KR101202996B1 - Transgenic Cats Expressing Red Fluorescence Protein and Producing Method Thereof - Google Patents

Abstract

Disclosed are a transgenic cat expressing a red fluorescent protein and a method of producing the same. The production method of a transgenic cat expressing a red fluorescent protein according to the present invention can not only produce a cat with a red fluorescent protein gene introduced with high efficiency, but is also useful for producing a genetically designed "modified pet". . In addition, the transgenic cat expressing the red fluorescent protein according to the present invention can be usefully used as a clinical model for the treatment of human diseases.

The present invention also relates to a transgenic cat and its progeny expressing the red fluorescent protein produced by the above method. The present invention also relates to cells isolated from transgenic cats and their progeny expressing red fluorescent protein.

Red fluorescent protein, cat, somatic cell nuclear transfer

Description

Transgenic Cats Expressing Red Fluorescence Protein and Producing Method Thereof}

The present invention relates to a transgenic cat expressing a red fluorescent protein and a method for producing the same, and more particularly, to express a red fluorescent protein which can be usefully used as a clinical model for the treatment of human diseases as well as the production of modified pets. It relates to a transgenic cat and a production method thereof. The present invention also relates to a transgenic cat or its progeny and cells isolated therefrom produced by the method and expressing a red fluorescent protein.

Cats are systematically close to humans. And the feline genetic map shows higher levels of systematic conservation than humans, such as rodents or other laboratory mammals (Menotti-Raymond M, et al ., Genomics 1999; 57: 9-23). . In addition, about 250 genetic diseases are similar to human diseases, and have been proposed as important experimental models for studying various refractory diseases (Gomez MC et al ., Theriogenology, 2006; 66; 72-81; Pontius JU et. al ., Genome Research, 2007; 17: 1675-1689).

Cat genetic engineering is limited by the lack of suitable techniques, such as stem cells (ES), which are used primarily for the production of mutations in mice. Replication through somatic cell nuclear transfer (SCNT) is a potential alternative approach for species without stem cell technology. Somatic cloning is a technique in which differentiated somatic cells are activated by inserting them into an egg from which a nucleus has been removed and then in the same manner as a normal fertilized egg. Such cloning technology can be widely used in research in basic sciences including developmental biology, and is expected to contribute greatly to various medical and pharmaceutical fields such as production of useful proteins, development of disease models, and transplantation of organs. The usefulness is very large.

Somatic cell nuclear transfer techniques include transformation and replication (Cibelli JB et al ., Science, 1998; 280: 1256-1258.), Sheep (Denning C. et al ., Nature Biotechnology, 2001; 19: 559-562, McCreath KJ et al ., Nature, 2000; 405: 1066-1069), goats (Keefer CL et al ., Biology of Reproduction, 2001; 64: 849-856), and pigs (Dai Y et al ., Nature Biotechnology, 2002 20: 251-255, Lai L & Prather RS., Annals of Medicine, 2002; 34: 501-506).

In order to improve the production capacity of transgenic animals with somatic cell nuclear transfer, it is very important to select genetically modified donor cells and reconstructed embryos before transplanting embryos into surrogate mothers. Mice (Sato K et al ., Human Cell, 2001; 14: 301-304), pigs (Park KW et al ., Biology of Reproduction, 2002; 66: 1001-1005) to obtain transgenic pups with somatic cell nuclear transfer And green fluorescent protein (GFP) was used as donor cells for production from cattle (Bordignon V et al ., Biology of Reproduction, 2003; 68: 2013-2023). The targeting of the GFP gene allows for the binding of chromosomal protein labels, tagging of specific chromosomal sites, and binding to many proteins in the cytoplasm, and its harmlessness allows cognate cytoskeletal filaments in living cells. It is widely used to express. In 1994, Halfie et al. Applied GFP obtained from Aequorea victoria as a fluorescent protein recognition marker to observe various molecular biological changes in living cells including pig embryos. Since then, EGFP (enhanced GFP) has been further improved and used as a marker gene in various animals. Red fluorescent protein (RFP) has been described as Discosoma [Matz MV et al., Nature Biotechnology, 1999; 17: 969-973, a kind of fluorescent protein first isolated as DsRed.

As a method for transplanting a fluorescent protein gene into somatic cells, a method of infecting with a viral vector or electroporation with a lipid (liposome) or a non-lipid (polymer) material that carries DNA is known. have. For example, using a retroviral vector to produce GFP pigs (Park KW et al., Animal Biotechnology, 2001; 12: 173-181), electroporation to produce a-1,3-galactosyltransferase knockout cloned pigs. (Lai L et al., Science, 2002; 295: 1089-1092), the method of implanting the GFP gene by transplanting the gene under the control of liposomes to produce transgenic pigs (Hyun S et al., Biology of Reproduction, 2003; 69: 1060-1068). However, there have been no reports of transgenic cloned cats expressing genes derived from outside, and many studies have been conducted for this purpose.

A prominent consequence of clinically confirmed retinal degeneration is the loss of cells, such as photoreceptors, that can cause visual function decline. In this situation, we need to find a solution in terms of developmental treatment that can fundamentally solve vision-related diseases. Various studies have been conducted on whether retinal transplantation or retinal progenitor cells or cells such as brain progenitor cells can be transplanted into retinal disease animals and recovered as visual function by proliferation of external cells and differentiation into retinal cells. there was.

Neural tissue transplantation could provide a new form of treatment for neurodegenerative disorders such as Parkinson's or Huntington's disease. The most advanced disease for the clinical application of neurotransplantation is Parkinseung's disease, which leads to depletion and degeneration of striatum dopamine. In order to use a method that is easy to provide to humans and free from moral problems, it must first be appropriately replaced with animal organs and have the advantage of being genetically manipulated.

Stem cells are symmetry or asymmetry cell division methods that are capable of maintaining their own differentiation ability for an indefinite period of time (self-renewal) or differentiating into specific cells. . Immediately after fertilization by sperm and ovum in mammalian embryonic development, the cells are called totipotent cells. That means not only differentiation into all cells, but also the development of the fetus if the cells are isolated and implanted in the womb. After several cell divisions, the embryos have a more specific character and go through the so-called blastocyst stage, which remains as a hollow wall. The blastocyst consists of a trophoblast and inner cell mass (ICM), which form the supporting tissue or placenta necessary for fetal development in the uterus, and the ICM forms cells with potentials that can actually differentiate into all organs. do. These ICM cells are defined as pluripotent cells and differentiate into all the necessary cells but do not form complete organs. These ICM cells are cultured to form embryonic stem cells in pluripotent state.

Focusing on the cat as a disease model animal that can be applied to the bio-clinical of human disease, the genetically modified cat was introduced by the red fluorescent protein, which is a marker, to prepare a somatic cell nuclear replacement method.

Thus, the present inventors use a pLHCRW vector based on Moloney rat leukemia virus (MoMLV) which is pseudotyped by VSV-G protein, a surface glycoprotein of Vesicular stomatitis virus (VSV), The red fluorescent protein gene was introduced into cat somatic cells with high efficiency, and it was confirmed that a transgenic cat expressing the red fluorescent protein could be produced.

An object of the present invention to provide a method for producing a transgenic cat expressing a red fluorescent protein.

Still another object of the present invention is to provide a vector for expressing a red fluorescent protein which can be used in the production of the transgenic cat.

Still another object of the present invention is to provide a transgenic cat or a progeny thereof in which a gene expressing a red fluorescent protein is integrated in a cat chromosome.

It is another object of the present invention to provide a cell isolated from the transgenic cat and its progeny expressing the red fluorescent protein.

In order to achieve the above object, the present invention comprises the steps of (a) separating the somatic cells from the cat; (b) preparing an expression vector pLHCRW having a series map of FIG. 2 comprising a nucleic acid sequence encoding a red fluorescent protein; (c) introducing the expression vector pLHCRW into the isolated somatic cells and culturing them; (d) removing the nucleus of the oocytes collected from the cat, and then fusion with somatic cells into which the expression vector pLHCRW cultured in step (c) is introduced to prepare a transformed embryo, and activating it; And (e) transplanting the transformed embryo into the fallopian tube of the surrogate mother cat, thereby producing the offspring, thereby providing a method for producing a transgenic cat expressing a red fluorescent protein.

The transgenic cat of the present invention refers to a cat genetically engineered so that the foreign gene expressing the red fluorescent protein is stably integrated into the cat's chromosome. It may also be knocked out or knocked-in further in the cat's chromosome. In this case, the transgenic cat not only expresses a red fluorescent protein, but also a specific gene of the cat is knocked out or knocked-in, thereby further obtaining a genetic trait suitable for the purpose.

The gene to be knocked out or knocked in is not particularly limited. Specifically, specific genes may be knocked out or knocked in for the purpose of producing useful proteins, developing disease models, and the like.

The production method of the transgenic cat of the present invention is characterized by using the expression vector pLHCRW having a series map of FIG. 2 so that the gene encoding the red fluorescent protein can be inserted into the chromosome and constructed by somatic cell nuclear transfer.

Expression vector pLHCRW is characterized in that it comprises a CMV (cytomegalovirus) promoter of SEQ ID NO: 1, the DsRed2 gene of SEQ ID NO: 2 and the woodchuck hepatitis virus posttrancriptional regulatory element (WPRE) of SEQ ID NO: 3.

In addition, the expression vector pLHCRW may further comprise a nucleic acid sequence that can knock-out or knock-in a specific gene in the cat chromosome. In this case, in one pLHCRW vector, a nucleic acid sequence capable of knocking-out or knocking-in a specific gene in the cat chromosome is expressed under a separate promoter, apart from the system in the vector expressing the red fluorescent protein. Such vectors can be prepared using genetic recombination techniques well known in the art.

In addition, a recombinant fusion gene produced by the above method, comprising a CMV (cytomegalovirus) promoter of SEQ ID NO: 1, a DsRed2 gene of SEQ ID NO: 2, and a woodchuck hepatitis virus posttrancriptional regulatory element (WPRE) of SEQ ID NO: 3 Transgenic cats expressing the red fluorescent protein and their progeny are provided.

By using the method of producing a transgenic cat expressing a red fluorescent protein according to the present invention, it is possible to select a embryo that has a positive reaction before being transplanted into a surrogate mother, thereby producing a cat with a high red fluorescent protein gene introduced therein. In addition, it is useful for producing genetically designed "modified pets" such as allergen-free cats. In addition, the transgenic cat expressing the red fluorescent protein according to the present invention can be usefully used as a clinical model for the treatment of human diseases.

In addition, it was confirmed that the red fluorescent protein was stably expressed even in the offspring obtained by crossing the normal cat with the transgenic cat expressing the red fluorescent protein. In other words, it has acquired hereditary transmission from one generation to the next.

Progeny of transgenic cats expressing red fluorescent protein can be obtained by crossing the transgenic cats expressing red fluorescent protein with normal cats or transgenic cats expressing red fluorescent protein, and obtained by replicating somatic cells of the transgenic cats. It may be. Check that each generation has the same genotype and phenotype as the first-generation transgenic cat.

Also provided are cells isolated from a transgenic cat and its progeny expressing the red fluorescent protein.

One skilled in the art can isolate various cells in a variety of organs at various stages of development of the transgenic cat and its progeny expressing the red fluorescent protein by methods known in the art. The characteristics of the finally isolated cells differ depending on the tissue origin and the method of isolation, but have the characteristics of expressing the cellular red fluorescent protein isolated from the transgenic cat and its progeny of the present invention.

For example, retinal progenitor cells can be isolated from tissues such as the retina and brain, mesenchymal cells can be separated from bone marrow, and embryonic stem cells can be separated from cat's blastocyst.

The method of isolating cells from each tissue is not particularly limited, and known general methods may be used. For example, separation may be performed depending on cell density, antibody affinity for cell surface epitopes, cell size, and degree of fluorescence emission. Specifically, there is a method such as density gradient centrifugation and a method using an antibody such as a magnetic activated cell sorter (MACS), and a method using fluorescence such as FACS.

Cultivating cells isolated from tissues may include cells having various properties. In order to separate only specific cells from such cell populations, cell surface markers may be used and FACS may be used.

That is, various cell populations can be reproducibly obtained at various stages of development of the transgenic cat and its offspring and at various organs in vivo. The isolated cells can be cultured and differentiated by known methods and used for various purposes. The culture and differentiation methods are not particularly limited, and factors that promote differentiation can be treated according to the purpose.

The present invention can be usefully used in the fields of basic science including developmental biology, development of disease models, and organ transplantation.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Reagent Source

All reagents were purchased from Sigma-Aldrich Chemical Company (St. Lorraine, Mo., USA) unless otherwise noted.

Care and Use of Animals

Wild cats to be used as oocyte donors were maintained in 0.9 × 0.7 × 0.65 m stainless steel cages, and feed and water were freely fed. The animals were bred in a room controlled by 14 (Light): 10 (Dark) photoperiod to receive light at 06:00. The management and use of experimental animals was approved by the National Institute of Animal Care and Use, Sunchon National University.

Statistical analysis

Each experiment conducted in the present invention was repeated at least three times. The effects of various cultures on the development of egg ovulation and blastocysts of activated eggs were analyzed by chi-square test. The number of blastocysts and the differences between groups were assessed by student's t-test. The significance level was adjusted to P <0.05.

Example 1 Retroviral vector production and virus production

end. Retroviral vector (pLHCRW) production

As shown in Figure 1, the pLHCRW plasmid containing the RFP gene was constructed as follows. That is, the commercially available pLNCX (Clontech Mountain View, CA, USA) was treated with restriction enzymes BamH I and Hind III to isolate the CMV promoter, which was treated with the same restriction enzyme pRevTRE (Clontech Mountain View, CA, USA) ) Was combined with the plasmid to construct pRevTRE-CMV. PLHCX was prepared by treating the constructed pRevTRE-CMV plasmid with Xho I and BamH I restriction enzymes to remove the TRE moiety and completing the Klenow reaction. Next, PCR fragments containing the DsRed2 gene from pDsRed2-C1 (Clontech Mountain View, CA, USA) and the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) sequence from woodchuck hepatitis virus 2 genomic DNA (GenBank Accession No. M11082) were PCR. After cloning using a few intermediate procedures and then inserted into pLHCX [Zufferey et al., Journal of Virology 1999; 73: 2886-2892 to finally build the pLHCRW plasmid.

I. Virus production

The cells produced by retroviruses are described in Koo et al . [FASEB Journal 2006; 20: 2251-2260. First, PT 67 cells (Clontech Mountain View, CA, USA) were temporarily transferred to pLHCRW. Virus obtained from transfected and transfected PT 67 cells was infected with GP2-293 cells (Clontech Mountain View, CA, USA). PT 67 is a retroviral packaging cell, which expresses the gag gene and pol gene of MoMLV (Moloney murine leukemia virus) and the Gibbon ape leukemia virus membrane gene, and GP2-293 cells express the gag gene and pol gene of MoMLV. LHCRW-infected GP2-293 cells were selected using hygromycin (150 μg / ml) for 2 weeks, and these Hyg ^R (hygromycin-resistant) cells were transfected with pVSV-G (Clontech Mountain View, CA, USA) To express VSV-G protein.

Viruses packaged with VSV-G protein were obtained 48 hours after transfection. All cells, including virus producing cells, were incubated in DMEM medium containing 4.5 g / l glucose (GibcoBRL, Grand Island, NY, USA), fetal bovine serum (10%) and streptomycin (100 μ / ml). Incubations were made at 5 ° C. and 5% CO ₂ . Virus-containing medium harvested from the infected and transfected GP2-293 cells was filtered through a 0.45 μm pore size filter and then used to infect fibroblasts in cats. Infected fibroblasts were selected for 6 days with hygromycin (150 μg / ml).

[Example 2] Establishing feline fibroblasts

White OD Eye White 6 mm skin tissue was removed from the white cat to form several islet infant cell lines. Chop the skin cells in 35 mm Petri dishes (Nunc, Denmark) with sterile scissors and initially culture 90% confluence in a 38 ° C incubator with 5% CO ₂ in a DMEM medium containing 10% FBS. Incubate until confluence was seen. The cells were trypsinized and reincubated at ¹ × 10 ⁶ cells / ml and cells at zero phase in DMEM (Gibco, USA) with 10% dimethylsulfoxide (10% DMSO) and 10% FBS (1 vial / 35). frozen in mm dish). After thawing, the cells were cultured for transfection of the RFP gene. After incubation in serum free culture for 3 days, fully grown RFP transformed cells were used for somatic cell nuclear transfer (SCNT) (Yin XJ et al ., Theriogenology 2007; 67: 816-823). Individual RFP-transfected cells were selected on an inverted microscope with a G-2A filter (EX 510-560 nm, BA 590 nm) (see FIG. 3).

[Example 3] Ovarian recovery and egg maturation

200 IU of horse chorionic gonadotropin (eCG; Daesung, Korea) was injected into adult cats to stimulate follicular development, and 4 days later, human chorionic gonadotropin (hCG; Daesung, Korea) 100 IU was treated to mature eggs. Induced. Twenty four hours after hCG injection, the ovaries were recovered by normal ovarian dissection and chopped into mesnal to allow the eggs to emerge from m-Tyrode's Hepes culture. Eggs selected from TCM 199 with 10% FBS (fetal bovine serum; Gibco / Invitrogen, Carlsbad, CA, USA) and 1% penicillin G / streptomycin (P-4333) were added. It matured at 38 ° C. containing% carbon for 4 hours.

Example 4 Somatic Cell Nuclear Replacement (SCNT)

The oocytes were removed from mature eggs by gentle pipetting in TCM199 containing 0.1% hyaluronidase. Stripped eggs were incubated for 1 hour in TCM199 containing 0.2 μg / ml demecolcine, followed by TCM199 containing 5 μg / ml cytocalinine B (cytochalasin B) and 0.2 μg / ml demecolcine. Put in. The protruding first poles and chromatin were removed using a micropipette mounted on a micromaipulator (Narishige, Japan) while observing on an inverted microscope (Nikon, Japan) using Hoffman controlled control optics. Next, the eggs were stained with Hoechst 33342 (5 μg / ml), and fluorescence microscopy was observed under ultraviolet light to confirm whether denucleation was successful.

[Example 5] Cell fusion and activation

Fibroblast donor cells established in Example 2 were isolated using 1% trypsin-EDTA and placed in D-PBS (Ca ²⁺ and Mg ²⁺ free) added with 0.3% fat acid-free (BSA). Medium size (20-25 μm) donor nuclear cells were inserted into the gastric cavity of each denuclearized egg by micromanipulation. Cytoplast / cell couplets were equilibrated in 0.3 M mannitol containing 0.1 mM Mg ²⁺ , and then transferred to an electrofusion chamber containing the same culture, followed by an electrogenerator (Nepagene, Ichikawa, Chiba, Japan) was energized twice at a time of 20 μsec at a DC voltage of 2.0 kV / cm to perform cell fusion. The fused embryos were removed from the chamber, washed several times, placed in a TCM199 culture containing 0.3% BSA, and then cultured in a 38 ° C., 5% CO ₂ incubator. After 1 hour of electrofusion, the fused embryos were equilibrated in 0.3 M mannitol containing 0.1 mM Ca ²⁺ and 0.1 mM Mg ²⁺ , placed in a fusion chamber containing the same culture, and 20 μsec at a DC voltage of 1.0 kV / cm. It was energized by energizing at a time of and a time of 0.1 sec, respectively. The activated embryos were washed and then cultured in a 38 ° C., 5% CO ₂ incubator in TCM199 culture with 0.3% BSA and 2 mM 6-DMAP added.

As a result, strong fluorescence was observed in the reconstructed egg within 1 hour after fusion. This fluorescence is inferred to be transcribed and expressed in the donor cell genome or expressed in the donor cytoplasm containing RFP mRNA, such as the RFP protein. In addition, pigs [Lai L. et al ., Molecular Reproduction & Development 2002; 62: 300-306, fluorescence was weakly detected in NT (Nuclear Transfer) embryos at 4 cell and morula stages, similar to that reported in Two hours after fusion, strong fluorescence persisted in the reconstructed eggs, and after 15-48 hours after fusion, the fluorescence weakened or disappeared in NT embryos. After 3 days, it was confirmed that RFP begins to be expressed again in 2 ~ 4 cell stages of embryonic embryos.

[Example 6] In Vitro and In Vivo Development of Cloned Embryos Derived from RFP Transgenic Fibroblasts

end. In vitro culture

The activated embryos established in Example 5 were m-Tyrode's medium (50 μl × 150 droplets) with 1% MEM non-essential amino acid 151 (NEAA) and 3 mg / ml BSA (Tyrode's 1) added. ) [Gomez MC et al., Biol Reprod. , 2003; 69: 1032-1041], and further incubated for 4 days in m-Tyrodes culture with 1% NEAA, 2% MEM BME amino acids (EAA) and 10% FBS (Tyrode's 2). Segmentation was confirmed after 3 days, and the development of blastocysts on day 7 was visually confirmed. Next, blastocysts were fixed in PBS containing 3.7% paraformaldehyde and 0.1% BSA for 15 minutes at room temperature and then stained with Hoechst 33342 (20 μg / ml). The stained embryos were placed on a glycerol drop on the slide, covered with a cover glass, and the nuclei stained with a fluorescence microscope were observed, and the results are shown in Table 1 below.

I. In vivo culture

Three female cats were treated with eCG and hCF to collect embryos in the body. After 36 h of hCG treatment, the activated embryos were surgically implanted into surrogate mother oviducts. Seven days after transplantation, blastocysts were perfused from the uterus incision with TALP-Hepes buffered saline containing 0.3% BSA (A-9647). Next, blastocysts were fixed in PBS with 3.7% paraformaldehyde and 0.1% BSA for 15 minutes at room temperature and then stained with Hoechst 33342 (20 μg / ml). The stained embryos were placed on a glycerol drop on the slide, covered with a cover glass, and the nuclei stained with a fluorescence microscope were observed, and the results are shown in Table 1 below.

Values in the same column with different superscripts differ significantly ( P <0.05).

* Number of cells in blastocyst on day 7 of culture (Mean ± S.E.M).

** Number of cloned embryos recovered from total transplanted embryos after 7 days of incubation.

From Table 1, it was found that the number of cloned embryos was not sufficient for statistical analysis, but each embryo positively expressed RFP (100% in each group). The development rate up to blastocysts was higher in culture than in vitro culture (6.5% vs. 3.1%; P <0.05). The mean cell number of in vitro blastocysts was also higher than that of in vitro blastocysts (508 ± 477.9 vs. 78.2 ± 45.5; P <0.05). Thus, it can be seen that the in vitro culture system is not suitable for culturing cat embryos.

[Example 7] Cloning Embryo Transplantation into Synchronized Surrogate Mother

Activated embryos were cultured in humid conditions with 5% CO ₂ in 50 μl drop of TCM-199 with 4 mg / ml BSA covered with mineral oil. Determine the number of embryos in the two-cell to four-cell stage (176), then inject them with 100 IU PMSG and synchronize 96 healthy, mature domesticated female cats (S1-S11) via 100 IU hCG injection 96 hours after ovulation ) Into the fallopian tube. Transplantation of cloned embryos was performed 30 hours after about hCG injection. Surrogate mothers were anesthetized with acepromazine maleate (0.025 mg / kg, Sedaject; Samwoo, S. Korea) and ketamine (5 mg / kg; Daesung, S. Korea) before laparotomy. Only cats with a new ovulation site were used as surrogate mothers. 40 or 45 days after implantation, the pregnancy was diagnosed using a SONOACE 900 ultrasound scanner (Medison Co. LTD, Seoul, S. Korea) attached with a 7.0 MHz linear probe. After this, even after two weeks at the interval between the ultrasound and confirming the pregnancy status and development of the fetus while giving birth, and gave birth, the results are shown in Table 2 below.

* ND, not found.

From Table 2, it was confirmed that 3 out of 11 surrogate mothers were pregnant (27.3%) on ultrasound examination at 40-50 days. S-2 cats produced one live and one stillborn cat (TG-A and -B) on day 65 and S-3 cats produced one live cat (TG-C) on day 66 of pregnancy. It can be seen that.

The birth weight and placenta weight of cloned cats were measured and shown in Table 3 below.

TG, transformed ND, not identified.

The live weights of TG-A, -B and -C were 110, 122 and 136 g, respectively. The placenta weights of TG-A and -C cats were 20 and 29 g, respectively. The placenta of TG-B was not recovered due to natural birth during the night.

[Example 8] Microsatellite analysis of cloned cats

The paternity of TG cats produced in Example 7 was carried out. DNA was extracted from the tissues of offspring, surrogate mothers and donor somatic cells. Nine cat-specific DNA microsatellite markers (FCA229, FCA290, FCA305, FCA441, FCA078, FCA201, FCA224, FCA170, and FCA304) were used to confirm genetic matching of the cloned cat and donor fibroblasts. Yin XJ et al., Theriogenology 2007; 67: 816-823. Genomic DNA was amplified by PCR using nine cat microsatellite primers that were fluoresced using HEX (Applied Biosystems, Foster, Calif., USA). All PCR products were analyzed by 3100 gene analyzer, allele sizes were calculated by Genescan program (Applied Biosystems, Foster, CA, USA), and the results of microsatellite analysis are shown in Table 4 below.

S: surrogate mother, TG: transformation.

From Table 4, it was confirmed that the donor cat and the cloned cat were genetically identical to each other.

[Example 9] Genomic DNA Analysis

end. PCR analysis

Genomic DNA of cloned cats (TG-A, TG-B, TG-C) was extracted using the G-DEX Genomic DNA Extraction Kit (iNtRON BIOTECHNOLOGY, Seoul, S. Korea). To amplify the RFP gene, the nucleotide sequence of the pDsRed2-C1 cloning vector (Clontech, Mountain View, CA; Cat. Number 632407) was used to correspond to the base sequence of pDsRed2-C1 at positions 804-827 and 1218-1241. An upstream primer (SEQ ID NO: 5'GTTCCAGTACGGCTCCAAGGTGTA3 ') and a downstream primer (SEQ ID NO: 5: 5'ATGGTGTAGTCCTCGTTGTGGGAG3') were synthesized (see FIG. 2).

Next, preparing a genomic DNA extract, 10 pmol primers (SEQ ID NO: 4, 5), and 10 μl 2X GoTaq ^ⓡ Green Master Mix (Promega, Madison, WI, USA), reaction mixture (20 μl) containing the 100 ng And PCR was performed. Initial denaturation was performed at 94 ° C. for 5 minutes after 35 cycles of PCR amplification. The following three amplification conditions are: 94 ° C. for 30 seconds (denature), 58 ° C. for 30 seconds (annealed), and 72 ° C. for 30 seconds (amplification) after 35 cycles of amplification, at 72 ° C. to ensure amplification. Hold for 7 minutes. As a result, an amplification product of 438 base pairs was obtained (see FIG. 4).

I. Southern blot analysis

The genomic DNA (25 μg) of cloned cats (TG-A, TG-B, TG-C) was digested with Kpn I and the cut fragments containing the entire sequence of the RFP gene were isolated on a 0.8% agarose gel. To synthesize the RFP gene probe used for Southern blot analysis, an upstream primer corresponding to the base sequence of pDsRed2-C1 at positions 606-623 and 1270-1287 (SEQ ID NO: 6: 5'CGCCACCATGGCCTCTCTC3). ') And downstream primers (SEQ ID NO: 7: 5'CAGGAACAGGTGGTGGCG3') were synthesized (see Figure 2). Probes were synthesized using a PCR DIG Probe Synthesis kit (Roche, Mannheim, Germany), and the synthesized probes were purified by agarose gel electrophoresis and labeled with digoxigenin. It was then used for hybridization. After hybridization, labeled DNA located on a positively-charged nylon membrane was detected using a DIG luminescent detection kit (Roche, Mannheim, Germany) (see FIG. 4).

[Example 10] Confirmation of Red Fluorescent Protein

The red fluorescence of pups (TG-A, TG-C) and stillborn cats (TG-B) was confirmed using excitation-emission filter sets. The light was sourced from a 70W surgical lamp equipped with an excitation filter (HQ 540/40; Chroma Technology Corp., Rockingham, VT, USA). Red fluorescence emission from cats and intestines is applied to Samsung digital cameras equipped with emission filters (HQ 600/50; Chroma Technology Corp., Rockingham, VT, USA) attached to the base of the camera lens (GX10, Republic of Korea). The filter was easily removed for the image with white light and illumination (see FIGS. 5 and 6).

As shown in FIG. 5, the transgenic cat expressed red color under fluorescence illumination, which could be easily distinguished from a normal cat.

As shown in FIG. 6, the expression pattern of the RFP transgene was determined by several tissues collected from still-born TG cats (TG-B) and non-TG cats. Brain, heart, liver, kidneys, testicles, lungs, muscles, intestines, thymus, spleen, seminal vesicles, skin, hair, adipose tissue, and cord blood from transgenic cats. Among these, cardiac tissue showed relatively faint red fluorescence. However, the tissue of the cat used as a control did not see the expression of red fluorescence. In addition, although the transgenic cat had high RFP expression including brain and muscle expression, the RFP transgenic cat was normal in appearance and exhibited similar behavior as the control cat.

Confirmation of gene expression in the second generation cloned transgenic cat through somatic cells of the first generation transgenic cloned cat was intended to verify that the gene transfer of the transgenic cloned cat is normal. To establish the skin fibroblast line of the first generation of cloned cats, the fibroblast line was constructed from skin tissue. The constructed cell line was confirmed whether the gene expression through FACS analysis (Fig. 7). Normally expressed skin fibroblasts of the first generation of transgenic cloned cats were used as donor cells for the production of second generation cloned cats and used for nuclear replacement. The second-generation transgenic cloned cats thus obtained were able to confirm their expression in genomic DNA and mRNA by PCR analysis of their expression in organs and whole skin tissues. It was confirmed that the gene has been transferred (Fig. 8, 9).

Finally, the germ-line transmission, along with the ability of the first generation of transgenic cloned cats, to confirm that the specific gene was introduced into the next generation. In this study, natural mating between first-generation transgenic cloned cats and normal cancer cats was attempted, and six healthy litters were obtained from a surrogate mother. The expression of fluorescence was confirmed using a fluorescence filter for the expression of genes in six litters (FIG. 10) and the expression in genomic DNA and mRNA of each organ was confirmed by PCR analysis (FIG. 11).

RFP genes are useful markers for the identification of transgenic nuclear transfer embryos prior to embryonic expression. The use of these reported genes could significantly increase the efficient production of transgenic animals. This is because expression of these genes allows the selection of embryos that have tested positive before being transferred to the surrogate mother. In addition, RFP transgenic replication studies can be important for human clinical basic research in need of cells. That is, the application of the SCNT method to produce genetically modified cats suggests that not only the production of modified pets but also the clinical model animal production of human disease can be of value.

[Example 11] Establishment and Differentiation of Retinal Progenitor Cells and Brain Progenitor Cells Isolated from RFP-transformed Cat Retina and Brain

The purpose of this study was to isolate retinal progenitor cells and brain progenitor cells from RFP transgenic cats and transplant them into cats suffering from retinal diseases.

The babies of RFP transgenic cloned cats at 45 days of gestation were anesthetized by surrogate mothers, and the fetuses were removed by caesarean section. Isolate the eye and brain parts of the living area, rinse with cold PBS in a Petri dish, split the retina into small pieces with a 1 ml pipette, and use the blade to sculpt as much as possible. Centrifuge for 5 minutes. After removing the supernatant, leave 1 ml trypsin for 1 minute to stop trypsin using a 1 ml trypsin inhibitor. After pipetting 15-20 times with Pasteur glass pipette, centrifuge for 1,000 rpm x 4 minutes with 13 ml cold PBS and break up the centrifuged mass again with UL culture + 5% FBS. After counting the cells, incubate 5-7 × 10 ⁶ cells / T75 in a T75 flask coated with Fibronectin. After about one day, UL culture + 5% FBS was completely replaced with serum-free culture.

Passage of retinal progenitor cells and brain progenitor cells was performed as follows. Discard all of the culture solution in the flask containing the cells in culture, put 4 ml trypsin in the flask and left in the incubator for 5 minutes. Add 4 ml DMEM + 5% FBS culture to the flask to stop trypsin and transfer all to 15 ml bub. After centrifugation for 1,000 rpm × 5 min, the supernatant is removed and the cells can be broken down with a Pasteur glass pipette to break up the centrifuged mass together with the UL culture culture to fit 10 ml of the culture that will be needed for culture in a new T75 flask. Add approximately 9 ml UL culture to the 15 ml tube containing and pipette all of them into the flask. Incubated in 37 ° C., 5% CO ₂ , 95% incubator.

The freezing of progenitor cells was trypsinized as in the above method, the cells were collected, transferred to a freezing tube with a freeze culture (UL culture medium + 10% DMSO), stored in a freezer at -80 ° C, and the freezing tube was placed in a constant temperature bath upon thawing. After dissolving for 2-3 minutes, the solution was transferred to a 15 ml tube, diluted in 10 ml of DMEM + 10% FBS culture, and centrifuged and incubated with UL culture.

Retinal progenitor cells in culture are characterized by a slow growth rate up to 2 months and a rapid increase in growth rate after 2 months. The growth of retinal progenitor cells is shown in FIG. 12. Brain progenitor cells are relatively easy to proliferate and manipulate, unlike retinal progenitor cells. The growing form of the brain progenitor cells showed that the nerves tangled together like branches (FIG. 13). When both cells were initially isolated from each tissue and cultured, it was found that RFP expression was markedly low, which is also mainly the expression of tissues, and there was no expression of the cells being cultured (FIG. 12F, 8F). Five days after the first isolation, 50-60% or more of the progenitor cells were observed to emit RFPs (H, I, J in FIG. 12, and H, I, J in FIG. 8). Nearly 100% of the cells showed RFP expression and stable proliferation after 10 days (FIG. 12J and FIG. 13J).

As a laboratory animal, many cat's genetic diseases appearing in cats are similar to human genetic diseases, so cat genetic research can contribute greatly to the cause of human intractable diseases. It has many advantages as the value of large animals in clinical trial procedures before application.

In addition, RFP transgenic clone cats express red color of RFP gene, which is a marker gene, so that they can differentiate into embryonic stem cells, adult stem cells, etc. This can be effectively utilized as a variety of human disease animals.

Progress to date is the establishment and securing of retinal progenitor cells and brain progenitor cells, and subsequent transplant experiments are real disease models with retinal diseases through collaboration with other research cooperatives. Transgenic cloned cats with red fluorescent protein genes in genetically and pathologically close cats have the potential to treat optic nerves and cells by separating brain precursor cells and retinal precursor cells and transplanting them. In terms of proliferation, development, and differentiation, red fluorescent protein is easily identified and proved as a marker.

[Example 12] Survival and Neuronal Differentiation of the Rat Brain of Mesenchymal Cells Isolated from Bone Marrow

MSCs were isolated from the bone marrow of RFP transgenic cats and transplanted into different areas of the rat brain striatum to see how the transplanted cells proliferated and differentiated.

In the process of bone marrow harvesting, transplantation and analysis, RFP-transformed cats were anesthetized and bladed around the upper femur. Using a syringe, poke the bulge toward the indentation and carefully collect 1 cc to 2 cc of bone marrow and transfer it immediately to a blood tube containing heparin. Wash all blood with PBS, transfer to 15 ml tube and centrifuge for 10 min at 1800 rpm. All of the underlying blood layer is then incubated in a T75 flask with 10 ml of DMEM + 10% FBS culture (hereafter DMEM culture). After about 5 days, the culture medium was replaced with a fresh solution, and after 2 days of culture, the blood was also carefully removed while passing through the subculture at about 1 week. MSC passage was performed as follows. The culture solution in the flask containing the cells in culture was discarded and 4 ml trypsin was treated in the flask and left in an incubator for 5 minutes. Treat the flask with 4 ml DMEM + 10% FBS culture to stop trypsin and transfer all to 15 ml tubes. After centrifugation for 1,000 rpm × 5 min, remove all supernatant and break up the centrifuged mass with the culture using a 1 ml pipette to fit 10 ml of the culture solution required for incubation in a new T75 flask. Add about 9 ml DMEM culture to the pipette and transfer all to the flask. Incubated in 37 ° C., 5% CO ₂ , 95% incubator.

The freezing of progenitor cells was trypsinized as in the above method, the cells were collected, transferred to a freezing tube with a freezing medium (DMEM medium + 10% DMSO), stored in a freezer at -80 ° C, and the freezing tube was placed in a constant temperature bath for 2-3 minutes. After dissolving, the solution was transferred to a 15 ml tube and diluted in 10 ml of DMEM + 10% FBS culture, followed by centrifugation and incubation with DMEM culture.

The MSC used for transplantation used cells from the fourth stage of passage. 36 rats were prepared and divided into 6 groups and 1 control group. Six groups were divided into 2, 3, 4, 5, and 6 weeks after transplanting MSC for the purpose of cross-section of the implanted area. cyclosporine A) immunosuppressants were administered until the last analysis day. Brains were isolated from the group of rats after a given day and fixed in 4% paraformaldehyde to O.C.T. Samples were cryopreserved after embedding in the compound.

Cryopreserved specimens were sectioned and attached to slide glass, β III-tubulin (1: 400 dilution, mouse monoclonal; Sigma), NF-M (1:40 dilution, mouse monoclonal; Sigma), GFAP (1: 1000 dilution, rabbit polyclonal; Chemicon), and myelin / oligodendrocyte specific protein (MOSP, 1: 1000 dilution, mouse monoclonal; Chemicon) were placed in the incubator for 1 hour 30 minutes. Storage, again FITC-conjugated anti-mouse IgG or IgM (1:64 or 1: 128; Sigma), anti-chicken IgG (1: 320; Sigma), and anti-rabbit IgG (1:80; Sigma) And stored in an incubator for 1 hour to stain the antibody. Nuclear staining was done at room temperature with DAPI.

As a result of the transplantation experiment, the proliferation and differentiation of the transplanted cells were observed weekly. I could see that. In addition, all cells were positive for β III-tubulin, NF-M, GFAP, and MOSP antibody responses, indicating that the cat's RFP-transformed MSCs were differentiated into neurons, astrosites, and oligodendrosites. . However, the transplanted cells were noticeably reduced after 4 to 5 weeks and all disappeared after 6 weeks (Fig. 22). Migration of transplanted cells after transplantation was also observed between 3 and 4 weeks. Mice in the group treated with the immunosuppressive cyclosporin A did not seem to affect the survival and neuronal differentiation of the transplanted cells. The study focuses on the survival and neuronal differentiation of xenograft cells derived from cats into the rat brain. Survival cells were proliferated between two and three weeks after transplantation and then reduced to 4 weeks. It was easy to distinguish the transplanted cells from other cells or nerves in the brain because they already had a unique fluorescent marker called RFP. The results are likely due to depletion of nutrients at the implanted site and poor vascular tissue. From this, it can be seen that RFC-transformed bone marrow-derived MSCs in cats are differentiated into neurons with survival in the murine striatum region. I think.

[Example 13] Stem cell induction from RFP transgenic cloned cats

The following experiment was conducted to conduct studies on efficient induction and verification of feline embryonic stem cells.

In order to separate and induce fetal embryonic stem cells, the inner cell mass (ICM) was separated from the blastocyst derived from the body by mechanical methods (FIG. 24A, B) and compared with each other in a medium containing FBS and a medium containing KSR. Feeder cells were cat embryonic fibroblast cells (FIG. 23). Results KSR medium showed better results in early embryonic stem cell attachment, but FBS was better in terms of cell proliferation rate. These induced embryonic stem cells had the morphological characteristics of embryonic stem cells with a large nucleus and a small cytoplasm (Fig. 24). Stem cell specific markers such as 3 and SSEA-4 were verified, and the results confirmed that these markers were clearly expressed in undifferentiated pseudo embryonic stem cells (FIG. 25). In order to verify the differentiation capacity of pseudo-embryonic stem cells, EB was first made and morphologically confirmed that EBs were differentiated into pseudo-epithelial cells and neurons by culturing on tissue culture dishes. Two embryonic stem cell colonies cultured in FBS were spontaneously differentiated into cardiomyocytes spontaneously autonomous at the third passage and were also verified by the expression of α-actinin, a cardiomyocyte specific marker. 26). These results suggest that we were the first to successfully isolate and culture cat embryonic stem cells.

Under the premise of successfully inducing fetal embryonic embryonic stem cells, two nucleotide genes, POU5F1 and NANOG, have not been identified in cats. The CDSs (coding sequences) of the cats POU5F1 and NANOG were determined and the orthologous genes were analyzed.The cat POU5F1 gene was 92% and 82% identical to human and mouse at the nucleotide level, respectively. 94% and 83% confirmed the same. In addition, the analysis of POU specificity and POU homeodomain sequences in the CDS of POU5F1 showed that 69% and 68% of human and mouse were the same (Fig. 27) .The cat NANOG gene was found to be human and mouse at the nucleotide level, respectively. 69% and 68% were identical and 69% and 58% were identical at the amino acid level, respectively (Figure 28). In addition, the SMAD4 domain and tryptophan repeat domain (W / QXXXX) were identified in the CDS of NANOG, a homeodomain (FIG. 28). RT-PCR method was used to confirm the expression of POU5F1 and NANOG mRNA in feline embryonic stem cells and embryonic fibroblasts, whereas POU5F1 was highly expressed in feline embryonic stem cells, whereas NANOG was not expressed in embryonic fibroblasts. Stem cells were found to be more expressed in embryonic fibroblasts (FIG. 29). In addition, the expression of the biceps gene was verified by immunostaining. As a result, if fetal embryonic stem cells showed high expression, they were not detected in embryonic fibroblasts (FIG. 30). From these results, it can be seen that the cat embryo-like stem cells have been successfully isolated, and by identifying the nucleotide sequence of the cat gene, it can be used for various studies such as being used in biomarkers for feline stem cell verification in the future.

Therefore, using the embryonic stem cell isolation and culture technology we currently possess, RFP target markers are expressed by separating and culturing embryonic stem cells from blastocysts or cloned blastocysts extracted from the world's first cloned RFP-expressing transgenic cat. The production of embryonic stem cells or specific embryonic stem cells with no immunorejection reaction and applied to preclinical experiments has the advantage of easy tracking of the transplanted cells in the body. In addition, by inducing pluripotent stem cell (ips) technology to derive omnipotent stem cells from RFP transgenic cat somatic cells has the advantage that can be used in preclinical experiments.

The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

1 is a diagram illustrating a manufacturing process of a pLHCRW vector according to the present invention.

2 is a schematic diagram of a series map of a pLHCRW vector for expression of red fluorescent protein (LTR: long terminal repeat, Hyg ^R : hygromycin-resistant gene, CMVp: cytomegalovirus promoter, DsRed2: red fluorescent protein, WPRE: woodchuck hepatitis virus posttranscriptional regulatory element, approximate Southern blotting probe location and PCR primer set for amplification of DsRed2 ( or RFP) gene base sequence.

Figure 3 is a photograph showing the somatic cell nuclear fusion (SCNT) process and RFP expression in feline fibroblasts (a: taken in bright light, semi-confluence cells, b: semi-confluence cells Taken under fluorescence, c: taken under bright light of trypsin-treated cells that emit bright red before SCNT, d: taken under fluorescence of trypsin-treated cells emitting bright red before SCNT, e : Injecting RFP-positive cells into denuclearized eggs under bright light. F: RFP-positing cells into denuclearized eggs under fluorescent light, × 200).

Figure 4 is a PCR and Southern blot analysis of TG cats (I) PCR analysis: pLHCRW plasmid (P), fetal fibroblasts (cell +) genetically modified with LHCRW retroviruses, unmodified cat fibroblasts ( cell-), muscle of non-transgenic cat (NTM), muscle of stillborn TG cat (M), liver (L), kidney (K), brain (B), large intestine (I), heart (H), skin (S), testicles (T); Placenta (PL) of TG constructs, expected size of the amplified RFP gene product (arrow); (II) Southern blot analysis: expected size (arrow) of plasmid DNA (pLHCRW) positive control (P), marker (M), non-TG cat (N) stillborn TG cat (T), RFP gene fragment.

FIG. 5 is a photograph of RFP expression of transgenic cloned cat (left) and control cat (right) at 60 days of age (a: visible photo, a ': fluorescence, red fluorescence at a' is 540 ± 20 nm) (illumination) and the emission filter having the longest transmission of 600 ± 25 nm wavelength).

Figure 6 is a photograph of the body and organs of non-transgenic cats (left) and stillborn transgenic cats (right) under natural light (left photo) and fluorescence (right photo) (a and a ': hair, b). And b ': muscle, c and c': brain, d and d ': heart, e and e': kidney, f and f ': stomach and intestine, g and g': bronchial and lung, h and h ': liver , i and I ': spleen, j and j': tongue, k and k ': feces).

7 is a result of measuring RFP expression on donor cell surface, (A) visible light image, (B) red fluorescence emission of donor cells, (C) Non-RFP TG cat cell line (negative control), (D) First RFP TG cat cell line (donor cells). (E) RFP gene transformed cell line (positive control).

8 shows RFP expression in Re-RFP TG (left) and non-TG control (right) cats. (A) visible light image and (B) fluorescence image

9 shows the results of PCT analysis of Re-RFP TG cats. The genomic DNA used for PCR amplification was isolated from various organs: (a) testes, (b) liver, (c) colon, (d) spleen, (e) kidney, (f) heart, (g) duodenum, ( h) stomach, (i) pancreas, (j) lungs, (k) skin, (l) placenta, (m) non-TG control cat, (n) negative control II: Re-RFP TG cat (Re-TG) , non Re-RFP TG control cat (non Re-TG), and negative control.

10 is a visible and fluorescence image of RFP expression in F-1 cats.

11 is a PCR result showing that the F1 progeny-RFP transformant inherits the RFP trans gene from RFP transgenic male cats (1) to (6) (M) marker, (a) non-TG, (b) negative (c) liver, (d) muscles, (e) brain, (f) large intestine, (g) bladder, (h) spleen, (i) reproductive organs, (j) small intestine, (k) kidney, (l) Heart, (m) stomach, (n) pancreas, (o) liver, (P) skin.

Figure 12 shows the appearance of the proliferation of the retinal precursor cells and the degree of RFP expression as the date after the first isolation culture.

Figure 13 shows the appearance of the brain precursor cells are proliferating and the degree of RFP expression as the date after the first isolation culture.

FIG. 14 is a fluorescence photograph two weeks after transplantation of bone marrow-derived MSCs from RFP-transformed cats into adult rat right striatum. A, general picture. B, transplanted cells in RFP expression. C, III-tubulin positive fluorescence. D, DAPI nuclear staining picture. Composite picture of E, B and C, D

15 is a fluorescence photograph 2 weeks after transplantation of bone marrow-derived MSCs from RFP-transformed cats into adult rat right striatum. A, general picture. B, transplanted cells in RFP expression. C, NF-M positive fluorescence. D, DAPI nuclear staining picture. Composite picture of E, B and C, D.

16 is a fluorescence photograph two weeks after transplantation of bone marrow-derived MSCs from RFP-transformed cats into adult rat right striatum. A, general picture. B, transplanted cells in RFP expression. C, GFAP positive fluorescence. D, DAPI nuclear staining picture. Composite picture of E, B and C, D

FIG. 17 is a fluorescence photograph two weeks after transplantation of bone marrow-derived MSCs from RFP-transformed cats into adult rat right striatum. A, general picture. B, transplanted cells in RFP expression. C, MOSP positive fluorescence. D, DAPI nuclear staining picture. Composite picture of E, B and C, D

FIG. 18 is a fluorescence photograph three weeks after transplantation of bone marrow-derived MSCs from RFP-transformed cats into adult rat right striatum. A, general picture. B, transplanted cells in RFP expression. C, III-tubulin positive fluorescence. D, DAPI nuclear staining picture. Composite picture of E, B and C, D

19 is a fluorescence photograph three weeks after transplantation of bone marrow-derived MSCs from RFP-transformed cats into adult rat right striatum. A, general picture. B, transplanted cells in RFP expression. C, NF-M positive fluorescence. D, DAPI nuclear staining picture. Composite picture of E, B and C, D.

20 is a fluorescence photograph three weeks after transplantation of bone marrow-derived MSCs from RFP-transformed cats into adult rat right striatum. A, general picture. B, transplanted cells in RFP expression. C, GFAP positive fluorescence. D, DAPI nuclear staining picture. Composite picture of E, B and C, D.

21 is a fluorescence photograph three weeks after transplantation of bone marrow-derived MSCs from RFP-transformed cats into adult rat right striatum. A, general picture. B, transplanted cells in RFP expression. C, MOSP positive fluorescence. D, DAPI nuclear staining picture. Composite picture of E, B and C, D.

FIG. 22 is a fluorescence photograph 4, 5, 6 weeks after transplantation of bone marrow-derived MSCs from RFP-transformed cats into adult rat right striatum. A, D, G are regular pictures. B, E, H are transplanted cells in RFP expression. C, F, I DAPI Nuclear Staining Photos

23 are fetal embryonic fibroblasts derived from fetal fetuses (A) Fetuses were obtained from female cats after 4 weeks of gestation (B) and show cEF cell proliferation during incubation (100X).

24 shows pseudoembryonic stem cells derived from blastocysts after growing in the cEF feeder layer. (A) In vivo-produced blastocysts (63X). (B) ICM of blastocyst (100X). (C-F) shows the formation of feline ES-like cell colonies in KSR-medium (C, 100X; D, 200X) or FBS-medium (E, 40X; F, 200X).

25 shows non-differentiation characteristics in three passage ES-like cell colonies. (A) AP expression (100 ×). (D, G, J) Phase contrast images of ES-like cells (B, E, H, K) Images reverse stained with Hoechst33342 (C, F, I, L) Oct-4, SSEA-1, SSEA-3 and Immunofluorescence staining for detection of SSEA-4 expression is shown (100 ×).

26 shows the differentiation of EBs into various cell types. (A) A simple EB (left) and cystic EB (right) (40X). (B) epithelial cell-like cells (100 ×). (C) neuron-like cells (200 ×). (D) Phase contrast images of feline ES-like cells (E and F) after 2 weeks of culture of the same EB (G) inversely stained with Hoechst33342 (blue) and immunostained with desmin, a mesoderm marker. Relative ratio images (40X) of ES-like colonies that spontaneously differentiated into myocardiocytes). (H and I) Same colony (40X) showing reverse staining (blue) with Hoechst33342 and immunofluorescence staining (red) with α-actin.

27 shows amino acid sequence comparisons between cPOU5F1 (GenBank accession no. EU366914), human (GenBank accession no. NM_002701) and mouse (GenBank accession no. NM_013633) homologues. POU-specific and POU homeodomains are indicated in underlined and bold font. Linker regions connecting the two domain regions are underlined.

FIG. 28 shows a comparison of amino acid sequences of cNANOG (GenBank accession no. EU366913), human (GenBank accession no. NM_024865) and mouse (GenBank accession no. NM_028016) homologs. SMAD4 homology domains and homeodomains are underlined and bold and tryptophan (W) repeat domains are boxed. Sequence alignment was performed using Clustal W.

29 shows cPOU5F1 and cNANOG mRNA expression in three passage ES-like cells and fibroblast Peter cells. cPOU5F1, cNANOG and GAPDH expression were measured by RT-PCT. PCT products corresponding to cPOU5F1, cNANOG and GAPDH are 285, 271 and 246 bp, respectively. Li, liver; St, stomach; Sp, spleen; Ov, ovary; Lu, lung; Br, cerebellum; S, cat ES-like cells; F, fibroblast feeder cells; B, blastocyst; N, negative control.

30 shows immunocytochemical results in in vivo-produced cat blastocysts and undifferentiated ES-like cell colonies. A and D, staining nuclei with Hoechst33342 in blastocysts (blue) B and E, POU5F1 and NANOG expression in ICM cells of blastocysts as positive controls; C and F, stained with secondary antibody with negative control; G and J, phase contrast images of ES-like cells; H and K, blue with Hoechst33342; I and L, POU5F1 and NANOG expression in ES-like cells (red). Magnification, 200X.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Transgenic Cats Expressing Red Fluorescence Protein and Producing          Method Thereof <130> 1.63P <150> KR10-2007-0126410 <151> 2007-12-06 <160> 7 <170> Kopatentin 1.71 <210> 1 <211> 812 <212> DNA <213> Artificial Sequence <220> <223> CMV promoter <400> 1 gatccggcca ttagccatat tattcattgg ttatatagca taaatcaata ttggctattg 60 gccattgcat acgttgtatc catatcataa tatgtacatt tatattggct catgtccaac 120 attaccgcca tgttgacatt gattattgac tagttattaa tagtaatcaa ttacggggtc 180 attagttcat agcccatata tggagttccg cgttacataa cttacggtaa atggcccgcc 240 tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg ttcccatagt 300 aacgccaata gggactttcc attgacgtca atgggtggag tatttacggt aaactgccca 360 cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg tcaatgacgg 420 taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc ctacttggca 480 gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa 540 tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa 600 tgggagtttg ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc 660 cccattgacg caaatgggcg gtaggcatgt acggtgggag gtctatataa gcagagctcg 720 tttagtgaac cgtcagatcg cctggagacg ccatccacgc tgttttgacc tccatagaag 780 acaccgggac cgatccagcc tccgcggccc ca 812 <210> 2 <211> 678 <212> DNA <213> Artificial Sequence <220> <223> DsRed2 <400> 2 atggcctcct ccgagaacgt catcaccgag ttcatgcgct tcaaggtgcg catggagggc 60 accgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120 cacaacaccg tgaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180 ctgtcccccc agttccagta cggctccaag gtgtacgtga agcaccccgc cgacatcccc 240 gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300 gacggcggcg tggcgaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360 aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420 atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480 acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540 tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600 atcacctccc acaacgagga ctacaccatc gtggagcagt acgagcgcac cgagggccgc 660 caccacctgt tcctgtaa 678 <210> 3 <211> 591 <212> DNA <213> Woodchuck hepatitis virus <400> 3 atcaacctct ggattacaaa atttgtgaaa gattgactgg tattcttaac tatgttgctc 60 cttttacgct atgtggatac gctgctttaa tgcctttgta tcatgctatt gcttcccgta 120 tggctttcat tttctcctcc ttgtataaat cctggttgct gtctctttat gaggagttgt 180 ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca acccccactg 240 gttggggcat tgccaccacc tgtcagctcc tttccgggac tttcgctttc cccctcccta 300 ttgccacggc ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg gctcggctgt 360 tgggcactga caattccgtg gtgttgtcgg ggaagctgac gtcctttcca tggctgctcg 420 cctgtgttgc cacctggatt ctgcgcggga cgtccttctg ctacgtccct tcggccctca 480 atccagcgga ccttccttcc cgcggcctgc tgccggctct gcggcctctt ccgcgtcttc 540 gccttcgccc tcagacgagt cggatctccc tttgggccgc ctccccgcct g 591 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> upstream primer <400> 4 gttccagtac ggctccaagg tgta 24 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> downstream primer <400> 5 atggtgtagt cctcgttgtg ggag 24 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> upstream primer <400> 6 cgccaccatg gcctcctc 18 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> downstream primer <400> 7 caggaacagg tggtggcg 18  

Claims (11)

(a) isolating somatic cells from the cat; (b) has a cleavage map of FIG. 2 comprising a nucleic acid sequence encoding a red fluorescent protein, a CMV (cytomegalovirus) promoter of SEQ ID NO: 1, a DsRed gene of SEQ ID NO: 2, and a woodchuck hepatitis virus posttranscriptional regulatory WPRE of SEQ ID NO: 3 preparing a pLHCRW vector for expressing a red fluorescent protein comprising an element); (c) transfecting the expression vector pLHCRW into retrovirus packaging cells to obtain and incubate LHCRW virus; (d) infecting the somatic cells isolated in step (a) with the obtained and cultured LHCRW virus, transforming and culturing with a red fluorescent protein; (e) removing the nucleus of the oocytes collected from the cat, and then electro fusion with the somatic cells transformed in step (d) to prepare embryos and activating them with electric current. (f) isolating the transformed embryo with the expression of red fluorescent protein and culturing in blastocyst state; And (g) implanting the transformed blastocyst into the fallopian tube of a surrogate cat to produce a pup; A transgenic cloned cat expressing a red fluorescent protein, which was prepared by the method. 2

A cell isolated from the cloned cat of claim 1. The embryonic stem cell of claim 2, wherein the cell is derived from a blastocyst of a cat. The cell of claim 2, wherein the cell is a retinal progenitor cell, a brain precursor cell or a mesenchymal cell. delete delete delete delete delete delete delete

Images