueous solution corresponding to 0.005 U each of the His-tagged mutant TH-2PLD and His-tagged TH-2PLD was incubated at 60 ° C. for 10 minutes. For the His-tagged mutant TH-2PLD and His-tagged TH-2PLD after incubation, the hydrolysis activity was measured in the same manner as in (i) of (2) of Example 1 above. In addition, as a control, 0.02 ml of His-tagged mutant TH-2PLD and His-tagged TH-2PLD (each equivalent to 0.005 U) without incubation at 60 ° C. for 10 minutes were used, and hydrolysis was performed in the same manner as described above. Activity was measured. The result is shown in FIG. In FIG. 3, the residual activity calculated with the hydrolysis activity without incubation as 100 is shown.

  As a result, G at position 188 was substituted with C (cysteine), E (glutamic acid), K (lysine), L (leucine), M (methionine), N (asparagine) and R (arginine), respectively. Species mutant enzymes did not show phospholipase D activity.

  As shown in FIG. 3, in TH-2PLD, the residual activity is 10% or less, whereas G at position 188 is relatively hydrophobic, V (valine), F (phenylalanine) and W ( It was found that the residual activity exceeded 50% in the mutant enzymes (G188V, G188F and G188W) substituted for each of the tryptophan).

(2) Examination of thermal stability The resulting strain expressing His-tagged TH-2PLD and the amino acid residue at position 188 are V (valine), F (phenylalanine), W (tryptophan), or S (serine). For a strain expressing a certain His-tagged mutation TH-2PLD [G188V, G188F, G188W or G188S], the culture supernatant was concentrated with 70% saturated ammonium sulfate, and the resulting precipitate was added to a 1/15 M phosphate buffer. Dialyzed against (pH 7.0). The obtained product was subjected to a nickel affinity column (trade name: TALON Metal Affinity Resins, manufactured by Clontech) to obtain His-tagged mutant TH-2PLD and His-tagged TH-2PLD.

  Subsequently, the optimum temperature was evaluated using each of the obtained His-tagged mutant TH-2PLD and His-tagged TH-2PLD. Each of the His-tagged mutant TH-2PLD and His-tagged TH-2PLD (1.0 μg equivalent) was measured at 35 ° C., 45 ° C., in the same manner as in the activity measurement method of (i) in (2) of Example 1. The hydrolysis activity of phospholipase D at 55 ° C, 65 ° C, 75 ° C and 85 ° C was measured. The result is shown in panel A of FIG. In FIG. 4, panel A shows the relative activity calculated with 100 as the maximum activity.

  Further, for each of the His-tagged mutant TH-2PLD and His-tagged TH-2PLD (1.0 μg equivalent), the activity was measured at 37 ° C. and 65 ° C. as in the activity measurement method of (i) of Example 1 (2). The activity at each temperature was measured and the specific activity was calculated. The result is shown in panel B of FIG.

  As shown in panel A of FIG. 4, it can be seen that both His-tagged mutant TH-2PLD and His-tagged TH-2PLD show maximum activity around 65 ° C. Among them, G188V and G188F show almost the same activity as the maximum activity even at 75 ° C., and it can be seen that the temperature range where the activity is higher than the original TH-2PLD is expanded.

  Also, as shown in panel B of FIG. 4, the specific activity at 37 ° C. is 35-40 U / mg for both His-tagged mutant TH-2PLD and His-tagged TH-2PLD. Since all showed values of around 60 U / mg at ° C., it can be seen that these substitutions do not affect the catalytic performance.

  Next, for each of the His-tagged mutant TH-2PLD and His-tagged TH-2PLD (0.1 mg / ml), each was incubated at 15 ° C., 55 ° C., 65 ° C., 68 ° C., and 75 ° C. for 10 minutes. Residual activity was measured. The hydrolysis activity was determined in the same manner as (i) of Example 1 (2) except that the His-tagged mutant TH-2PLD and His-tagged TH-2PLD were previously incubated at the indicated temperature and incubation time. It was measured. The results are shown in panel A of FIG. In panel A of FIG. 5, the residual activity calculated with the hydrolysis activity without incubation as 100 is shown.

  Moreover, the change over time of the residual activity was measured when incubated at 68 ° C. for 5 minutes, 10 minutes, and 15 minutes. The hydrolysis activity was determined in the same manner as (i) of Example 1 (2) except that the His-tagged mutant TH-2PLD and His-tagged TH-2PLD were previously incubated at the indicated temperature and incubation time. It was measured. The results are shown in panel B of FIG. In panel B of FIG. 5, the residual activity calculated with the hydrolysis without incubation as 100 is shown.

  As shown in FIG. 5 panel A, TH-2PLD and G188S have a residual activity of 20% or less after incubation at 65 ° C. for 10 minutes, whereas G188V, G188F and G188W have almost 100% activity. It can be seen that

  Further, as shown in FIG. 5 panel B, from the results of comparison of changes in residual activity over time at 68 ° C., among G188V, G188F, and G188W, G188F is particularly excellent in thermal stability. I understand.

  Primer: Primer PDK6-C1 [5'-TCCAGGACTTCGGGTACGTGGTG-3 '(SEQ ID NO: 18)] and NcoI, KpnI and BamHI recognition sites on the 5'-end side Primer PDK6-C2 [5'-ACCATGGGGTACCGGATCCGAGGCCGGGCAGAGG-3' (SEQ ID NO: 19)] and the 3′-terminal region of the phospholipase D (K6PLD) gene (referred to as PDK6) derived from the Streptomyces halstedii subsp. Scabies K6 strain by PCR. Amplified. The PCR was performed using a GC-RICH PCR System kit (Roche) with a plasmid carrying PDK6 as a template. The obtained amplification product was cloned into pGEM-T Easy (Promega).

  Further, a fusion gene (excluding the 3'-terminal region) of the nucleic acid encoding the secretion signal of T7-lac promoter and E. coli PelB protein and PDK6 was excised from the plasmid in which the PDK6 was incorporated into the expression vector pETKmS2. The obtained fragment was ligated with the 3'-terminal region of PDK6.

  On the other hand, the nucleic acid corresponding to the HIS tag on the expression vector pETKmS2 and the T7 terminator were used as a primer HIS6-1 [5′-TCGGATCCGAATTCGAGCTCCG-3 ′ (SEQ ID NO: 20)] and a primer HIS6-2 [5′-AGATATCTCCGGATATAGTTCCTCCTTTC-3 ′. (SEQ ID NO: 21)]. The PCR was performed using the GC-RICH PCR System kit (Roche) with pETKmS2 as a template. The obtained amplification product was cloned into pGEM-T Easy (Promega). Thereafter, a fragment corresponding to the amplification product was excised and ligated to the 3′-end of the phospholipase D gene (PDTH2) derived from the Streptomyces septatus TH-2 strain.

  Next, two phospholipase D genes were ligated in tandem using the NcoI recognition site added to the 3 'end of PDK6 and the NcoI recognition site added in the vicinity of the initiation codon of PDTH2. A fragment containing T7-lac promoter / pelB signal-PDK6 / PDTH2-His tag / T7 terminator was excised from the resulting plasmid and inserted into the tetracycline resistance gene region of pACYC184 to obtain pACT (K6 / TH2).

  By digesting pNC124 with KpnI, a fragment containing the gentamicin (Gm) resistance gene and rpsL was excised, and the obtained fragment was recognized at the KpnI recognition site provided at the ligation site between PDK6 and PDTH2 of pACT (K6 / TH2). The plasmid pACT (K6 / GS / TH2) for in vivo DNA shuffling was obtained by insertion into the site.

  Further, a fragment containing lacI was excised from pET-22b (+) (manufactured by Novagen), and the obtained fragment was inserted into the pACT (K6 / TH2) to construct pACTI (K6 / TH2). ccdA and ccdB were excised from pTN1117, and the obtained fragment was inserted into the pACTI (K6 / TH2) to obtain pACTIS2 (K6 / TH2). Subsequently, the Gm resistance gene excised from pNC124 and rpsL were incorporated into the pACTIS2 (K6 / TH2) to obtain a shuffling plasmid pACTIS2 (K6 / GS / TH2).

  Product name: Gene Pulser [manufactured by Bio-Rad (BIO-RAD)] was used for electroporation, and the shuffling plasmid pACTIS2 (K6 / GS / TH2) was obtained from Escherichia coli MK1019 [rpsL (Smr) ssb-3]. Introduced.

  The obtained cells were seeded on a plate of Luria-Bertani (LB) solid medium (referred to as LB (Cm, Gm) plate) containing 50 μg / ml chloramphenicol and 20 μg / ml gentamicin. Cultivated overnight. The grown colonies were separated into another LB (Cm, Gm) plate and an LB solid medium plate [LB (Cm, Gm, Sm) containing 50 μg / ml chloramphenicol, 20 μg / ml gentamicin, and 50 μg / ml streptomycin. And so on) and cultured at 37 ° C. overnight to confirm the sensitivity to streptomycin (Sm).

  Select colonies of Sm-sensitive clones from the LB (Cm, Gm) plate, inoculate the obtained colonies into 2 ml of LB liquid medium containing 50 μg / ml chloramphenicol, and culture overnight at 37 ° C. with shaking. Promoted chimera formation.

  Then, after appropriately diluting the obtained culture, it was spread on an LB (Cm, Sm) plate and cultured at 37 ° C. overnight, and from the Sm-resistant colonies that had grown on the plate, the alkaline miniprep method was used. A plasmid was prepared.

  Escherichia coli BL21-Gold (DE3) [manufactured by Stratagene] was transformed with the obtained plasmid, and a single colony was inoculated into a chloramphenicol-containing LB liquid medium and shaken at 37 ° C. overnight. Cultured. 0.5 ml of the obtained culture solution is inoculated into 50 ml of an expression medium [Naoto Mishima et al., Biotechnol. Prog., 13 (1997) 864-868, 50 μg / ml chloramphenicol]. And cultured with shaking at 125 rpm for 12 hours at 30 ° C. Thereafter, IPTG was added to the medium so as to have a final concentration of 1 mM, followed by shaking culture at 125 rpm for 4-5 days at 16 ° C.

  The obtained culture was centrifuged at 3500 × g for 60 minutes to obtain a culture supernatant. The obtained culture supernatant was subjected to a trade name: MagExtractor-His-tag-kit (manufactured by Toyobo Co., Ltd.) to obtain various chimeric PLDs.

  As a result, chimera PLD [chimera PLD a to chimera PLD i in FIG. 6] was obtained.

  About each of said chimera PLD ai, the hydrolysis activity was measured like (i) of the said Example 1 (2). As controls, PLD derived from actinomycete K6 strain (K6PLD) and PLD derived from TH-2 strain (TH-2PLD) were used.

  Each of the chimeric PLD ai, K6PLD and TH-2PLD was incubated at 50, 55, 60, 65 and 70 ° C. for 10 minutes, and then each enzyme obtained was hydrolyzed using phosphatidyl-p-nitrophenol. Activity was measured. The result is shown in FIG. In FIG. 7, the residual activity after incubation at 15 ° C. is shown as 100.

  As a result, as shown in FIG. 7, TH-2PLD and K6PLD retained almost 100% activity even after incubation at 60 ° C. for 10 minutes. A decrease in was observed.

  FIG. 8 shows the thermal stability when incubated at 50 ° C. for 10 minutes and the thermal stability when incubated at 55 ° C. for 10 minutes.

  As a result, as shown in FIG. 8, in the chimeric PLD, the thermal stability when incubated at 50 ° C. for 10 minutes and the thermal stability when incubated at 55 ° C. for 10 minutes are remarkable. The difference was recognized.

  Among them, chimera g was completely inactivated when incubated at 50 ° C. for 10 minutes, while other chimeric PLDs showed more than 70% of the control activity even when incubated at 50 ° C. for 10 minutes. Was holding.

  Therefore, it was suggested that amino acid residues related to temperature sensitivity exist in the region around the recombination point of chimera g.

  On the other hand, when incubation was performed at 55 ° C. for 10 minutes, chimera g, chimera f, and chimera h were almost completely inactivated.

  Therefore, it was suggested that amino acid residues near the recombination points of chimera f and chimera h are also related to temperature sensitivity.

Comparative Example 1

  In the same manner as in Example 4, three types of chimeric PLDs having a recombination point between a recombination point in chimera F and a recombination point in chimera G [chimeric PLD j, chimera PLD k, and chimera PLD l] Was made. The amino acid sequences near the recombination points of the chimeric PLD j, chimeric PLD k, and chimeric PLD l are shown in the left panel of FIG.

  The chimeric PLD j, the chimeric PLD k, and the chimeric PLD l were examined for residual activity when incubated for 10 minutes at 50 ° C., 55 ° C., and 60 ° C., respectively, by the same method as in Example 3 (2). . The results are shown in the right panel of FIG. In the figure, the residual activity after incubation at 15 ° C. is shown as 100.

  As a result, chimera PLD j, chimera PLD k, and chimera PLD l were almost completely inactivated by incubation at 50 ° C. for 10 minutes in the same manner as chimera PLD g.

  The difference between the chimeric PLD f and the chimeric PLD j is that the amino acid residue at position 331 and the amino acid residue at position 333 are glycine and isoleucine, respectively, in the chimeric PLD j, as in the case of K6PLD. In f, like TH-2PLD, it is lysine and valine, respectively. Therefore, it was suggested that the amino acid residue at position 331 and / or the amino acid residue at position 333 are involved in thermal stability.

  Subsequently, for the chimeric PLD g having the lowest heat stability, a mutant enzyme having a substitution of glycine at position 331 with lysine and / or a substitution of isoleucine at position 333 with valine by the same method as in Example 3 above. Enzyme GI / KV, mutant enzyme G / K, mutant enzyme I / V] were prepared.

  For the preparation of the mutant enzyme GI / KV, the primer G682: 5′-TGTCAGAACAGGAACAACATC-3 ′ (SEQ ID NO: 22) and the primer chimG (GI / KV): 5′-AGATCTCGACGTGCTTCTTCGCGCT-3 ′ (SEQ ID NO: 23) For the preparation of the primer pair consisting of: and the mutant enzyme G / K, the primer pair consisting of the primer G682 and the primer G / K: 5'-AGATCTCGATGTGCTTCTTCGCGCT-3 '(SEQ ID NO: 24), the mutant enzyme I / V For the preparation, a primer pair consisting of the primer G682 and primer I / V: 5′-AGATCTCGACGTGCCCCTTCGCGCT-3 ′ (SEQ ID NO: 25) was used.

  After each of the obtained mutant enzymes was incubated at 55 ° C. for 0, 5, 10 or 15 minutes, the obtained mutant enzymes were subjected to hydrolysis activity in the same manner as (i) of (2) of Example 1. It was measured. The results are shown in FIG. In the figure, the residual activity calculated with the hydrolysis activity without incubation as 100 is shown. Further, for each of the obtained mutant enzymes, after incubation at 15 ° C., 50 ° C., 55 ° C. or 60 ° C. for 10 minutes, the obtained mutant enzymes were subjected to the same procedure as in (2) (i) of Example 1, Hydrolysis activity was measured. The results are shown in FIG. In the figure, the residual activity after incubation at 15 ° C. is shown as 100.

  As a result, as shown in FIG. 10 and FIG. 11, in the chimeric PLD g, the amino acid residue corresponding to position 331 and the amino acid residue corresponding to position 333 in TH-2PLD are changed to the corresponding amino acid residue in the chimeric PLD f. It was found that the thermal stability did not change even when the group was substituted. That is, it was suggested that these amino acid residues are not directly involved in thermal stability.

  In the same manner as in Example 4, three types of chimeric PLDs having a recombination point between the recombination point in chimera H and the recombination point in chimera I [chimeric PLD m, chimera PLD n, and chimera PLD o] Was made. The amino acid sequences near the recombination points of the chimeric PLD m, chimeric PLD n, and chimeric PLD o are shown in the upper panel of FIG.

  Each of the chimeric PLD m, the chimeric PLD n, and the chimeric PLD o was examined for residual activity when incubated at 55 ° C. for 10 minutes in the same manner as in Example 2. The results are shown in the upper panel of FIG. In the figure, the residual activity after incubation at 15 ° C. is shown as 100.

  As a result, chimera PLD h was completely inactivated, while chimera PLD m, chimera PLD n, and chimera PLD o all had a residual activity of 90% or more, as in chimera PLD i.

  For chimeric PLD h, the amino acid residues at positions 426, 430, 432 and 433 are alanine, aspartic acid, alanine and lysine, respectively, whereas for chimeric PLD m, phenylalanine, lysine, proline and threonine It is a point. Therefore, it was suggested that one or more of these residues are involved in thermal stability.

  By the same method as in Example 3, phenylalanine at position 426 in chimeric PLD m, lysine at position 430, proline at position 432, and threonine at position 433, respectively, the corresponding amino acid residues in chimeric PLD h, specifically Produced mutant enzymes F / A, K / D, P / A and T / K substituted with alanine, aspartic acid, alanine and lysine.

  In the production of the mutant enzyme, the restriction enzyme site XhoI was introduced without changing the amino acid sequence in the base sequence corresponding to the serine-serine portions of the 428-429th positions of the chimeric PLD h. That is, a fragment of about 300 bp was amplified using a primer pair consisting of primer K6Bgl2: 5′-ATCTCCAGCGCGAAGGGGCAC-3 ′ (SEQ ID NO: 26) and primer XhoIBamHI: 5′-GGATCTGCTCGAGCGGGCGGTGGCGAGCTGGAG-3 ′ (SEQ ID NO: 27). Then, the obtained product was subcloned on pUC19, and then the 300 bp fragment was replaced with the region excised from BglII and BamHI of the chimeric PLD h.

  Then, a fragment of about 300 bp was amplified with a primer pair consisting of primer XhoI1281: 5′-CTCGAGCGACAGCGCCAAGTGGGCCG-3 ′ (SEQ ID NO: 28) and primer PLDHIS: 5′-GGATCCGAGCCCTGGCAGAGGCC-3 ′ (SEQ ID NO: 29). The obtained fragment was replaced with the amplification product corresponding to the upstream portion of XhoI of the nucleic acid encoding the chimeric PLD h, cut with XhoI and BamHI, and the product amplified downstream was inserted into the cut end. .

  Using the obtained product, the mutant enzyme F / A was prepared by substituting the 300 bp fragment between BglII and XhoI of the nucleic acid encoding the chimeric PLD h, and the mutant enzyme K / D, mutant enzyme P / A and Mutant enzyme T / K was prepared by substituting a 300 bp fragment between XhoI and BamHI of a nucleic acid encoding chimeric PLD h.

  For the preparation of the mutant enzyme F / A, a primer pair consisting of the primer XhoI-DAK / KPT: 5′-CTCGAGCAAGAGCCCCACGTGGGCCG-3 ′ (SEQ ID NO: 30) and the primer PLDHIS, and the mutant enzyme K / D were prepared. Is a primer pair consisting of primer XhoI-DAK / DPT: 5′-CTCGAGCGACAGCCCCACGTGGGCCG-3 ′ (SEQ ID NO: 31) and the primer PLDHIS, and primer XhoI-DAK / KAT: 5 For the preparation of a primer pair consisting of '-CTCGAGCAAGAGCGCCACGTGGGCCG-3' (SEQ ID NO: 32) and the above-mentioned primer PLDHIS, and the mutant enzyme T / K, the primer XhoI-DAK / KPK: 5'-CTCGAGCAAGAGCCCCAAGTGGGCCG-3 '(SEQ ID NO: 33) and a primer pair consisting of the primer PLDHIS were used.

  After each of the obtained mutant enzymes was incubated at 60 ° C. for 0, 5, 10 or 15 minutes, the obtained mutant enzymes were subjected to hydrolysis activity in the same manner as in (i) of (2) of Example 1. It was measured. The results are shown in FIG. In the figure, the residual activity calculated with the hydrolysis activity without incubation as 100 is shown. Further, for each of the obtained mutant enzymes, after incubation at 15 ° C., 50 ° C., 55 ° C. or 60 ° C. for 10 minutes, the obtained mutant enzymes were subjected to the same procedure as in (2) (i) of Example 1, Hydrolysis activity was measured. The results are shown in FIG. In the figure, the residual activity after incubation at 15 ° C. is shown as 100.

  As shown in FIGS. 13 and 14, it was suggested that the amino acid residue corresponding to position 426 and the amino acid residue corresponding to position 433 in TH-2PLD are residues involved in thermal stability.

  In the same manner as in Example 3, in the chimeric PLD h, the amino acid residue corresponding to position 426 and the amino acid residue corresponding to position 433 in TH-2PLD were easily heat-treated compared to the chimeric PLD h. Mutant enzymes [chimeric PLD h A / F, chimeric PLD h K / T and chimeric PLD h AK / FT] were prepared by substituting the corresponding amino acid residues in m.

  For the preparation of chimeric PLD h A / F, a primer pair consisting of the primer K6Bgl2 and primer A / F-XhoI: 5′-CTCGAGCGGAAGGTGGCGAGCTGGAG-3 ′ (SEQ ID NO: 34), chimera PLD h K / T The primer pair which consists of primer XhoI-DAK / DAT: 5'-CTCGAGCGACAGCGCCACGTGGGCCG-3 '(sequence number: 35) and said primer PLDHIS was used for preparation. Chimeric PLD h AK / FT was produced by linking chimeric PLD h (A / F) and chimeric PLD h (K / T) between XhoI and BamHI.

  Each of the obtained mutant enzymes was incubated at 15 ° C., 50 ° C., 55 ° C. or 60 ° C. for 10 minutes, and then the obtained mutant enzymes were hydrolyzed in the same manner as in (i) of Example 1 (2). Activity was measured. The results are shown in FIG. In the figure, the residual activity after incubation at 15 ° C. is shown as 100. Further, after each of the obtained mutant enzymes was incubated at 55 ° C. for 0, 5, 10 or 15 minutes, the obtained mutant enzymes were hydrolyzed in the same manner as (i) of Example 1 (2). Activity was measured. The results are shown in FIG. In the figure, the residual activity calculated with the hydrolysis activity without incubation as 100 is shown.

  As a result, as shown in FIGS. 15 and 16, in the chimeric PLD h, the amino acid residue corresponding to position 426 and the amino acid residue corresponding to position 433 in TH-2PLD are changed to the corresponding amino acid residues in chimeric PLD m. It was found that the thermal stability of the chimeric PLD h is improved by substituting

  That is, it was found that the thermal stability was improved by substituting the amino acid residue corresponding to position 426 and the amino acid residue corresponding to position 433 in TH-2PLD with the same amino acid residue as that of K6PLD.

  A mutant enzyme [TH-2PLD A / F, TH-2PLD K] in which each of alanine at position 426 and lysine at position 433 of TH-2PLD was substituted with the same amino acid residue as K6PLD by the same method as in Example 3. / T and TH-2PLD AK / FT].

  When producing a mutant enzyme of TH-2PLD, the restriction enzyme site XhoI was introduced without changing the amino acid sequence in the base sequence corresponding to the 428-429th (1281st base) serine-serine portion of TH-2PLD. did.

Using a primer pair consisting of the primer TH2Bgl2: 5′-AGCGCGAAGAAGCACGTCGA-3 ′ (SEQ ID NO: 36) and the primer XhoIBamHI, an approximately 300 bp fragment was amplified, and the resulting product was subcloned onto pUC19. The 300 bp fragment was replaced with a region excised from BglII and BamHI of TH-2PLD.

  Thereafter, using the primer XhoI1281 and the primer PLDHIS, a fragment of about 300 bp was amplified, and the obtained fragment was replaced with an amplification product corresponding to the upstream side of the nucleic acid encoding TH-2 from XhoI. After cutting with XhoI and BamHI, the downstream amplification product was inserted into the cut end.

  Using the obtained product, the mutant enzyme TH-2PLD A / F was prepared by substituting a 300 bp fragment between BglII and XhoI of the nucleic acid encoding TH-2PLD, and the mutant enzyme TH-2PLD K / T was This was prepared by substituting a 300 bp fragment between XhoI and BamHI of the nucleic acid encoding TH-2PLD.

  For the preparation of TH-2PLD A / F, a primer pair consisting of the primer TH2Bgl2 and the primer A / F-XhoI, and for the preparation of TH-2PLD K / T, the primer XhoI-DAK / DAT and the primer A primer pair consisting of the primer PLDHIS was used. Moreover, TH-2PLD AK / FT was prepared by linking TH-2PLD A / F and TH-2PLD K / T between XhoI and BamHI.

  After each of the obtained mutant enzymes was incubated at 15 ° C., 50 ° C., 55 ° C., 60 ° C., 65 ° C. or 70 ° C. for 10 minutes, the obtained mutant enzymes were subjected to (i) of Example 1 (2). In the same manner as above, hydrolysis activity was measured. The results are shown in FIG. In the figure, the residual activity after incubation at 15 ° C. is shown as 100. In addition, each of the obtained mutant enzymes was incubated at 60 ° C. and 62 ° C. for 0, 5, 10 or 15 minutes, and then the obtained mutant enzymes were the same as (i) of (2) of Example 1. Then, the hydrolysis activity was measured. The results are shown in FIGS. 18 and 19, respectively. In the figure, the residual activity calculated with the hydrolysis activity without incubation as 100 is shown.

  As a result, as shown in FIG. 18 and FIG. 19, respectively, the alanine at position 426 and the lysine at position 433 of TH-2PLD were substituted with phenylalanine and threonine, respectively, in the same manner as K6PLD. Was found to improve.

  According to the same procedure as in Example 3, TH-2PLD has substitution of glycine at position 188 with phenylalanine, substitution of alanine at position 426 with phenylalanine and / or substitution of lysine at position 433 with threonine. Mutant enzymes [TH-2PLD G188F, TH-2PLD G188FA / F, TH-2PLD G188FAK / FT] were prepared.

  The TH-2PLD G188F was produced in the same manner as in Example 3.

  TH-2PLD G188FA / F and TH-2PLD G188FAK / FT use TH-2PLD G188F and TH-2PLD A / F and TH-2PLD AK / FT obtained in Example 8, respectively, and use BglI and BamHI. It was produced using.

  After each of the obtained mutant enzymes was incubated at 15 ° C., 50 ° C., 55 ° C., 60 ° C., 65 ° C. or 70 ° C. for 10 minutes, the obtained mutant enzymes were subjected to (i) of Example 1 (2). In the same manner as above, hydrolysis activity was measured. The results are shown in FIG. In the figure, the residual activity after incubation at 15 ° C. is shown as 100. In addition, after each of the obtained mutant enzymes was incubated at 70 ° C., 72 ° C. and 74 ° C. for 0, 5, 10 or 15 minutes, the obtained mutant enzymes were subjected to (i) in (1) of Example 1 (i). The hydrolysis activity was measured in the same manner as in (1). The results are shown in FIGS. 21, 22 and 23, respectively. In the figure, the residual activity calculated with the hydrolysis activity without incubation as 100 is shown.

  As a result, as shown in FIG. 20, FIG. 21, FIG. 22 and FIG. 23, in TH-2PLD, in addition to substitution of glycine at position 188 with phenylalanine, substitution of alanine at position 427 with phenylalanine and / or Alternatively, it was found that substituting lysine at position 434 with threonine improved the thermal stability as compared with the case where only substitution of glycine at position 188 with phenylalanine was performed.

  In the same manner as in Example 3, in TH-2PLD, a mutant enzyme in which an alanine corresponding to the amino acid residue at position 426 is substituted with another amino acid residue [TH-2 (A426G), TH-2 (A426V ), TH-2 (A426I), TH-2 (A426L), TH-2 (A426F), TH-2 (A426W), TH-2 (A426Y), TH-2 (A426H)] and the amino acid residue at position 433 Mutant enzymes in which lysine corresponding to the group is substituted with other amino acid residues [TH-2 (K433T), TH-2 (K433S), TH-2 (K433Y), TH-2 (K433C), TH-2 ( K433R), TH-2 (K433H), TH-2 (K433D), TH-2 (K433E)].

  TH-2 (K433T) was prepared by using a primer pair consisting of the primer XhoI-DAK / DAT and the primer PLDHIS, TH-2 (K433Y), TH-2 (K433h) or TH-2 (K433D). The primer XhoI-K / YHD: 5′-CTCGAGCGACAGCGCCBACTGGGCCG-3 ′ (B = T or G or C) (SEQ ID NO: 37) and the primer pair consisting of the primer PLDHIS, TH-2 (K433S) In preparation of TH-2 (K433C) or TH-2 (K433R), the primer XhoI-K / SCR: 5′-CTCGAGCGACAGCGCCHGCTGGGCCG-3 ′ (H = A or T or C) (SEQ ID NO: 38) and the above Primer XhoI-K / E: 5′-CTCGAGCGACAGCGCCGAGT was used for the preparation of a primer pair consisting of primer PLDHIS, TH-2 (K433E). A primer pair consisting of GGGCCG-3 ′ (SEQ ID NO: 39) and the primer PLDHIS was used.

  After each of the obtained mutant enzymes was incubated at 15 ° C., 50 ° C., 55 ° C., 60 ° C., 65 ° C. or 70 ° C. for 10 minutes, the obtained mutant enzymes were subjected to (i) of Example 1 (2). In the same manner as above, hydrolysis activity was measured. The results are shown in FIGS. In the figure, the residual activity after incubation at 15 ° C. is shown as 100. In addition, each of the obtained mutant enzymes was incubated at 65 ° C. for 0, 5, 10 or 15 minutes, and then the obtained mutant enzymes were hydrolyzed in the same manner as in (i) of Example 1 (2). Activity was measured. The results are shown in FIGS. 26 and 27, respectively. In the figure, the residual activity calculated with the hydrolysis activity without incubation as 100 is shown.

  As a result, as shown in FIG. 24 and FIG. 25, in TH-2PLD, the alanine corresponding to the amino acid residue at position 426 is substituted with glycine, phenylalanine or tyrosine, so that it is more stable than TH-2PLD. It was found that the performance was improved.

  In addition, as shown in FIGS. 26 and 27, in TH-2PLD, lysine corresponding to the amino acid residue at position 433 is substituted with threonine, serine, tyrosine, cysteine, arginine or histidine, so that TH-2PLD It was found that the thermal stability was improved as compared with.

  INDUSTRIAL APPLICABILITY According to the present invention, it is useful for improving the efficiency in the production of phospholipids and derivatives of the phospholipids, which are useful for cosmetic base materials, pharmaceuticals and the like.

FIG. 1 is a diagram showing the structure and thermal stability of chimeric phospholipase D (chimeric PLD). The left panel shows phospholipase D (K1PLD) derived from Streptomyces halstedii K1, strain, phospholipase D (TH-2PLD) derived from Streptomyces septatus TH-2, and K1PLD and TH. It is the schematic which shows each primary structure of chimeric phospholipase D produced from -2PLD. In the left panel, “aa” indicates an amino acid residue. The right panel shows the thermal stability of K1PLD, TH-2PLD, and chimeric PLD when incubated at 60 ° C. for 10 minutes. FIG. 2 is a diagram showing mutation sites and thermal stability in the mutant enzymes C1 to C4. The left panel shows the structure of the mutation site in the mutant enzymes C1 to C4 of the chimeric PLD C. The right panel shows the thermal stability of chimeric PLD C and mutant enzymes C1-C4 when incubated at 60 ° C. for 10 minutes. FIG. 3 is a diagram showing the thermal stability of the TH-2PLD mutant enzyme when incubated at 60 ° C. for 10 minutes. FIG. 4 is a diagram showing the results of examining the optimum temperature conditions for the TH-2PLD mutant enzyme. Panel A shows the result of examining the optimum temperature, and panel B shows the result of examining the specific activity at 37 ° C. and 65 ° C., respectively. In the figure, a white circle indicates a mutant enzyme at position 188, G, a black circle is V, a white triangle is F, a black triangle is S, and a white square is W. FIG. 5 is a diagram showing the thermal stability of TH-2PLD and its mutant enzyme (0.1 mg / ml). Panel A shows residual activity after 10 minutes incubation at 15 ° C., 55 ° C., 65 ° C., 68 ° C. and 75 ° C., respectively, and Panel B is incubated at 68 ° C. for 5 minutes, 10 minutes, 15 minutes. The change in the residual activity over time is shown. In the figure, a white circle indicates a mutant enzyme at position 188, G, a black circle is V, a white triangle is F, a black triangle is S, and a white square is W. FIG. 6 is a diagram showing a structure of a chimeric PLD a to i that is a chimeric PLD of TH-2PLD and K6PLD. FIG. 7 is a diagram showing the thermal stability of chimeric PLD ai when incubated at 50, 55, 60, 65 and 70 ° C. for 10 minutes. In the figure, A to I correspond to the chimeric PLD a to i, respectively. In the figure, K6 represents K6PLD, and TH-2 represents TH-2PLD. FIG. 8 shows the thermal stability of chimeric PLD ai when incubated at 50 ° C. or 55 ° C. for 10 minutes. FIG. 9 is a diagram showing the structures and thermal stability of chimeric PLD f, chimeric PLD j, chimeric PLD k, chimeric PLD l, and chimeric PLD g. The left panel shows the amino acid sequences (respectively, SEQ ID NOs: 40 to 44) near the recombination points of the chimeric PLD f, the chimeric PLD j, the chimeric PLD k, the chimeric PLD l, and the chimeric PLD g, respectively. The right panel shows the thermal stability of chimeric PLDs f, j, k, l and g (F, J, K, L and G) when incubated for 10 minutes at 50 ° C., 55 ° C. and 60 ° C., respectively. FIG. 10 shows the thermal stability of mutant enzyme GI / KV, mutant enzyme G / K, and mutant enzyme I / V when incubated at 55 ° C. for 0, 5, 10, or 15 minutes. FIG. 11 is a diagram showing the thermal stability of mutant enzyme GI / KV, mutant enzyme G / K and mutant enzyme I / V when incubated at 15 ° C., 50 ° C., 55 ° C. or 60 ° C. for 10 minutes. FIG. 12 is a diagram showing the structure and thermal stability of chimeric PLD m, chimeric PLD n, and chimeric PLD o. The upper panel shows the amino acid sequences near the recombination points of the chimeric PLD m to the chimeric PLD o (SEQ ID NOs: 45 to 49, respectively). The lower panel shows the thermal stability of each of the chimeric PLD m to chimeric PLD o when incubated at 55 ° C. for 10 minutes. FIG. 13 is a diagram showing the thermal stability of chimeric PLD m mutant enzymes F / A, K / D, P / A and T / K when incubated at 60 ° C. for 0, 5, 10 or 15 minutes. . FIG. 14 shows the thermal stability of chimeric PLD m mutant enzymes F / A, K / D, P / A and T / K when incubated at 15 ° C., 50 ° C., 55 ° C. or 60 ° C. for 10 minutes. It is. FIG. 15 shows chimeric PLD h mutant enzymes [chimeric PLD h A / F, chimeric PLD h K / T and chimeric PLD h AK / FT] when incubated at 15 ° C., 50 ° C., 55 ° C. or 60 ° C. for 10 minutes. It is a figure which shows the thermal stability of. FIG. 16 shows the thermal stability of chimeric PLD h mutant enzymes [chimeric PLD h A / F, chimeric PLD h K / T and chimeric PLD h AK / FT] incubated at 55 ° C. for 0, 5, 10 or 15 minutes. It is a figure which shows sex. FIG. 17 shows TH-2PLD mutant enzymes [TH-2PLD A / F, TH-2PLD K / T and TH when incubated at 15 ° C., 50 ° C., 55 ° C., 60 ° C., 65 ° C. or 70 ° C. for 10 minutes. -2PLD AK / FT] is a diagram showing the thermal stability. FIG. 18 shows the heat of TH-2PLD mutant enzymes [TH-2PLD A / F, TH-2PLD K / T and TH-2PLD AK / FT] when incubated at 60 ° C. for 0, 5, 10 or 15 minutes. It is a figure which shows stability. FIG. 19 shows the heat of TH-2PLD mutant enzymes [TH-2PLD A / F, TH-2PLD K / T and TH-2PLD AK / FT] when incubated at 62 ° C. for 0, 5, 10 or 15 minutes. It is a figure which shows stability. FIG. 20 shows TH-2PLD mutant enzymes [TH-2PLD G188F, TH-2PLD G188FA / F, TH-2PLD when incubated at 15 ° C., 50 ° C., 55 ° C., 60 ° C., 65 ° C. or 70 ° C. for 10 minutes. G188FAK / FT] shows the thermal stability. FIG. 21 shows the thermal stability of TH-2PLD mutant enzymes [TH-2PLD G188F, TH-2PLD G188FA / F, TH-2PLD G188FAK / FT] when incubated at 70 ° C. for 0, 5, 10, or 15 minutes. FIG. FIG. 22 shows the thermal stability of TH-2PLD mutant enzymes [TH-2PLD G188F, TH-2PLD G188FA / F, TH-2PLD G188FAK / FT] when incubated at 72 ° C. for 0, 5, 10, or 15 minutes. Indicates. FIG. 23 shows the thermal stability of TH-2PLD mutant enzymes [TH-2PLD G188F, TH-2PLD G188FA / F, TH-2PLD G188FAK / FT] when incubated at 74 ° C. for 0, 5, 10 or 15 minutes. Indicates. FIG. 24 shows TH-2PLD mutant enzymes [TH-2 (A426G), TH-2 (A426V), TH when incubated at 15 ° C., 50 ° C., 55 ° C., 60 ° C., 65 ° C. or 70 ° C. for 10 minutes. -2 (A426I), TH-2 (A426L), TH-2 (A426F), TH-2 (A426W), TH-2 (A426Y), TH-2 (A426H)] . FIG. 25 shows TH-2PLD mutant enzymes [TH-2 (K433T), TH-2 (K433S), TH when incubated at 15 ° C., 50 ° C., 55 ° C., 60 ° C., 65 ° C. or 70 ° C. for 10 minutes. -2 (K433Y), TH-2 (K433C), TH-2 (K433R), TH-2 (K433H), TH-2 (K433D), TH-2 (K433E)] . FIG. 26 shows TH-2PLD mutant enzymes [TH-2 (A426G), TH-2 (A426V), TH-2 (A426I), TH- when incubated at 65 ° C. for 0, 5, 10, or 15 minutes. 2 (A426L), TH-2 (A426F), TH-2 (A426W), TH-2 (A426Y), TH-2 (A426H)]. FIG. 27 shows TH-2PLD mutant enzymes [TH-2 (K433T), TH-2 (K433S), TH-2 (K433Y), TH− when incubated at 65 ° C. for 0, 5, 10 or 15 minutes. 2 (K433C), TH-2 (K433R), TH-2 (K433H), TH-2 (K433D), TH-2 (K433E)].

  SEQ ID NO: 11 is the sequence of primer T1.

  SEQ ID NO: 12 is the sequence of primer T2.

  SEQ ID NO: 13 is a linker sequence.

  SEQ ID NO: 14 is the sequence of primer T3.

  SEQ ID NO: 15 is the sequence of primer T4.

  SEQ ID NO: 16 is the sequence of primer T5.

  SEQ ID NO: 17 is the sequence of primer T6. N in positions 24 to 26 is an arbitrary nucleotide.

  SEQ ID NO: 18 is the sequence of primer PDK6-C1.

  SEQ ID NO: 19 is the sequence of primer PDK6-C2.

  SEQ ID NO: 20 is the sequence of primer HIS6-1.

  SEQ ID NO: 21 is the sequence of primer HIS6-2.

  SEQ ID NO: 22 is the sequence of primer G682.

  SEQ ID NO: 23 is the sequence of primer chimG (GI / KV).

  SEQ ID NO: 24 is the sequence of primer G / K.

  SEQ ID NO: 25 is the sequence of primer I / V.

  SEQ ID NO: 26 is the sequence of primer K6Bgl2.

  SEQ ID NO: 27 is the sequence of primer XhoIBamHI.

  SEQ ID NO: 28 is the sequence of primer XhoI1281.

  SEQ ID NO: 29 is the sequence of primer PLDHIS.

  SEQ ID NO: 30 is the sequence of primer XhoI-DAK / KPT.

  SEQ ID NO: 31 is the sequence of primer XhoI-DAK / DPT.

  SEQ ID NO: 32 is the sequence of primer XhoI-DAK / KAT.

  SEQ ID NO: 33 is the sequence of primer XhoI-DAK / KPK.

  SEQ ID NO: 34 is the sequence of primer A / F-XhoI.

  SEQ ID NO: 35 is the sequence of primer XhoI-DAK / DAT.

  SEQ ID NO: 36 is the sequence of primer TH2Bgl2.

  SEQ ID NO: 37 is the sequence of primer XhoI-K / YHD.

  SEQ ID NO: 38 is the sequence of primer XhoI-K / SCR.

  SEQ ID NO: 39 is the sequence of primer XhoI-K / E.

  SEQ ID NO: 40 is a partial sequence of chimeric PLD f.

  SEQ ID NO: 41 is a partial sequence of chimeric PLD j.

  SEQ ID NO: 42 is a partial sequence of chimeric PLD k.

  SEQ ID NO: 43 is a partial sequence of chimeric PLD l.

  SEQ ID NO: 44 is a partial sequence of chimeric PLD g.

  SEQ ID NO: 45 is a partial sequence of chimeric PLD h.

  SEQ ID NO: 46 is a partial sequence of chimeric PLD m.

  SEQ ID NO: 47 is a partial sequence of chimeric PLD n.

  SEQ ID NO: 48 is a partial sequence of chimeric PLD o.

  SEQ ID NO: 49 is a partial sequence of chimeric PLD i.

Claims (5)

The following (A) to (C):
(A) the amino acid sequence shown in SEQ ID NO: 2,
(B) an amino acid sequence of a polypeptide that is aligned by the BLAST algorithm with respect to the amino acid sequence shown in SEQ ID NO: 2 and has a calculated sequence identity of at least 50% and exhibits phospholipase D activity; ) In the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence of a polypeptide having at least one amino acid residue substitution, deletion, addition or insertion and exhibiting phospholipase D activity;
In one amino acid sequence selected from the group consisting of:
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, and a threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid A method for stabilizing phospholipase D, comprising introducing substitution with one amino acid residue selected from the group consisting of residues. The following (A) to (C):
(A) the amino acid sequence shown in SEQ ID NO: 2,
(B) an amino acid sequence of a polypeptide that is aligned by the BLAST algorithm with respect to the amino acid sequence shown in SEQ ID NO: 2 and has a calculated sequence identity of at least 50% and exhibits phospholipase D activity; ) In the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence of a polypeptide having at least one amino acid residue substitution, deletion, addition or insertion and exhibiting phospholipase D activity;
In one amino acid sequence selected from the group consisting of:
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, and a threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid Substitution with one amino acid residue selected from the group consisting of residues;
c) an amino acid residue corresponding to position 188 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of phenylalanine residue, valine residue, tryptophan residue and serine residue; A method for stabilizing phospholipase D, which comprises introducing   A stabilized phospholipase D obtained by the method for stabilizing phospholipase D according to claim 1 or 2. The following (A) to (C):
(A) the amino acid sequence shown in SEQ ID NO: 2,
(B) an amino acid sequence of a polypeptide that is aligned by the BLAST algorithm with respect to the amino acid sequence shown in SEQ ID NO: 2 and has a calculated sequence identity of at least 50% and exhibits phospholipase D activity; ) In the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence of a polypeptide having at least one amino acid residue substitution, deletion, addition or insertion and exhibiting phospholipase D activity;
In one amino acid sequence selected from the group consisting of:
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, and a threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid A stabilized phospholipase D having a substitution with one amino acid residue selected from the group consisting of residues. The following (A) to (C):
(A) the amino acid sequence shown in SEQ ID NO: 2,
(B) an amino acid sequence of a polypeptide that is aligned by the BLAST algorithm with respect to the amino acid sequence shown in SEQ ID NO: 2 and has a calculated sequence identity of at least 50% and exhibits phospholipase D activity; ) In the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence of a polypeptide having at least one amino acid residue substitution, deletion, addition or insertion and exhibiting phospholipase D activity;
In one amino acid sequence selected from the group consisting of:
a) an amino acid residue corresponding to position 426 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of a glycine residue, a phenylalanine residue, a tyrosine residue and a histidine residue; And / or b) an amino acid residue corresponding to position 433 in the amino acid sequence shown in SEQ ID NO: 2, and a threonine residue, serine residue, cysteine residue, arginine residue, histidine residue and aspartic acid Substitution with one amino acid residue selected from the group consisting of residues,
When,
c) an amino acid residue corresponding to position 188 in the amino acid sequence shown in SEQ ID NO: 2 and one amino acid residue selected from the group consisting of phenylalanine residue, valine residue, tryptophan residue and serine residue; A stabilized phospholipase D having the following substitution:

Images