KR101204415B1 - Compositions for Preventing or Treating Obesity, Hyperlipidemia or Fatty Liver - Google Patents

Abstract

PURPOSE: A composition containing Cudrania tricuspidata extract is provided to prevent, relieve, or treat obesity, hyperlipidemia, or fatty liver with safety to human body. CONSTITUTION: A food composition for treating obesity or fatty liver contains Cudrania tricuspidata extract as an active ingredient. The extract is prepared from Cudrania tricuspidata stems using a polar solvent or non-polar solvent. The polar solvent is water, alcohol(methanol, ethanol, propanol, butanol, normal-propanol, iso-propanol, normal-butanol, 1-pentanol, 2-buthoxy ethanol, or ethylene glycol), acetic acid, DMFO(dimethyl-formamide) and DMSO(dimethyl sulfoxide). [Reference numerals] (AA) Body weight(g); (BB) Weeks

Description

Compositions for preventing or treating obesity, hyperlipidemia or fatty liver {Compositions for Preventing or Treating Obesity, Hyperlipidemia or Fatty Liver}

The present invention relates to a composition for preventing or treating obesity, hyperlipidemia or fatty liver.

Accumulation of triglycerides in the body due to obesity promotes fat progenitor cell differentiation and lipid formation (Furuyashiki et al. 2004), which leads to insulin resistance, glucose intolerance and dyslipidemia (Marcelin and Chua 2010). Adipose cells secrete a variety of adipokine such as adiponectin, leptin, resistin and TNF-α to play an important role in regulating energy metabolism and maintaining immune responses and body homeostasis (Ahima and Flier 2000). However, abnormal secretion of these signaling substances is known to act as a cause of further obesity and affect the incidence of metabolic diseases including diabetes (Gil et al. 2008). For these reasons, improving obesity should be of importance for the purpose of preventing factors related to geriatric disease and metabolic syndrome.

Metabolic syndrome is caused by metabolic dysregulation in the body and is combined with hypertension, diabetes mellitus and dyslipidemia (Grundy et al. 2004). The disease reduces high density lipoprotein-cholesterol (HDL-C) levels, increasing triglyceride levels in the blood and increasing cardiovascular mortality. Currently, about 30% of adults in developed and developing countries have metabolic syndrome (Kelishadi et al. 2007), and the prevalence is increasing due to lack of exercise and high-fat eating habits (Fried 2008; Lakka et al. 2002). As a result, interest in prevention and treatment is increasing in Korea.

Dietary fats are hydrolyzed into fatty acids and glycerol by lipases, absorbed by intestinal epithelial cells, converted into triglycerides, and transported to the liver in the form of chylomicrons. do. Lipogenesis occurs in the liver when energy is in excess, and fatty acids and glycerol begin under the influence of insulin (Donnelly et al. 2005). Insulin secreted after eating catalyzes all stages of synthesis, and triglycerides synthesized in the liver are combined with very low density lipoprotein -cholesterol (VLDL) and enter the blood, and some are metabolized into energy. It is stored in adipose tissue and muscle through reesterification (Qureshi and Abrams 2007).

By high-fat method Obesity causes systemic oxidative stress (Galili et al. 2007), and increased reactive oxygen species (ROS) cause biomolecular damage such as protein denaturation, lipid peroxide production, and DNA modification, leading to aging and cancer And pathological conditions such as autoimmune diseases (Valko et al. 2007). For this reason, obesity is becoming an increasingly serious social problem in aesthetic, psychological and medical terms.

Mechanisms for improving obesity include appetite suppression, fat absorption inhibition and heat generation promotion. Among these, orlistat, approved by the U.S. Food and Drug Adminstration (FDA), reduces lipase activity in the pancreas, inhibits fat absorption and effectively excretes lipids. However, problems such as gastrointestinal diseases and rheumatism caused by long-term use of this drug have been raised (Padwal and Majumdar 2007). Therefore, the development of safe and effective anti-obesity substances using natural substances is required.

Oh, Pil-sun et al. (2009) found that the physiologically active ingredients of natural plants have fewer side effects and are effective in enhancing physiological and immune function according to their specific structures. Among them, phenolic substances widely distributed in the plant system have phenolic hydroxyl groups, which bind relatively easily to proteins and macromolecules, and are particularly excellent in anticancer and antioxidant functions (Whang et al. 2001). In addition, it inhibits cholesterol absorption and lowers blood cholesterol (Meguro et al. 2001), and is known to be effective in cardiovascular diseases (Pechanova et al. 2006). Among the phenolic compounds, catechin is found in green tea and has been reported to reduce the risk of fatty acid oxidation, weight loss, visceral fat reduction (Bruno et al. 2008), diabetes and coronary heart disease (Nagao). et al. 2007; Murase et al. 2002).

Cudrania tricuspidata Bureau) is a deciduous tree belonging to the Mulberry family and is distributed mainly in East Asia such as China and Japan. Only one species is introduced in Korea. The main ingredients are 6-8-p-hydroxy benzeneyl taxifolin, kaempferol, naringenin, 7-0-β-D-glucopyrano Contains polyphenolic compounds such as seeds (7-0-β-D-glucopyranoside), xanthones and benzenoids, and antioxidants (Lee et al. 2007), blood sugar Effects have been reported on lowering (Seo et al. 2007), anti-inflammatory (Park et al. 2006) and hypertension (Kang et al. 2002). In addition, there is an effect of inhibiting cancer cell growth in cell line experiments targeting female diseases such as uterine cancer and breast cancer, gastric cancer and lung cancer (Zou et al. 2004). Park et al. (2008) reported that zigzag extracts were effective in reducing blood sugar levels by inhibiting glycated protein production in a study of streptozotocin-induced diabetic rats. The stem is being drunk.

A number of patent documents are referred to throughout this specification and their citations are indicated. The disclosures of the cited patent documents are incorporated by reference herein in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly described.

The present inventors have sought to develop natural substances that can prevent or treat lipid metabolism related diseases, in particular obesity, hyperlipidemia and fatty liver. As a result, the present inventors have found that Kudjippong extract reduces the accumulation of triglycerides, increases the content of HDL-cholesterol in the blood, and is involved in the synthesis of acetyl-CoA carboxylase and peroxide proliferator-activated receptor-γ involved in lipid synthesis. By reducing the amount of expression and increasing adiponectin to improve lipid metabolism, the present invention has been completed by finding out that it is very effective for the prevention or treatment of obesity, hyperlipidemia and fatty liver.

Therefore, it is an object of the present invention to provide a food composition for improving obesity, hyperlipidemia or fatty liver.

Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of obesity, hyperlipidemia or fatty liver.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to an aspect of the present invention, the present invention provides a food composition for improving obesity, hyperlipidemia or fatty liver, which comprises Cudrania extract as an active ingredient.

According to another aspect of the present invention, the present invention provides a pharmaceutical composition for the prevention or treatment of obesity, hyperlipidemia or fatty liver, comprising kkujippong extract as an active ingredient.

The present inventors have sought to develop natural substances that can prevent or treat lipid metabolism related diseases, in particular obesity, hyperlipidemia and fatty liver. As a result, the present inventors have found that Kudjippong extract reduces the accumulation of triglycerides, increases the content of HDL-cholesterol in the blood, and is involved in the synthesis of acetyl-CoA carboxylase and peroxide proliferator-activated receptor-γ involved in lipid synthesis. By reducing the amount of expression and increasing adiponectin to improve lipid metabolism, it has been found to be very effective for the prevention or treatment of obesity, hyperlipidemia and fatty liver.

The composition of the present invention comprises Cudrania tricuspidata ) extract as an active ingredient.

The term "extract" as used herein to refer to kkujippong means not only the extraction result obtained by treating the extraction solvent in kkujippong, but also includes a processed (such as powdered) kkujippong formulation formulated to administer the kkujippong itself to the animal. Has

In the case of obtaining the zigzag extract used in the composition of the present invention by treating the zigzag extract with a solvent, various extraction solvents may be used. Preferably, a polar solvent or a nonpolar solvent can be used. Suitable polar solvents include (i) water, (ii) alcohols (preferably methanol, ethanol, propanol, butanol, normal-propanol, iso-propanol, normal-butanol, 1-pentanol, 2-butoxyethanol Or ethylene glycol), (iii) acetic acid, (iv) dimethyl-formamide (DMFO) and (v) dimethyl sulfoxide (DMSO). Suitable as nonpolar solvents are acetone, acetonitrile, ethyl acetate, methyl acetate, fluoroalkane, pentane, hexane, 2,2,4-trimethylpentane, decane, cyclohexane, cyclopentane, diisobutylene, 1- Pentene, 1-chlorobutane, 1-chloropentane, o -xylene, diisopropyl ether, 2-chloropropane, toluene, 1-chloropropane, chlorobenzene, benzene, diethyl ether, diethyl sulfide, chloroform, dichloro Methane, 1,2-dichloroethane, anneal, diethylamine, ether, carbon tetrachloride and THF.

More preferably, the extraction solvent used in the present invention is (a) water, (b) anhydrous or hydrous lower alcohol having 1 to 4 carbon atoms (methanol, ethanol, propanol, butanol, etc.), (c) the lower alcohol and water Mixed solvent with (d) acetone, (e) ethyl acetate, (f) chloroform, (g) butyl acetate, (h) 1,3-butylene glycol, (i) hexane and (j) diethyl ether Include. Even more preferably, the extract of the present invention is obtained by treating Cudjipon with water, methanol, ethanol or a combination thereof, most preferably water, ethanol or a combination thereof.

As used herein, the term "extract" has the meaning commonly used as a crude extract in the art as described above, but also broadly includes a fraction additionally fractionating the extract. That is, the kkujippong extract includes not only those obtained by using the above-described extraction solvent, but also those obtained by additionally applying a purification process thereto. For example, fractions obtained by passing the extract through an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography (manufactured for separation according to size, charge, hydrophobicity or affinity), etc. The fraction obtained through the purification method is also included in the kkujippong extract of the present invention.

Kujippong extract used in the present invention may be prepared in a powder state by an additional process such as vacuum distillation and freeze drying or spray drying.

Kujippong extract of the present invention can be obtained using a variety of organs (eg, stem, leaves, root and fruit) of kkujippong. According to a preferred embodiment of the present invention, kkujippong extract is a stem extract of kkujippong.

Cudrania extract of the present invention improves lipid metabolism in the human body. According to a preferred embodiment of the present invention, the composition of the present invention increases the content of HDL-cholesterol in the blood.

Cudrania japonica extract of the present invention reduces the level of biomolecules involved in lipid synthesis. According to a preferred embodiment of the present invention, the composition of the present invention reduces the amount of expression of acetyl-CoA carboxylase or peroxide proliferator-activated receptor-γ.

The composition of the present invention may be prepared as a pharmaceutical composition.

The composition of the present invention comprises (a) a pharmaceutically effective amount of the kkujippong extract of the present invention described above; And (b) a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to achieve the efficacy or activity of the above-mentioned Kujippong extract.

When the composition of the present invention is made into a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like It doesn't happen. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and agents are Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally, and preferably applied by oral administration.

The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . Typical dosages of the pharmaceutical compositions of the invention are in the range of 0.001-1000 mg / kg on an adult basis.

The pharmaceutical compositions of the present invention may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. The formulation may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or in the form of extracts, powders, powders, granules, tablets or capsules, and may further comprise dispersants or stabilizers.

The composition of the present invention may be provided as a food composition.

According to a preferred embodiment of the present invention, the composition of the present invention is (a) a food-effective amount of the kkujippong extract of the present invention described above; And (b) a food acceptable carrier.

When the composition of the present invention is made of a food composition, as an active ingredient, as well as Cudrania extract, it contains components that are commonly added during food production, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents. It includes. Examples of the above carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose, oligosaccharides and the like; And sugars such as conventional sugars such as polysaccharides such as dextrin, cyclodextrin and the like and xylitol, sorbitol, erythritol. As flavoring agents, natural flavoring agents (tauumatin, stevia extract (for example rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is prepared with a drink, in addition to the water extract of the present invention, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, tofu extract, jujube extract, licorice extract, and the like may be further included. Can be.

The features and advantages of the present invention are summarized as follows:

(i) The present invention proposes a novel use of Cudrania extract for the prevention or treatment of obesity, hyperlipidemia or fatty liver.

(Ii) The composition of the present invention is very effective in preventing, improving or treating obesity, hyperlipidemia or fatty liver.

(Iii) Cujippong extract as an active ingredient in the composition of the present invention is safe for the human body because it is a natural product.

1 is a graph showing the total phenolic content of Cudrania tricuspidata ethanol extract. Values are mean ± SD of 3 replicates. □: CTSEE ( Cudrania tricuspidata stem ethanol extract), ■: CTLSS ( Cudrania tricuspidata leaf ethanol extract). For determination of the phenol content, the test compound was diluted to the same volume of 70% ethanol.
2 is a graph showing the change in the number of weeks of weight during the entire experiment. Values are the mean ± SD of the experiments on 7 animals. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts displayed at weeks 4 and 9 were analyzed using ANOVA and Duncan's Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
Figure 3 is a graph showing the level of insulin in the blood intake of Cudrania tricuspidata ethanol extract of high fat diet-induced obese rats. Values are the mean ± SD of the experiments on 7 animals. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
Figure 4 is a graph showing the level of glucose in the blood upon ingestion of Cudrania tricuspidata ethanol extract of high fat diet-induced obese rats. Values are the mean ± SD of the experiments on 7 animals. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
Figure 5 is a graph showing the level of triglycerides in the blood intake of Cudrania tricuspidata ethanol extract of high fat diet-induced obese rats. Values are the mean ± SD of the experiments on 7 animals. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
Figure 6 is a graph showing the level of total cholesterol in the blood intake of Cudrania tricuspidata ethanol extract of high fat diet-induced obese rats. Values are the mean ± SD of the experiments on 7 animals. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
Figure 7 is a photograph of the histological changes of liver tissue when ingested Cudrania tricuspidata ethanol extract of high fat diet-induced obese rats. Stained with hematoxylin-eozin and observed at 100 × magnification. a: normal diet + purified water, b: high-fat diet + purified water, C: high-fat diet + 0.5% catechin, d: high-fat diet + 2% Cudrania stem ethanol extract, e: high-fat diet + 2% Cudrania leaf ethanol extract .
8 is Cudrania of high fat diet-induced obese rat tricuspidata ) The photographs show the histological changes of adipose tissue when ethanol extract is ingested. Stained with hematoxylin-eozin and observed at 100 × magnification. a: normal diet + purified water, b: high-fat diet + purified water, C: high-fat diet + 0.5% catechin, d: high-fat diet + 2% Cudrania stem ethanol extract, e: high-fat diet + 2% Cudrania leaf ethanol extract .
9 is a graph showing the effect of Cudrania tricuspidata ethanol extract by confirming the epididymal fat cell size of high fat diet-induced obese mice. Values are the mean ± SD of the experiments on 7 animals. The size of the epididymal fat cells was measured at 100X magnification and averaged by measuring three different parts. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
10 is a graph showing the effect of ethanol extract Cudrania tricuspidata by confirming the number of epididymal fat cells of high fat diet-induced obese rats. Values are the mean ± SD of the experiments on 7 animals. The number of epididymal adipocytes was measured at 100X magnification and the average of three different parts was measured. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
11 is confirmed by the activity of the harmful oxygen-producing enzyme XO in liver tissue of high fat diet-induced obese rats ( Cudrania tricuspidata ) is a graph showing the effect of ethanol extract. Values are the mean ± SD of the experiments on 7 animals. Unit: nmole 2,4-dinitrobenzene-glutathione conjugate / mg protein / min. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
12 is confirmed by the activity of SOD which is a toxic oxygen scavenger in the liver tissue of high fat diet-induced obese rats ( Cudrania tricuspidata ) is a graph showing the effect of ethanol extract. Values are the mean ± SD of the experiments on 7 animals. Unit: U (50% inhibition of hematoxylin autooxidation) / mg protein / min. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
Figure 13 is a high fat to make harmful deoxidation of CAT enzyme activity in the livers of obese rats induced kkujippong (Cudrania tricuspidata ) is a graph showing the effect of ethanol extract. Values are the mean ± SD of the experiments on 7 animals. Unit: nmole reduced H 2 O 2 / mg protein / min. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
14 is fat-induced superoxide generation determine the tissue membranes indicator of activity of TBARS of lipid in the liver of obese rats kkujippong (Cudrania tricuspidata ) is a graph showing the effect of ethanol extract. Values are the mean ± SD of the experiments on 7 animals. Unit: nmole / mg protein. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
Figure 15 is a high fat to determine the mRNA expression level of the enzyme ACC to promote lipid synthesis in livers of induced obese mice kkujippong (Cudrania tricuspidata ) is a graph showing the effect of ethanol extract. Real-time RT-PCR was performed, and these results were expressed as values relative to the GAPDH, an anti-gonal gene. Values are the mean ± SD of the experiments on 7 animals. Unit: nmole / mg protein. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
FIG. 16 shows the expression level of PPARγ mRNA, a promoter for adipocyte differentiation, in adipose tissue of induced obese rats ( Cudrania) tricuspidata ) is a graph showing the effect of ethanol extract. Real-time RT-PCR was performed and these results were expressed relative to the GAPDH, an anti-gene. Values are the mean ± SD of the experiments on 7 animals. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.
FIG. 17 shows the adiponectin mRNA expression level of adipose metabolism-promoting factor in adipose tissue of induced obese rats ( Cudrania) tricuspidata ) is a graph showing the effect of ethanol extract. Real-time RT-PCR was performed and these results were expressed relative to the GAPDH, an anti-gene. Values are the mean ± SD of the experiments on 7 animals. N: normal diet + purified water, C: high-fat diet + purified water, PC: high-fat diet + 0.5% catechin, E1: high-fat diet + 2% Cudrania stem ethanol extract, E2: high-fat diet + 2% Cuzipan leaf ethanol extract . The values of the different superscripts were analyzed using ANOVA and Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and Experiments

Reagents and Instruments

Hematoxylin and catechin were used by Sigma (USA), cDNA synthesis and real-time RT-PCR kit, and GAPDH and ACC, PPAR-γ and adiponectin primers were used by BioNEER (Korea). And other common reagents were used. The laboratory equipment was an automated blood analyzer (Hemavet, HV-950FS, USA), an automatic biochemistry analyzer (Thermo, Konelab 20XT, Finland), a frozen centrifuge (Beckman Coulter Inc., AVANTI JE, USA), a homogenizer (IKA, T25 basic). , Malaysia), PCR machines (Bio-RAD, Mycycler ^TM thermal cycler, USA), small centrifuge (Hitachi, MIKRO 200R, Japan), spectrophotometer (Shimadzu, UV-1601, Japan), sectioner (Leica, RM2235, Germany), an optical microscope (Olympus, BX51, Japan) and a general instrument used in the laboratory.

sample

The harvested and dried Kujippong stems were harvested from Goseong Cujippong, a Goseong-gun farming association in Gangwon-do in 2009, and the leaves were directly harvested in June 2010 from Seongju-gun and used after 3 days of drying. Stems and leaves were extracted by adding 10 times the amount of 70% ethanol to the sample weight, and the supernatant and the sediment were separated. The same method was repeated three times, lyophilized and stored frozen. After feeding, 4 g of dry powder was added to 200 ml of purified water. Each was dissolved and used. Yield rate of kkujippong ethanol extract was 20.0% stem and 12.5% leaf.

feed

A high-fat diet for obesity induction was D12492 (Research Diets, USA) and a normal diet (Purina, Korea) was used. The composition of the high fat diet is shown in Table 1 below.

Dietary Ingredients High Fat Diet (1kg) D12492 gm (%) kcal (%) protein 26.2 20 carbohydrate 26.3 20 Fat 34.9 60 Etc 12.6 0 gun 100 100 ingredient gm kcal Casein, 80 mesh 200 800 L-cystine 3 12 Maltodextrin 10 125 500 Sucrose 68.8 275.2 Cellulose 50 0 Soybean oil 25 225 Lard 245 2205 Mineral mixture (S10026) 10 0 Dicalcium phosphate 13 0 Calcium carbonate 5.5 0 Potassium Citrate, 1 H ₂ O 16.5 0 Vitamin Mixture (V10001) 10 40 Choline Bitrate 2 0 FD & C blue die # 1 0.05 0 Etc 226.15 0 gun 1000 4057.2

Source: Research diets Inc. (USA)

Total Phenolic Content Determination

Total polyphenol content was determined based on the Folin and Denis method (Folin and Denis 1912). 0.5 ml of the sample made by adding 1 ml of distilled water to 5.2 mg of the extracted sample was placed in a test tube. 1.5 ml of phenol reagent was added and mixed well. After 5 minutes, 0.5 ml of saturated sodium carbonate (Na ₂ CO ₃₎ solution was added thereto, and the mixture was added for 1 hour, followed by adding 1N HCl (0.1 ml). Absorbance was measured at 640 nm using a spectrophotometer and the amount was converted to a standard curve using tannic acid.

Laboratory Animals and Treatment

The experimental animals were fed with 35 C57BL / 6 mice (Samtako Bio Korea) 6 weeks of age and adapted to the environment for 1 week, and then divided into 5 groups of 7 by randomized block design. 4 groups were fed a high fat diet for 4 weeks to induce obesity. After the induction of obesity, the high fat diet group was divided into a control group, a catechin intake group that is a positive control group, courageous stem ethanol extract ingestion group, and a cousip leaf ethanol extract intake group, and fed the experimental material for 5 weeks with a high fat diet. The nursery was kept day and night at a temperature of 22 ± 1 ℃, a humidity of 50 ± 5% and a light / dark cycle for 12 hours. The water and feed were freely supplied during the experiment. After the test material was supplied for 5 weeks, at the end of the experiment, fasting for 12 hours before anesthesia with ether (ether) to collect blood from the posterior vena cava. Heart, liver, kidney and epididymal adipose tissue were extracted and weighed and fixed in 10% formalin solution for histological observation. Hepatic and epididymal adipose tissue was excised and stored at -80 ℃ for gene expression. .

 Substance killing group classification

 Normal group (N): normal diet + purified water

 Control Group (C): High Fat Diet + Purified Water

 Positive control (PC): high fat diet + 0.5% catechin

 Experimental group 1 (E1): high fat diet + 2% kkujippong stem ethanol extract

Experimental Group 2 (E2): High Fat Diet + 2% Cudrania Leaf Ethanol Extract

Negative water , Feed intake, body weight and feed efficiency

Yield, feed intake, and body weight were measured once a week at 10 AM-11 AM.

Organ and Adipose Tissue Weighing

The extracted heart, liver, kidney, and epididymal adipose tissue were washed with physiological saline, water was removed with filter paper, and measured using an electronic balance.

Hematological analysis

The collected blood is placed in a cell blood count tube containing the anti-coagulant K ₂ -EDTA, mixed for at least 10 minutes on a coulter mixer, and then analyzed by an automatic blood analyzer (Sysmex VE-2100, Japan). Leukocyte count, neutrophil count, lymphocyte count, monocyte count, eosinophil count, basophils, erythrocyte count, hemoglobin concentration, erythrocyte volume, and platelet count were measured.

Biochemical Analysis of Serum

The collected blood was placed in a vacuum tube (Greiner, Austria), left at room temperature for 1 hour, and then centrifuged at 3,000 rpm for 10 minutes. The serum obtained from the autobiochemical analyzer (Konelab 20XT, Finland) was analyzed using AST, ALT, ALP, LDH, Insulin, glucose, triglyceride, HDL-C, LDL-C, total cholesterol were analyzed.

Histological Analysis of Liver and Adipose Tissue

The extracted liver and epididymal adipose tissues were fixed in 10% neutral formalin solution for 12 hours and washed with running water for histological observation, followed by tissue treatment to prepare 4 μm thick slices. Staining was performed with hematoxylin and eosin and histological changes were observed through light microscopy.

Hematoxylin- Eojin (H & E) dyeing

A thin slice having a thickness of 4 μm was prepared, deparaffinized in xylene, and after washing with water, washed with running water. Transfer to Harris hematoxylin solution, stain the nucleus for 5 minutes, wash with running water, immerse three times with 1% hydrochloric acid-alcohol solution, wash with water, blue with 1% ammonia solution and 3 minutes in eojin solution After staining the cytoplasm dehydrated by gradually moving to 80%, 95%, 100% ethanol. After the clearing process, it was encapsulated with Canada balsam and examined under a 100 magnification optical microscope.

Liver tissue Geological deposition  And fat cell size and number measurement

H & E stained liver tissues were observed for distribution of lipids deposited around the central vein under a 100 magnification optical microscope, and epididymal adipose tissues were measured for fat cell size and number using a scale bar program.

Hazardous Oxygen Metabolizing Enzyme Activity and Lipid Peroxidation Content

Preparation of Enzyme Sample

The extracted liver tissue is excised under ice-cooling, and weighed in a predetermined amount, followed by adding 4 times of 0.25 M sucrose (pH 7.4) buffer to make 20% (w / v) ground homogenate using a glass teflon homogenizer. . The homogenate was centrifuged at 600 Xg for 10 minutes, and the supernatant from which the nucleus and uncrushed portion was removed was centrifuged at 10,000 Xg for 20 minutes. The supernatant was obtained and used for the enzyme activity measurement.

Xanthine oxidase ( Xanthine oxidase , XO )

XO activity in liver tissue was measured according to the method of Stripe and Della (1969). In the activity unit, 1 mg of protein contained in the enzyme solution reacted for 1 minute, and the amount of uric acid generated from the substrate xanthine was expressed as nmole.

Antioxidant enzymes ( Superoxide dismutase , SOD )

The activity of SOD in liver tissues was measured using 10 μm hematoxylin and enzyme solution in 50 mM phosphate buffer (pH 7.5) containing 0.1 mM EDTA according to the method of Martin et al. (1987), which observes the degree of inhibition of hematoxylin autooxidation. Hematein produced by the reaction at 25 ℃ was measured at 560 nm to determine the activity of the enzyme. The activity unit was expressed as a unit in which 1 mg of protein was reacted for 1 minute with a degree of inhibiting 50% of the automatic oxidation of hematoxylin in the reaction solution without an enzyme solution.

Catalase ( Catalase , CAT )

The activity of CAT in liver tissue was reduced by using hydrogen peroxide as substrate and the absorbance was read at wavelength 240 nm using spectrophotometer and molecular absorption coefficient (E = 0.04 mM ^-1 cm ^-1). ) According to the method of Aebi (1984) to calculate the activity. The activity unit expressed the amount of hydrogen peroxide reduced in nmole by the reaction of 1 mg of protein contained in liver tissue for 1 minute.

Thiobarbitulic acid  Reactant ( Thiobarbituric acid reactive substance , TBARS )

Lipid peroxidation TBARS test in liver tissue was measured according to the method of Ohkawa et al. (1979). The absorbance of TBARS produced by heating a lipid peroxide in an enzyme sample with a thiobarbituric acid solution under acidic conditions was measured at 500 nm. TBARS content is expressed as nmole per gram of protein.

Molecular Biology of Liver and Adipose Tissue

RNA  extraction

Liver and epididymal adipose tissue stored in frozen (-80 ℃) is transferred to liquid nitrogen and kept at low temperature with ice. The tissue is ground by adding 1 ml of Trizol (Invitrogen, New Zealand) per 50 mg of tissue. After incubating for 5 minutes, 200 μl of chloroform was added thereto, and left at room temperature for 3 minutes, followed by centrifugation at 15,000 rpm, 4 ° C. for 10 minutes. After taking the supernatant, 500 μl of isopropyl alcohol was added, followed by centrifugation at 15,000 rpm, 4 ° C. for 15 minutes, the supernatant was removed, and 1 ml of 70% ethanol was added to wash the RNA precipitate. After removing the supernatant from centrifugation at 15,000 rpm, 4 ℃ for 2 minutes, the remaining RNA precipitate was dried at room temperature, diluted with diethylpyrocarbonate (DEPC), and the absorbance (OD) value was measured at 260 nm. Was quantified. The absorbance value was measured at 280 nm and the absorbance ratio (A260 / A280) was determined to be between 1.8 and 2.0.

cDNA  synthesis

According to the procedure provided by BioNEER's reverse transcriptase kit (CycleScript RT PreMix, dT20), add an RNA sample so that the total amount of RNA is 0.1-1 ㎍ / μL, and fill up with 20 μl of DEPC. The reaction was completed at 12 ° C. for 4 minutes and heated at 95 ° C. for 5 minutes to terminate the reaction.

real time RT -PCR ( Real - time RT - PCR )

BioNEER's real-time RT-PCR enzyme kit ( Accum ^™ PCR PreMix kit) was purchased and used. 1.4 μl of template 2 μl, forward primer and reverse primer (10 pmole / l, BioNEER, Korea) and 15.2 μl of sterile distilled water were mixed and PCR reaction (Bio-RAD, Mycycler ^TM thermal cycler, USA) ) Was performed. The primers were GAPDH (57 ℃, 35 cycles) as a control group, PPARγ (60 ℃, 35 cycles), ACC (60 ℃, 35 cycles), adiponectin (60 ℃, 35 cycles) as the experimental group. Is shown in Table 2.

Base sequence of primer Item primer Expected size (bp) ^{4 )} GAPDH ^{1 )} Forward direction (5 '→ 3') ATTCCATGGCACCGTCAAGGC 571 Reverse direction (5 '→ 3') TCAGGTCCACCACTGACACGT ACC ^{2 )} Forward direction (5 '→ 3') AGATGTAGTTGCAGCAATTCGTGA 283 Reverse direction (5 '→ 3') CCGTAGGGTGCTACCGATGCAG PPAR-γ ³⁾ Forward direction (5 '→ 3') ATGGAACGTAACGGTCAAGTC 571 Reverse direction (5 '→ 3') GCACTGCCGCTGCTAAGACGT Adiponectin Forward direction (5 '→ 3') GATAGGTGCAACTGTCCTGAC 362 Reverse direction (5 '→ 3') GCACATGTACTACTGGGACAT

¹⁾ GAPDH: Glyceraldehyde-3-phosphate dehydrogenase

       (Glyceraldehyde-3-phosphate dehydrogenase)

²⁾ ACC: Acetyl-CoA carboxylase

³⁾ PPARγ: peroxide proliferator activated receptor-gamma

          (Peroxisome Proliferator-Activated Receptor-γ)

⁴⁾ bp: base pair

Data analysis

One-way ANOVA was performed using a statistical program (SPSS 18.0 for windows, SPSS Inc., USA), and Duncan's multiple range test was used to test the differences between the groups. Post hoc analysis was performed. The statistical significance level was p <0.05.

Experiment result

Total phenol content

The total phenolic contents of Cudrania stem ethanol extract and leaf ethanol extract were 19.63 mg / g and 15.64 mg / g, respectively (FIG. 1).

Negative water , Feed intake, body weight and feed efficiency

Table 3 shows the results of drinking water, feed intake, body weight and feed efficiency during the experimental diet for 5 weeks. The amount of drinking water was significantly decreased in all groups fed the high fat diet compared to the normal group, but there was no significant difference between the groups. Feed intake was significantly lower in all groups than in the normal group, and the catechin-ingested group and zigzag stem ethanol extract-intake group were significantly higher than the control group (p <0.05). The daily weight gain was significantly decreased in the zigzag stem ethanol extract intake group (31.6%) and the catechin intake group (23.1%) in the positive control group (p <0.05). The percentage decreased, but there was no statistically significant difference. Feed efficiency was 45% lower in the zigzag stem ethanol extract intake group (p <0.05) than in the control group, and the catechin intake group (16%) and zigzag leaf ethanol extract intake group (11%) were positive controls. Although there was a slight decrease, there was no statistically significant difference. The result of the weight change is shown in FIG. 2. During the 4-week obesity induction period, significant weight gain was observed in the high-fat diet group, and as a result of weight change by 5 weeks of substance treatment, 36.6% of the weight gain in the zigzag stem ethanol extract group compared to the control group. Inhibition was confirmed (p <0.05).

Drinking Water, Feed Intake, Weight, and Feed Efficiency of Kudjippong Ethanol Extracts from Obese Rats Item normal Control group Experimental group N C PC E1 E2 Drinking water amount (ml / day) 3.44 ± 0.09 ^b 2.11 ± 0.06 ^a 2.17 ± 0.13 ^a 2.50 ± 0.74 ^a 2.54 ± 0.61 ^a Feed Intake (g / day) 3.56 ± 0.24 ^c 2.54 ± 0.22 ^a 2.83 ± 0.14 ^b 2.86 ± 0.14 ^b 2.72 ± 0.15 ^ab Weight before experiment (g)  24.58 ± 1.17  33.51 ± 2.33 33.02 ± 2.38 34.26 ± 1.79 33.48 ± 1.63 Body weight after experiment (g) 28.05 ± 1.55 44.82 ± 1.60 41.71 ± 1.47 41.99 ± 3.22 44.27 ± 1.21 Weight gain (g / day) 3.47 ± 0.69 ^a 11.31 ± 1.61 ^c 8.69 ± 1.99 ^b 7.73 ± 2.60 ^b 10.79 ± 1.45 ^c Feed efficiency ^{1 )} (%) 2.68 ± 0.71 ^a 11.21 ± 1.28 ^c 9.43 ± 1.11 ^c 6.16 ± 2.69 ^b 9.94 ± 0.94 ^c

Values are the mean ± SD of the experiments on 7 animals.

N: normal diet + purified water

C: high fat diet + purified water

PC: High Fat + 0.5% Catechin

E1: High Fat Diet + 2% Cudrania Stem Ethanol Extract

E2: High Fat Diet + 2% Cudrania Leaf Ethanol Extract

1) feed efficiency ratio (%) = (weight is weight / feed intake) × 100

The values of the different superscripts in the same row were analyzed using ANOVA and Duncan's Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.

Weight fluctuation of organs

The long-term weight measurement results are shown in Table 4. Heart did not differ significantly in all groups. Soy sauce was significantly higher in the control group (21.5%) than in the normal group (p <0.05), and 3.7% and 8.5 in the catechin-ingestion group, zigzag stem ethanol extract group, and zigzag leaf ethanol extract group were positive controls. % And 1.8% decreased, but there was no statistically significant difference. The epididymal adipose tissue was significantly higher in the control group (419.2%) than in the normal group (p <0.05), and the catechin intake group, coujipon stem ethanol extract intake group, and zigzag leaf ethanol extract intake group showed a slight decrease, but statistically significant. There was no significant difference.

Long-term weight measurement results of ethanol extracts of KUJIJONGJIN in obese rats Item normal Control group Experimental group N C PC E1 E2 Heart
0.14 ± 0.01 ¹⁾ 0.14 ± 0.01 0.14 ± 0.01 0.15 ± 0.01 0.14 ± 0.01 0.48 ± 0.03 ^{2) c} 0.30 ± 0.02 ^a 0.34 ± 0.03 ^ab 0.35 ± 0.02 ^b 0.33 ± 0.02 ^ab liver 1.35 ± 0.11 ^a 1.64 ± 0.33 ^b 1.58 ± 0.22 ^ab 1.50 ± 0.24 ^ab 1.61 ± 0.13 ^ab 4.80 ± 0.38 ^b 3.77 ± 0.65 ^a 3.81 ± 0.60 ^a 3.55 ± 0.32 ^a 3.67 ± 0.22 ^a kidney 0.18 ± 0.00 0.19 ± 0.01 0.18 ± 0.01 0.18 ± 0.02 0.18 ± 0.00 0.67 ± 0.04 ^b 0.41 ± 0.03 ^a 0.44 ± 0.04 ^a 0.44 ± 0.04 ^a 0.41 ± 0.02 ^a Epididymis
Adipose tissue ^{3 )} 0.26 ± 0.04 ^a 1.35 ± 0.10 ^b 1.21 ± 0.10 ^b 1.21 ± 0.17 ^b 1.24 ± 0.05 ^b 0.92 ± 0.15 ^a 3.03 ± 0.26 ^b 2.90 ± 0.21 ^b 2.92 ± 0.34 ^b 2.79 ± 0.11 ^b

Values are the mean ± SD of the experiments on 7 animals.

1) Long term absolute value: g

2) Long-term weight relative value: g / 100g weight

3) AT: fat tissue

Values are the mean ± SD of the experiments on 7 animals.

N: normal diet + purified water

C: high fat diet + purified water

PC: High Fat + 0.5% Catechin

E1: High Fat Diet + 2% Cudrania Stem Ethanol Extract

E2: High Fat Diet + 2% Cudrania Leaf Ethanol Extract

The values of the different superscripts in the same row were analyzed using ANOVA and Duncan's Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.

Hematological analysis

Hematological analysis results are shown in Table 5. Leukocytes, neutrophils, lymphocytes, erythrocytes, hemoglobin, and erythrocyte volumes were significantly higher in the control group than in the normal group. p <0.05). In the zigzag stem ethanol extract group, the leukocytes (37.7%) and lymphocytes (42.5%) were significantly lower than the control group, and neutrophils were 34.0% lower in the catechin group (positive control group) than in the control group (p <0.05). Red blood cells (22.5%), hemoglobin (23.4%), and red blood cell volume (16.5%) were significantly lower in the zigzag stem ethanol extract group than the control group (p <0.05), and the catechin intake group and zigzag leaf ethanol extract were positive controls. There was no statistically significant difference among the intake groups. Platelet levels were significantly lower in the catechin-ingested group, the Cudrania stem ethanol extract group, and the Cudrania leaf ethanol extract group than the control group, but there was no statistically significant difference between the groups.

Hematological Analysis of Ethanol Extracts from Cucumis in Obese Rats Item normal Control group Experimental group N C PC E1 E2 Leukocytes (k / μl) 10.183 ± 0.397 ^b 14.632 ± 0.363 ^c 9.973 ± 0.509 ^b 9.113 ± 0.156 ^a 10.028 ± 0.137 ^b Neutrophils (k / μl) 4.645 ± 0.284 ^b 6.182 ± 0.328 ^c 4.080 ± 0.207 ^a 4.138 ± 0.210 ^a 4.245 ± 0.402 ^ab Lymphocyte (k / μl) 5.385 ± 0.211 ^b 8.186 ± 0.324 ^c 5.625 ± 0.455 ^b 4.704 ± 0.131 ^a 5.558 ± 0.264 ^b Protein (k / μl) 0.138 ± 0.126 0.212 ± 0.118 0.250 ± 0.082 0.248 ± 0.089 0.200 ± 0.082 Eosinophils (k / μl) 0.018 ± 0.005 ^a 0.040 ± 0.012 ^b 0.015 ± 0.013 ^a 0.021 ± 0.017 ^a 0.020 ± 0.014 ^a Basophils (k / μl) 0.003 ± 0.005 0.010 ± 0.012 0.003 ± 0.005 0.002 ± 0.004 0.005 ± 0.006 Erythrocytes (k / μl) 685.500 ± 11.000 ^c 841.600 ± 00.327 ^d 678.250 ± 9.430 ^bc 652.600 ± 7.829 ^a 666.750 ± 6.449 ^b Hemoglobin (k / μl) 17.425 ± 0.287 ^b 21.440 ± 0.750 ^c 17.275 ± 0.377 ^b 16.420 ± 0.311 ^a 17.350 ± 0.238 ^b Erythrocyte volume (%) 49.425 ± 0.838 ^c 54.240 ± 0.691 ^d 47.175 ± 0.299 ^b 45.300 ± 0.652 ^a 47.025 ± 0.427 ^b Platelets (k / μl) 697.500 ± 22.767 ^a 853.800 ± 25.322 ^b 701.750 ± 10.689 ^a 695.000 ± 14.318 ^a 702.250 ± 19.534 ^a

Values are the mean ± SD of the experiments on 7 animals.

N: normal diet + purified water

C: high fat diet + purified water

PC: High Fat + 0.5% Catechin

E1: High Fat Diet + 2% Cudrania Stem Ethanol Extract

E2: High Fat Diet + 2% Cudrania Leaf Ethanol Extract

The values of the different superscripts in the same row were analyzed using ANOVA and Duncan's Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.

Biochemical Analysis of Serum

Serum biochemical analysis results are shown in Table 6 and FIGS. 3-6. Enzyme changes, which are indicators of hepatotoxic damage, were significantly higher in AST (64.1%), ALT (52.8%), ALP (60.0%), and LDH (65.5%) in the control group than in the normal group. Low (p <0.05). The catechin intake group, a positive control group, was significantly lower in AST (38.9%), ALT (34.0%), and ALP (33.6%) than the control group, and the zigzag leaf ethanol extract group was significantly lower in AST (36.9%), ALT group than the control group. (34.3%), ALP (33.5%), and LDH (29.1%) showed significant decreases (p <0.05). Both the catechin and zigzag leaf ethanol extract groups, which were positive controls, returned to normal levels. In the zigzag stem ethanol extract group, AST (45.9%), ALT (39.5%), ALP (36.2%), and LDH (34.8%) were significantly lower than those of the control group and significantly lower than the normal group (p). <0.05). HDL-cholesterol was significantly lower in the control group (33.5%) than in the normal group (p <0.05). Compared with the control group, the catechin-intake group (26.6%) and zigzag leaf ethanol extract intake group (26.0%) were significantly higher (p <0.05), especially in the zigzag stem-ethanol extract intake group (45.2%). p <0.05).

LDL-cholesterol was significantly higher in the control group (215.6%) than in the normal group, and significantly lower in the experimental group (p <0.05). Among them, the most significant decrease was seen in the zigzag stem ethanol extract intake group (43.1%). Both insulin and glucose contents were significantly higher in the control group than in the normal group and significantly lower in the experimental group (p <0.05). There was no significant difference in insulin content between groups treated with test substance, but glucose content was significantly decreased (p <0.05) in the zigzag stem ethanol extract intake group (p <0.05). Triglycerides and total-cholesterol were also significantly lower in the catechin-ingested group, the Cucumis stem ethanol extract group, and the Cudrania leaf ethanol extract group (p <0.05).

Serum Biochemical Analysis of Ethanol Extracts from Cucumis in Obese Induced Rats Item normal Control group Experimental group N C PC E1 E2 AST 74.60 ± 2.70 ^b 122.40 ± 3.65 ^c 74.75 ± 3.78 ^b 66.25 ± 2.75 ^a 77.50 ± 2.38 ^b ALT 56.80 ± 1.92 ^b 86.80 ± 2.39 ^c 57.25 ± 2.22 ^b 52.50 ± 1.92 ^a 57.00 ± 1.83 ^b ALP 172.60 ± 3.05 ^a 276.00 ± 5.96 ^c 183.25 ± 2.99 ^b 176.00 ± 2.83 ^a 183.50 ± 1.29 ^b HDL-C 117.40 ± 3.65 ^c 78.00 ± 3.16 ^a 98.75 ± 4.65 ^b 113.25 ± 4.27 ^c 98.25 ± 3.40 ^b LDL-C 42.20 ± 2.78 ^a 133.20 ± 3.83 ^d 89.75 ± 3.76 ^c 75.75 ± 3.78 ^b 89.25 ± 4.11 ^c LDH 330.00 ± 12.25 ^a 546.00 ± 15.12 ^c 388.00 ± 3.56 ^b 374.00 ± 6.48 ^b 387.50 ± 6.86 ^b

Values are the mean ± SD of the experiments on 7 animals. The unit is Unit.

N: normal diet + purified water

C: high fat diet + purified water

PC: High Fat + 0.5% Catechin

E1: High Fat Diet + 2% Cudrania Stem Ethanol Extract

E2: High Fat Diet + 2% Cudrania Leaf Ethanol Extract

The values of the different superscripts in the same row were analyzed using ANOVA and Duncan's Duncan's multiple range test, and the values were significantly different. The statistical significance level was p <0.05.

Histological Observation of Liver and Epididymal Adipose Tissue

Hematoxylin- Eojin (H & E) dyeing

The histological observations of liver tissue are shown in Table 7. 9 weeks of high fat diet resulted in denser distribution of lipid droplets in liver tissue compared to normal group, whereas fat accumulation was confirmed, whereas catechin intake group and zigzag stem ethanol extract were positive controls. Intake group, kkujippong leaf ethanol extract intake group showed the distribution of fat globules similar to the normal group, it was confirmed that the lipid accumulation by the treatment of experimental material.

Changes in fat cell size and number

H & E staining of epididymal adipose tissue measured the size and number of scale bars as shown in FIGS. 8-10. The epididymal fat cell size was significantly increased in the control group (199.8%) compared to the normal group and 47.3% in the zigzag leaf ethanol extract group (p <0.05). In the catechin-ingested group and the zigzag stem ethanol extract group, the positive control group showed a significant decrease of 60.3% and 64.7%, respectively (p <0.05). As a result of measuring the number of fat cells per unit area of epididymal adipose tissue, the control group was significantly decreased by 53.2% compared with the normal group. Were increased by 96.9%, 110.7%, and 80.8%, respectively (p <0.05).

Hazardous Oxygen Metabolizing Enzyme Activity and Lipid Peroxidation Content

The results of analysis of harmful oxygen metabolizing enzyme activity and lipid peroxidation content of the extracted liver tissue are shown in Table 11-14. In the control group, 45.7% and 114.3%, respectively, were significantly higher in the control group than in the normal group, and the catechin intake group, 44.5%, 63.7%, and zigzag stem ethanol, respectively. 45.3% and 64.5% of the extract intake group and 34.8% and 52.3% of the zigzag leaf ethanol extract group were significantly lower (p <0.05), respectively. The SOD and CAT of the NOx removal enzymes were significantly lower in the control group than in the normal group, 59.0% and 40.2%, respectively. 166.6%, 166.5%, 126.5%, and CAT, 110.2%, 111.0%, and 65.2%, respectively (p <0.05).

Molecular Biology of Liver and Adipose Tissue

Changes in gene expression in liver tissue

The mRNA expression level of the extracted liver tissue was measured as shown in FIG. 15. The expression level of ACC mRNA, an enzyme promoting lipid synthesis, was significantly increased in the control group (64.3%) compared to the normal group (p <0.05). Compared to the control group, the catechin-ingested group and the zigzag leaf ethanol extract-intake group decreased 44.1% and 44.6%, respectively (p <0.05), but there was no statistically significant difference between the groups. The zigzag stem ethanol extract group was significantly decreased to 63.0% compared to the control group and statistically significant compared to all groups including the normal group (p <0.05).

Gene Expression Changes in Adipose Tissue

The mRNA expression level of the extracted epididymal adipose tissue is shown in FIGS. 16 and 17. The expression level of PPARγ mRNA, an adipocyte differentiation factor, was significantly increased by 96.4% in the control group (p <0.05). On the other hand, the catechin-ingested group and the zigzag leaf ethanol extract intake group were significantly decreased by 45.3% and 46.2%, respectively, compared with the control group. The results were also significantly different (p <0.05). Adiponectin mRNA expression, adipose metabolism-promoting factor, was significantly decreased in the control group (56.3%) compared to the normal group. There was no significant increase between the groups (p <0.05). The zigzag stem ethanol extract intake group was significantly higher (287.4%) than the control group (p <0.05).

As described in detail above, the present invention relates to a food composition and a pharmaceutical composition for improving obesity, hyperlipidemia or fatty liver, which comprises Cudradon extract as an active ingredient. Kujippong extract of the present invention exhibits excellent anti-obesity, anti-hyperlipidemia and anti-fatty effect through triglyceride accumulation reducing effect, lipid metabolism improving effect.

references

Mina Kim, Yongseop Jung, Jeontaek Jeon, and Yeonsu Cha. 2009. Lipid improvement and glycemic control effect of Chaga mushroom mycelium containing protein polysaccharide in C57BL / 6J Mice. Korean Journal of Food Science and Nutrition 38, no. 6: 667-673.

Jaebum Kim, Jiyoung Park. 2002. Adipocyte Differentiation and Function of Adipocyte Secretory Substances. Korean Journal of Endocrinology 17, no. 1: 1-8.

Park, Chul-Young. 2004. Inflammation and obesity. Korean Journal of Endocrinology 19, no. 2: 97-108.

Oh, Pil-sun, Lee Hye-jin, and Jeon Ji-taek. 2009. Inhibitory Effect of Histamine Release and COX-2 Activity by Cudrania Glycoprotein in RBL-2H3 Cells. Korean Journal of Food Science and Technology 41, no. 4: 405-412.

Lee Seong-gye, So Seung-ho, Hwang Eui-il, Koo Bon-seok, Han Kyung-oh, Sang-beom Ko, Nami Kim. 2008. Anti-obesity effect of red ginseng and natural products on obesity-induced rats. Korean Journal of Food Science and Nutrition 37, no. 4: 437-444.

Jae Young Cha, Young Soo Cho. 2001. Effects of Water-Soluble Extracts of Mulberry and Cucumber Mulberry on Lipid Concentrations and Lipid Peroxide Levels in Cholesterol-Fed Rats. Korean Journal of Food Science and Technology 33, no. 1: 128-134.

Ahima, RS, and JS Flier. 2000. Adipose tissue as an endocrine organ. Trends in Endocrinology and Metabolism 11, no. 8: 327-332.

Ballinger, A., and SR Peikin. 2002. Orlistat: its current status as ananti-obesity drug. European Journal of Pharmacology 440: 109-117.

Boer, M. den., PJ Vosho, F. Kuipers, LM Havekes, and JA Romijn. 2004. Hepatic steatosis: a mediator of the metabolic syndrome.lessons from animal models. Journal of the American Heart Association 24: 644-649.

Bruno, RS, CE Dugan, JA Smyth, DA Dinatale, and SI Koo. 2008. Green tea extract protects leptin-deficient, spontaneously obesemice from hepatic steatosis and injury. Journal of Nutrition 138: 323-331.

Cha, JY, and YS Cho. 2000. Effect of stem bark extract from Morus alba and Cudrania tricuspidata on the concentrations of lipid and tissue lipid peroxidation in the cholestrrol-fed rats. Journal of the Korean Society of Food Science and Nutrition 29, no. 3: 531-536.

Chao, L., SB Marcus, MM Mason, J. Moitra, C. Vinson, E. Arioglu, O. Gavrilova, and ML Reitman. 2000. Adipose tissue is required for the antidiabetic, but not for the hypolipidemic, effect of thiazolidinediones. Journal of Clinical Investigation 106: 1221-1228.

Chen, CH, MY Chang, YS Lin, DG Lin, SW Chen, and PM Chao. 2009. A herbal extract with acetyl-coenzyme A carboxylase inhibitory activity and its potential for treating metabolic syndrome. Metabolism Clinical Experimental 58: 1297-1305.

Donnelly, L. A., A. D. Morris, B. M. Frier, J. D. Ellis, P. T. Donnan, R.

Durrant, MM Band, G. Reekie, and GP Leese. 2005.Frequency and predictors of hypoglycaemia in Type 1 and insulin-treated Type 2 diabetes: a population-based study. Diabetic Medicine 22: 671-819.

Duval, C., M. Muller, and S. Kersten. 2007. PPARα and dyslipidemia. Biochimica et Biophysica Acta 1771: 961-971.

Flier, JS, and E. Maratos. 1998. Obesity and the hypothalamus: novel peptides for new pathways. Cell 92, no. 4: 437-440.

Folin, O., and W. Denis. 1912. On phosphotungstic-phosphomolybdic compounds as color reagents. Journal of Biochemistry and Chemistry 12: 239-249.

Fried, M., V. Hainer, A. Basdevant, H. Buchwald, M. Dietel, N. Finer, JW Greve, F. Horber, VE Mathus, N. Scopinaro, R. Steffen, C. Tsigos, R. Weiner, and K. Widhalm. 2008. Interdisciplinary european guidelines on surgery for severe obesity. European Journal of Obesity 87: 468-476.

Furuyashiki, T., H. Nagayasu, Y. Aoki, H. Bessho, T. Hashimoto, K.Kanazawa, and H. Ashida. 2004. Tea catechin suppresses adipocyte differentiation accompanied by down-regulation of PPARgamma2and C / EBPalpha in 3T3-L1 cells. Bioscience, Biotechnology, and Biochemistry 68: 2353-2359.

Gable, DR, SJ Hurel, and SE Humphries. 2006. Adiponectin and its gene variants as risk factors for insulin resistance, the metabolic syndrome and cardiovascular disease. Atherosclerosis 188, no. 2: 231-244.

Galili, O., D. Versari, KJ Sattler, ML Olson, D. Mannheim, JPMc Connell, AR Chade, LO Lerman, and A. Lerman. 2007. Early experimental obesity is associated with coronary endothelial dysfunction and oxidative stress. American Journal of Physiology 292: 904-911.

Gil, JH, JA Lee, JY Kim, and YM Hong. 2008. Leptin, adiponectin, interleukin-6 and tumor necrosis factor-αin obese adolescents. Korean Journal of Pediatrics 51, no. 6: 597-603.

Gonzalez, OM, H. Gonz, H. Salazar, and M. Abundis. 2008. Effect of oral L-carnitine administration on insulin sensitivity and lipid profile in type 2 diabetes mellitus patients. Annals of Nutrition and Metabolism 52, no. 4: 335-338.

Grundy, SM, HB Brewer, JI Cleeman, SC Smith, and C. Lenfant. 2004. Definition of metabolic syndrome: report of the national heart, lung, and blood institute / american heart association conference on scientific issues related to definition. Circulation 109: 433-438.

Harwood, HJ 2004. Acetyl-CoA carboxylase inhibition for the treatment of metabolic syndrome. Current Opinion in Investigational Drugs 5, no. 3: 283-289.

Hiroshi, K., K. Honda, Y. Tominaga, S. Yokota, and S. Hasegawa. 2008. Investigation of the anti-obesity action of licorice flavonoidoil in diet-induced obese rats. Bioscience, Biotechnology, and Biochemistry 72, no. 12: 3225-3231.

Hong, YM, YW Song, HS Kim, HS Park, JH Min, JW Jung, NS Kim, and CI Noh. 2009. Metabolic syndrome in the overweight and obese adolescents and the impact of obesity on the cardiovascularsystem. Korean Association of Medical Journal Editors 52, no. 10: 1109-1118.

Hotta, K., T. Funahashi, NL Bodkin, HK Ortmeyer, Y. Arita, BC Hansen, and Y. Matsuzawa. 2001. Circulating concentrations of the adipocyte protein adiponectin are decreased in parallel with reduced insulin sensitivity during the progression to type 2 diabetes in rhesus monkeys. Diabetes 50, no. 5: 1126-1133.

Kang, DG, TY Hur, GM Lee, H. Oh, TO Kwon, EJ Sohn, and HS Lee. 2002. Effects of Cudrania tricuspidata water extract on blood pressure and renal functions in NO-dependent hypertension. Life Sciences 70: 2599-2609.

Kelishadi, R. 2007. Childhood overweight, obesity, and the metabolic syndrome in developing countries. Epidemiologic Reviews 29: 62-76.

Kershaw, EE, and SF Jeeffrey. 2004. Adipose tissue as an endocrineorgan. Journal of Clinical Endocrinology and Metabolism 89, no. 6: 2548-2556.

Kim, IS, J. Lee, JS Lee, DY Shin, MJ Kim, and MK Lee. 2010. Effect of fermented yacon ( Smallanthus Sonchifolius) leaves tea on blood glucose levels and glucose metabolism in high-fat diet and streptozotocin-induced type 2 diabetic mice. Korean Journal of Nutrition 43, no. 4: 333-341.

Lakka, HM, DE Laaksonen, TA Lakka, LK Niskanen, E. Kumpusalo, J. Tuomilehto, and JT Salonen. 2002.The metabolic syndrome and total and cardiovascular disease mortality in middle-aged men. Journal of the American Medical Association 288, no. 21: 2709-2716.

Lang, A., and ES Froelicher. 2006. Management of overweight and obesity in adults: behavioral intervention for long-term weight loss and maintenance. European Journal of Cardiovascular Nursing 5, no. 2: 102-114.

Lee, BW, JH Lee, ST Lee, H. Lee, WS Lee, TS Jeong, and KH Park. 2005. Antioxidant and cytotoxic activities of xanthones from Cudrania tricuspidata . Bioorganic & Medicinal Chemistry Letters 15, no. 24: 5548-5552.

Lee, JS, GC Han, GP Han, and N. Kozukue. 2007. T he antioxidant activity and total polyphenol content of Cudrania tricuspidata . Journal East Asian Society Dietary Life 17, no. 5: 696-702.

Lee, JS, MK Lee, TY Ha, HM Park, KS Jeong, MN Woo, and MS Choi. 2006. Supplementation of whole persimmon leaf improves lipid profiles and suppresses body weight gain in rats fed high-fat diet. Food and Chemical Toxicology 44: 1875-1883.

Mao, J., F. J. Demayo, H. Li, L. A. Elheiga, Z. Gu, T. E. Shaikenov, P. Kordari, S. S. Chirala, W. C. Heird, and S. J. Wakil. 2006.

Liver-specific deletion of acetyl-CoA carboxylase 1 reduces hepatic triglyceride accumulation without affecting glucose homeostasis. Proceedings of the National Academy of Sciences of the United States of America 103, no. 22: 8552-8557.

Marcelin, G., and S. Chua. 2010. Contributions of adipocyte lipidmetabolism to body fat content and implications for the treatment of obesity. Current Opinion in Pharmacology 10: 588-593.

Martin, JP, M. Dailey, and E. Sugarman. 1987. Negative and positive assays of superoxide dismutase based on hematoxylin autoxidation. Archives of Biochemistry and Biophysics 255: 329-336.

Meguro, T., B. Chen, J. Lancon, and JH Zhang. 2001. Oxyhemoglobin induces caspase-mediated cell death in cerebral endothelial cells. Journal of Neurochemistry 77, no. 3: 1128-1135.

Meydani, M., and ST Hasan. 2010. Dietary polyphenols and obesity. Nutrients 2, no. 7: 737-751.

Mlinar, B., J. Marc, A. Janez, and M. Pfeifer. 2007. Molecular mechanismsof insulin resistance and associated diseases. International Journal of Clinical Chemistry 375: 20-35.

Munday, MR 2002. Regulation of mammalian acetyl-CoA carboxylase. Biochemical Society Transactions 30: 1059-1064.

Murase, T., A. Nagasawa, J. Suzuki 1, T. Hase, and I. Tokimitsu. 2002. Beneficial effects of tea catechins on diet-induced obesity: stimulation of lipid catabolism in the liver.International Journal of Obesity 26: 1459-1464.

Nagao, T., T. Hase, and I. Tokimitsu. 2007. A green tea extract high incatechins reduces body fat and cardiovascular risks in humans. Obesity ( Silver Spring ) 15, no. 6: 1473-1483.

hkawa, H., N. Ohishi, and K. Yagi. 1979. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Analytical Biochemistry 95: 351-358.

Padwal, RS, and SR Majumdar. 2007. Drug treatments for obesity: orlistat, sibutramine, and rimonabant. Lancet 369, no. 9557: 7177.

Park, BH, JW Shin, SI Lee, and SD Kim. 2008.The effects of Cudrania tricuspidata tea leaves on the blood glucose and serumipids profiles of streptozotocin-induced hyperglycemic rats. Journal East Asian Society Dietary Life 18, no. 2: 516-523.

Park, KH, YD Park, JM Han, KR Im, BW Lee, IY Jeong, TS Jeong, and WS Lee. 2006.Anti-atherosclerotic and anti-inflammatory activities of catecholic xanthones and flavonoids solated from Cudrania tricuspidata . Bioorganic & Medicinal Chemistry Letters 16, no. 21: 5580-5583.

Park, SH, SK Ko, and HC Sung. 2005. Euonymus alatus prevents the hyperglycemia and hyperlipidemia induced by high-fat diet inICR mice. Journal of Ethnopharmacology 102: 326-335.

Pechanova, O., R. Rezzani, P. Babal, I. Bernatova, and R. Andriantsitohaina. 2006. Beneficial effects of provinols ^™ : cardiovascular system andkidney. Physiological Research 55, no. 1: 17-30.

Plutzky, J. 2000. Emerging concepts in metabolic abnormalities associated with coronary artery disease. Current Opinion in Cardiology 15, no. 6: 416-421.

Qureshi, K., and GA Abrams. 2007. Metabolic liver disease of obesity and role of adipose tissue in the pathogenesis of nonalcoholic fatty liver disease. Journal of Gastroenterology 13, no. 26: 3540-3553.

Seo, EJ, L. Curtis, BW Lee, HY Kim, YB Ryu, TS Jeong, WS Lee, and KH Park. Xanthones from Cudrania Tricuspidata displaying potent a-glucosidase inhibition. Bioorganic & Medicinal Chemistry Letters 17, no. 23: 6421-6424.

Stripe, F., and CE Della. 1969.The regulation of rat liver xanthine oxidase. Conversion in vitro of the enzyme activity from dehydro-genase (type D) oxidase (type O). Journal of Biological Chemistry 244, no. 14: 3855-3863.

Taddei, S., V. Agostino, G. Lorenzo, V. Daniele, and S. Antonio. 2006. Endothelium, aging, and hypertension. Current Hypertension Reports 8, no. 1: 84-89.

Valko, M., DJ Moncol, TD Cronin, M. Mazura, and J. Telser. 2007. Free radicals and antioxidants in normal physiological functions and human disease. Journal of Biochemistry and Cell Biology 39 no. 1: 44-84.

Whang, HJ, WS Han, and KR Yoon. 2001. Quantitative analysis of total phenolic content in apple. Analytical Science and Technology 14, no. 3: 377-383.

Zou, YS, AJ Hou, GF Zhu, YF Chen, DS Han, and QS Zhao. 2004. Cytotoxic isoprenylated xanthones from Cudrania tricuspidata . Bioorganic and Medicinal Chemistry 12 no. 8: 1947-1953.

Attach an electronic file to a sequence list

Claims (8)

Food composition for improving obesity or fatty liver comprising kkujippong extract as an active ingredient.
According to claim 1, wherein the kkujippong extract is a composition, characterized in that the stem extract of kkujippong.
The composition of claim 1, wherein the composition reduces the content of LDL-cholesterol in the blood.
The composition of claim 1, wherein the composition reduces the expression level of acetyl-CoA carboxylase or peroxide proliferator-activated receptor-γ.
Pharmaceutical composition for the prevention or treatment of obesity or fatty liver comprising kkujippong extract as an active ingredient.
According to claim 5, wherein the kkujippong extract is a composition, characterized in that the stem extract of kkujippong.
6. The composition of claim 5, wherein the composition reduces the content of LDL-cholesterol in the blood.
6. The composition of claim 5, wherein the composition reduces the expression of acetyl-CoA carboxylase or peroxide proliferator-activated receptor-γ.

Images