KR101190078B1 - Recombinant expression vector to produce beta-agarase, transformed microorganisms, and method for producing beta-agarase - Google Patents

Abstract

The present invention is Streptomyces draw three-house (Streptomyces griseus) promoter derived from the trypsin gene (sprT) and Streptomyces series collar (Streptomyces coelicolor ) -derived beta-agarase gene ( dagA ) and capable of transforming prokaryotic type 1 beta-agarase recombinant expression vector and Streptomyces greece ( Streptomyces) griseus ) -derived trypsin gene ( sprT ) promoter, Streptomyces the signal peptide coding region of the griseus derived trypsin gene ( sprT ) and the portion from which the signal peptide coding portion is removed from the beta-agarase gene ( dagA ) derived from Streptomyces coelicolor It relates to a type 2 beta-agarase recombinant expression vector capable of transforming.
When the beta-agarase recombinant expression vector of the present invention is introduced into a heterologous strain, strains that do not produce beta-agarase can produce high-activity beta-agarase with high efficiency, and thus host a more manageable strain. When the recombinant expression vector of the present invention is introduced as a strain, it is possible to economically mass-produce beta-agares, and thus, the mass-produced beta-agares decomposes agar (agar), which is present in nature, to reduce reducing sugar. It can be very useful for energy, medicine and food fields.

Description

Recombinant expression vector to produce beta-agarase, transformed microorganisms, and method for producing beta-agarase}

The present invention relates to a recombinant expression vector for the production of beta-agarez, and more specifically, Streptomyces griseus ( Streptomyces griseus ) the promoter of the trypsin gene ( sprT ) derived from and Streptomyces sirikala (Streptomyces) coelicolor ) derived beta- agarez gene (dagA), and capable of transforming prokaryotes, type 1 beta- agarez recombinant expression vector and Streptomyces griseus (Streptomyces) griseus ) The promoter of the trypsin gene ( sprT ) derived from, Streptomyces griseus (Streptomyces) griseus ) from the signal peptide coding region of the trypsin gene ( sprT ) and the beta-agarez gene (dagA) derived from Streptomyces coelicolor , from which the signal peptide code is removed, and prokaryotes It relates to a type 2 beta-agarez recombinant expression vector capable of transforming.

Agar is composed of agarose and agaropectin. Agarose is a linear structure connected by α-1, 3 bonds by repeating agarobiose, a unit in which D-galactose and 3,6-anhydro-L-galactose are combined in β-1 and 4 forms. While it is composed of and has strong gel power, agaropectin is composed of agarobiose units like agarose, but contains acidic groups such as sulfuric acid groups and has weak gelation power.

Agarose is decomposed into neoagarobiose through neoagarotetraose by beta-agarase acting on the β-1 and 4 bonds, followed by α-1, It is finally decomposed into galactose (D-galactose) and 3,6-anhydro-L-galactose by alpha-agarase, which acts on 3 binding. Among agares that degrade agarose, beta-agarez, which acts on β-1 and 4 bonds, has not yet been able to express enough enzymes at low cost. Therefore, it is very valuable to secure Agarez's genetic resources and develop an expression system.

Actinomycetes, Streptomyces sirikala ( Streptomyces coelicolor ) A3(2) is known to produce extracellular (secreted out of cells) agarez that degrades agar (Stanier et al., 1942, J. Bacteriol.; Hodgson and Chater, 1981, J. Gen. Microbiol .), this agarez is encoded by the dagA gene. In actinomycetes, the dagA gene is the only known beta-agarase gene and has an important position in the study of agarase production in actinomycetes. In particular, Streptomyces sirikala is the most widely used strain for molecular biology studies of actinomyces, and has been published by analyzing the sequence of chromosomal DNA in Sanger Center in England in 2002 (Bantley et al., 2002, Nature).

SprT of Streptomyces griseus is a trypsin protease secreted outside the cell (Chi et al., 2001, J. Microbiol. Biotechnol.; Kato et al., 2005, J. Bacteriol.), currently sold by Sigma under the name Pronase.

The present inventors have Streptomyces (S. griseus ATCC10137) was cloned trypsin gene (sprT) by introducing a different expression strains were successful in the mass expression of the protein trypsin, bar one activity to develop superior strains of recombinant trypsin and the expression (Kim et al., 2008, Kor. J. Microbiol. Biotech.; Oh et al., 2007, FEMS Microbiol. lett.) In addition, sgtR1 and sgtR2 , which are regulatory genes that promote trypsin gene expression, were obtained and expressed simultaneously. It has succeeded in constructing a high-expression vector exclusively for actinomycetes that can increase the enzyme activity by 30 times or more (Korean Patent Registration No. 10-0687884).

Accordingly, the present inventors expected that when applying the agarez gene of Streptomyces sirikala to the expression system of trypsin-degrading enzyme, it would be possible to produce highly active agarez with high efficiency. It was confirmed that agarez can be produced with high efficiency from a heterogeneous strain that cannot produce, and the present invention was completed.

Accordingly, the main object of the present invention is to provide a recombinant expression vector for producing a strain capable of producing agarez by transforming a heterologous strain.

Another object of the present invention is to provide an agarez-producing strain transformed with the recombinant expression vector.

Another object of the present invention is to provide a method for producing agarez by using the agarez-producing strain.

According to one aspect of the present invention, the present invention comprises a promoter of a trypsin gene ( sprT ) derived from Streptomyces griseus and a beta- agarez gene (dagA) derived from Streptomyces coelicolor And, it provides a type 1 beta-agarez recombinant expression vector capable of transforming prokaryotes.

Type 1 beta of the invention on the agar Reds recombinant expression vector preferably further comprises a Streptomyces draw three-house (Streptomyces griseus) derived sgtR1 gene or Streptomyces draw three-house (Streptomyces griseus) derived sgtR2 gene.

In the type 1 beta-agarez recombinant expression vector of the present invention, the recombinant expression vector of the present invention is preferably pWHM3-TpAsm, pWHM3-TpAsmR1, pWHM3-TpAsmR2 and pWHM3-TpAsmR12 disclosed in FIG. 1.

According to another aspect of the present invention, the present invention is Streptomyces griseus ( Streptomyces griseus ) The promoter of the trypsin gene ( sprT ) derived from, Streptomyces griseus (Streptomyces) griseus ) from the signal peptide coding region of the trypsin gene ( sprT ) and the beta-agarez gene (dagA) derived from Streptomyces coelicolor , from which the signal peptide code is removed, and prokaryotes It provides a type 2 beta-agarez recombinant expression vector capable of transforming.

The term "signal peptide" refers to an amino acid sequence that plays an important role in secreting proteins expressed in actinomycetes cells to the outside of the cell through the cell membrane.

In the type 2 beta-agarez recombinant expression vector of the present invention, Streptomyces griseus ( Streptomyces griseus ) derived sgtR1 gene or Streptomyces griseus (Streptomyces griseus ) It is preferable to further include the derived sgtR2 gene.

In the type 2 beta-agarez recombinant expression vector of the present invention, the recombinant expression vector of the present invention is preferably pWHM3-TpsAm, pWHM3-TpsAmR1, pWHM3-TpsAmR2 and pWHM3-TpsAmR12 disclosed in FIG. 2.

According to another aspect of the present invention, the present invention provides Actinomycetes transformed with the recombinant expression vector.

According to another aspect of the present invention, the present invention provides a method for producing beta-agarez, comprising the step of culturing the transformed actinomycetes and obtaining beta-agarez from the culture medium.

The present invention is characterized by expressing agarez of Streptomyces sirikala using an expression system of a trypsin-degrading enzyme of Streptomyces griseus.

The present inventors have succeeded in expression by introducing the trypsin gene into a heterogeneous strain. Therefore, the present inventors decided to apply the trypsin gene expression system to the expression of agarez. For this purpose, promoters and regulators involved in the expression of the agarez gene and the trypsin gene By analyzing the presumed genes sgtR1 and sgtR2 , when introduced into a heterogeneous strain, a recombinant expression vector was designed so that the agarez gene can be efficiently expressed.

Actinomycosis-derived genes are often not expressed in E. coli due to problems such as the high frequency of GC in the gene and the use of rare codons, or form an inactive inclusion body even if expressed in E. coli. Therefore, when expressing foreign proteins in E. coli, specific expression conditions must be established for each protein. However, the gene derived from actinomycetes does not cause a problem of a rare codon even when expressing a heterologous protein having actinomycosis as a host strain, and does not form an inactive protein body. Therefore, it was judged that the dagA gene derived from actinomycetes was easily expressed in actinomycetes.

In order to obtain a protein expressed inside the cell of all microorganisms such as E. coli as well as actinomycetes, it is necessary to recover the cells through centrifugation or membrane filtration, and the steps of crushing the cells. There is a problem that protein denaturation occurs, and the amount of protein finally recovered is small. In addition, it takes a lot of time and requires an enormous cost to be invested. Accordingly, beta-agarez produced by the present invention preferably contains a signal peptide so that it can be secreted outside the cell, and for this purpose, the beta-agarez recombinant expression vector of the present invention was designed to contain a signal peptide coding portion. .

The present inventors succeeded in mass-expressing DagA of Streptomyces sirikala A3(2) using the sprT promoter of Streptomyces griseus using the heterologous strain, Streptomyces libidance TK24 as a host. Among these, when sgtR1 and sgtR2 of Streptomyces griseus were applied, higher efficiency of beta- agarez production could be confirmed.This is because the sprT promoter is transcriptionally activated by the transcriptional regulators sgtR1 and sgtR2 , which is located downstream. is judged to have induced the transcription of dagA, also sprT promoter downstream than when using sprT signal peptide seen to be the more agar Reds production in case of using the signal peptide of dagA dagA signal peptide outside the agar Reds Streptomyces It is judged to be more useful for secretion into rho.

As described above, when the beta-agarez recombinant expression vector of the present invention is introduced into a heterogeneous strain, a strain that cannot produce beta-agarez can produce high-activity beta-agarez with high efficiency, so it will be further covered. When the recombinant expression vector of the present invention is introduced using an easy strain as a host strain, it is possible to economically mass-produce beta-agarez, and thus mass-produced beta-agarez is agar that exists in many natural worlds. It can be very useful in energy, medicine and food fields to obtain reducing sugar by decomposing it.

1 is a genetic map of pWHM3-TpAsm, pWHM3-TpAsmR1, pWHM3-TpAsmR2 and pWHM3-TpAsmR12.
Figure 2 is a genetic map of pWHM3-TpsAm, pWHM3-TpsAmR1, pWHM3-TpsAmR2 and pWHM3-TpsAmR12.
Figure 3 is a photograph of an electrophoresis after the recombinant plasmid was isolated from E. coli into which pGEM-Am was introduced and E. coli into which pGEM-Asm was introduced, treated with the restriction enzyme EcoRI.
Figure 4 is a photograph of an electrophoresis after the recombinant plasmid was isolated from Escherichia coli (a) into which pGEM-sprTp was introduced and Escherichia coli (b) into which pGEM-sprTps was introduced, treated with the restriction enzyme EcoRI, and then.
5 is a photograph of a recombinant plasmid isolated from E. coli into which pGEM-sgtR1R2 was introduced, treated with a restriction enzyme EcoRI, and then subjected to electrophoresis.
Figure 6 is to determine whether sprTp, Asm and sgtR1R2 gene fragments were correctly inserted into pWHM3-TpAsmR12, the recombinant vector was recovered from Escherichia coli into which pWHM3-TpAsmR12 was introduced as a template, and primers specific for each gene fragment were used. This is a photo after PCR amplification and electrophoresis.
Figure 7 is to determine whether sprTps, Am and sgtR1R2 gene fragments were correctly inserted into pWHM3-TpsAmR12, the recombinant vector was recovered from E. coli into which pWHM3-TpsAmR12 was introduced as a template, and primers specific for each gene fragment were used. This is a photo after PCR amplification and electrophoresis.
Figure 8 is a graph showing the growth curves of the pWHM3-TpAsmR12 actinomycetes transformant, pWHM3-TpsAmR12 actinomycetes transformant and pWHM3 actinomycetes transformant used as a control.
Figure 9 is a graph showing the agarase activity of the pWHM3-TpAsmR12 actinomycetes transformant, pWHM3-TpsAmR12 actinomycetes transformant and pWHM3 actinomycetes transformant culture medium used as a control.
Fig. 10 is a photograph of an electrophoresis in SDS polyacrylamide gel by concentrating beta-agarez protein (DagA) from the culture medium of the pWHM3-TpAsmR12 actinomycetes transformant, pWHM3-TpsAmR12 actinomycetes transformant and the pWHM3 actinomycetes transformant used as a control. to be.

Hereinafter, the present invention will be described in more detail through examples. Since these examples are for illustrative purposes only, the scope of the present invention is not to be construed as being limited by these examples.

Example One. Agarez ( Agarase ) Coding gene ( dagA ) Secured

Streptomyces sirikala (Streptomyces coelicolor ) from A3(2) beta- agarez gene (dagA) (SEQ ID NO: 1) and a gene fragment from which the signal peptide code portion of beta-agarez was removed (only the mature form of DagA was coded) (SEQ ID NO: 2) was obtained. . This process will be described in detail as follows.

Agarase-producing strain, Streptomyces sirikala ( Streptomyces) coelicolor) A3(2) ATCC (American Type Culture Collection) BAA-471 was cultured in R2YE medium (Kieser et al., Practical Streptomyces genetics, A laboratory manual, 2000; John Innes Foundation, Norwich, United Kingdom), and Keizer et al. Chromosomal DNA was purely isolated according to the method of (Kieser et al., Practical Streptomyces genetics, A laboratory manual, 2000). Two types of dagA gene fragments (fragment-i and fragment-ii) were amplified through polymerase chain reaction (PCR) using the isolated chromosomal DNA as a template, and electrophoresed on a 1% agarose gel. .

(Fragment-i) PCR was performed using the following Am-F and Am-R primers to obtain a gene fragment (Am) encoding only the mature form of DagA.

Am-F: 5'- GCCATATGCGCAGACCTCGAATGGGAA -3' (SEQ ID NO: 3, 27mer)

Am-R: 5'- CGTATCAGGCCGTGTAGGCATGCACC -3' (SEQ ID NO: 4, 26mer)

(Fragment-ii) PCR was performed using the following Asm-F and Am-R primers to obtain a gene fragment (Asm) encoding the entire ORF (Open Reading Frame) of DagA.

Asm-F: 5'- GACATATGGTGGTCAACCGACGTGATC -3' (SEQ ID NO: 5, 27mer)

Am-R: 5'- CGTATCAGGCCGTGTAGGCATGCACC -3' (SEQ ID NO: 4, 26mer)

The amplified gene fragment was recovered using a Gel Extraction kit ( Dynebio), cloned into pGEM-T easy vector (Promega), and transformed into E. coli DH5aF'.

3 is an example of separating the recombinant plasmid from the transformed E. coli, cutting for 1 hour at 37°C with the restriction enzyme EcoRI, and then performing electrophoresis on a 1% agarose gel to confirm whether the amplified gene fragment was inserted. The vector into which fragment-i was inserted was named pGEM-Am, and the vector into which fragment-ii was inserted was named pGEM-Asm.

Example 2. Trypsin gene ( sprT ) Of the promoter and Signal Of the signal peptide secure

From Streptomyces griseus , a DNA fragment of a promoter (SEQ ID NO: 6) of the trypsin gene ( sprT ) and a portion encoding the signal peptide of the promoter and sprT (SEQ ID NO: 7) was obtained. This process will be described in detail as follows.

Streptomyces Grisseus griseus ) ATCC 31031 was cultured in R2YE medium (Kieser et al., Practical Streptomyces genetics, A laboratory manual, 2000; John Innes Foundation, Norwich, United Kingdom), and the method of Keizer et al. (Kieser et al., Practical Streptomyces genetics, A laboratory manual, 2000; John Innes Foundation, Norwich, United Kingdom). A laboratory manual, 2000), and chromosomal DNA was purely isolated.

(i) Streptomyces so by performing a PCR to sprTp-F and sprTp-R primer below from chromosomal DNA of the three mouse it was amplified a DNA fragment (sprTp) containing only the promoter of sprT, this in pGEM-T easy vector By cloning, a pGEM-sprTp recombinant vector was prepared, and transformed into E. coli.

sprTp-F: 5'- GGGGAATTCGGCCCGCCCCCTCTGCC -3' (SEQ ID NO: 8, 26mer)

sprTp-R: 5'- CTTCACCATATGCCTTCTTTCGTGGGGG -3' (SEQ ID NO: 9, 28mer)

(ii) In order to obtain a DNA fragment (sprTps) from the promoter of sprT to the signal peptide, amplification by PCR with the following sprTps-F and sprTps-R primers from the chromosomal DNA of Streptomyces griseus The resulting fragment was recovered after electrophoresis, and cloned into pGEM-T easy vector to produce a pGEM-sprTps recombinant vector, which was transformed into E. coli.

sprTps-F: 5'- GGGGAATTCGGCCCGCCCCCTCTGCC -3' (SEQ ID NO: 10, 26mer)

sprTps-R: 5'- GTTCCGCATATGACGGGGTTGGGGGCG -3' (SEQ ID NO: 11, 27mer)

Figure 4 (a) is an example confirmed by recovering the recombinant vector from the E. coli transformant produced in (i), treated with the restriction enzyme EcoRI, and then subjected to electrophoresis on a 1.5% agarose gel.

Figure 4 (b) is an example of recovering the recombinant vector from the E. coli transformant produced in (ii), treated with the restriction enzyme EcoRI, and then subjected to electrophoresis on a 1.5% agarose gel.

Example 3. sprT Genetic Transcriptional regulator sgtR1 and sgtR2 Securing of

A gene fragment (SEQ ID NO: 12) containing sgtR1 and sgtR2 was obtained from Streptomyces griseus. This process will be described in detail as follows.

Purely isolated to amplify the sgtR1 and sgtR2 coding genes (sgtR1R2) Streptomyces Grisseus griseus ) From ATCC 31031 chromosomal DNA, amplified by PCR reaction using the following R1R2-F and R1R2-R primers, and then inserted into pGEM-T easy vector to construct a pGEM-sgtR1R2 recombinant vector, which was transformed into E. coli.

R1R2-F: 5'- CCCGCATGCTCTGACGGCACGTACCG -3' (SEQ ID NO: 13, 26mer)

R1R2-R: 5'- GGTGGAGCAGGGGTCGAAGCTTGAGG -3' (SEQ ID NO: 14, 26mer)

5 is an example of recovering the recombinant vector from the prepared E. coli transformant, treating it with the restriction enzyme EcoRI, and then performing electrophoresis on a 1% agarose gel.

※ Five kinds of PCR reaction conditions used in Examples 1 to 3 above were denatured at 94°C for 5 minutes using a DNA polymerase (ExTaq polymerase, Takara), and a. 30 seconds at 95℃, b. 30 seconds at 63℃, c. The process of polymerization reaction at 72°C for 1 minute (A to C) was repeated 30 times, and finally polymerization was performed at 72°C for 10 minutes. In addition, after analyzing the nucleotide sequence of the gene fragment inserted into the vector prepared in Examples 1 to 3 to check whether there was a PCR error (PCR error), it was used only when there was no PCR error.

Example 4. pWHM3 - TpAsmR12 Construction of recombinant expression vector

(i) The dagA gene fragment (Asm) was recovered from the pGEM-Asm vector of Example 1 by electrophoresis on a 1% agarose gel after reacting for 1 hour at 37° C. using restriction enzymes NdeI and SphI.

(ii) sprT promoter gene fragment (sprTp) was recovered after treating pGEM-sprTp of Example 2-(i) with restriction enzymes EcoRI and NdeI, electrophoresis on 1.5% agarose gel.

(iii) The fragment (sgtR1R2) containing the sgtR1 and sgtR2 genes, the active transcriptional regulators of the sprT promoter, was treated with pGEM-sgtR1R2 prepared in Example 3 with restriction enzymes SphI and HindIII, followed by electrophoresis on a 1% agarose gel. And recovered.

(iv) Actinomycetes-Escherichia coli shuttle vector pWHM3 was treated with restriction enzymes EcoRI and HindIII at 37° C. for 1 hour, and then recovered by electrophoresis on 1% agarose gel.

The gene fragments recovered in (i), (ii), (iii) and (iv) were treated with T4 DNA ligase at 16° C. for 6 hours or more to prepare a pWHM3-TpAsmR12 recombinant expression vector (Fig. 1 Reference), was transformed into E. coli.

Figure 6 is to determine whether sprTp, Asm, and sgtR1R2 gene fragments were correctly inserted into the prepared recombinant expression vector, the recombinant vector was recovered from the prepared E. coli transformant and used as a template, and specific primers were used for each gene fragment. This is an example of PCR amplification and confirmation.

The actinomycetes expression vector pWHM3 (TaKaRa Shuzo Co., Japan) (JESUS VARA et al., Journal of Bacteriology, 1989, 171, 5872-5881p) used in the present invention is an E. It is a useful vector that can perform genetic manipulation in Escherichia coli instead of genetic manipulation of, and is a high-performance actinomycosis vector that maintains more than 100 copies of chromosomal DNA in actinomycetes cells.

Example 5. pWHM3 - TpsAmR12 Construction of fusion expression vector

(i) The pGEM-Am prepared in Example 1 was treated with restriction enzymes NdeI and SphI, and then subjected to electrophoresis on a 1% agarose gel to recover a gene fragment (Am) encoding only the mature form of DagA.

(ii) The pGEM-sprTps prepared in Example 2-(ii) was treated with restriction enzymes EcoRI and NdeI, and then electrophoresed on a 1.5% agarose gel to recover a fragment (sprTps) containing the sprT promoter and signal peptide. .

The gene fragments recovered in (i) and (ii), the gene fragment of Example 4-(iii), and the pWHM3 vector prepared in Example 4-(iv) were used with T4 DNA ligase at 16° C. 6 The pWHM3-TpsAmR12 recombinant expression vector was prepared by processing for more than an hour (see Fig. 2), and transformed into E. coli.

Figure 7 is to determine whether sprTps, Am, and sgtR1R2 gene fragments are correctly inserted into the constructed recombinant expression vector, the recombinant vector is recovered from the constructed E. coli transformant as a template, and specific primers are used for each gene fragment. This is an example of PCR amplification and confirmation.

Example 6. Production of Actinomycetes transformant introduced with recombinant vector

In order to transform the Streptomyces recombinant expression vectors agar Reds non-producing strain of actinomycete Streptomyces Libby thiooxidans (Streptomyces lividans) TK64 ATCC 69441 R2YE liquid medium of the strain 100㎖ (Kieser et al., Practical Streptomyces genetics, A laboratory manual, 2000, John Innes Foundation, Norwich, United Kingdom) the flask (baffled flask containing 500㎖ chopping peuldeu) After shaking culture for 3 days at, 50 ml of aliquots were aliquoted into a centrifuge tube, centrifuged at 2,800 rpm for 10 minutes, and the cells were immersed. The precipitated cells were suspended in 40 ml of phosphate buffer (Kieser et al., Practical Streptomyces genetics, A laboratory manual, 2000, John Innes Foundation, Norwich, United Kingdom) and centrifuged at 2,800 rpm for 10 minutes to recover the cells. . A solution of 40 mg of lysozyme (Sigma-Aldrich) dissolved in 20 ml of phosphate buffer was filtered through a 0.22 μm injection filter, and then the cells were resuspended and reacted at 30° C. for 40 minutes. It was shaken 3 to 4 times to mix. The solution was passed through a filter made of cotton to collect the cells, and then centrifuged at 2,800 rpm to remove the supernatant. In order to remove the lysozyme remaining on the surface of the cells, 10 ml of phosphate buffer was added and suspended, then centrifuged at 2,800 rpm to recover only the cells, and then carefully suspended in 10 ml of phosphate buffer. The suspended cells were dispensed into a 1 ml tube by 60 µl and stored at -80°C for use.

After dissolving the protoplasts stored at -80°C, add the pWHM3 vector to be used as a control, the pWHM3-TpAsmR12 recombinant expression vector prepared in Example 4, and the pWHM3-TpsAmR12 recombinant expression vector prepared in Example 5, respectively, and mix well and mix with polyethylene. After adding 200 µl of a glycol (polyethylene glycol, molecular weight 1000) solution and mixing well, it was carefully spread on R2YE solid medium and incubated at 30°C. After 12 hours, 1 ml of the antibiotic thiostrepton (Sigma-Aldrich, Inc.) at a concentration of 50 µg/µl was overlaid and incubated at 30° C. for 3 days.

After 3 days elapsed, 10 colonies were passaged in a new R2YE solid medium and cultured for 3 days, and then each colony was inoculated in 20 ml of R2YE liquid medium, cultured with shaking, and centrifuged, and only the cells were recovered. Plasmid DNA was recovered from the recovered cells and then subjected to electrophoresis on a 1% agarose gel to confirm the transformation.

Example 7. Analysis of Actinomycetes transformants

(i) After inoculation of the actinomycetes transformant in a solid medium of minimal medium (Kieser et al., Practical Streptomyces genetics, A laboratory manual, 2000, John Innes Foundation, Norwich, United Kingdom), incubation at 30°C for 5 days. Agarez production was measured separately. The minimum medium used in this study was prepared so that only 2% of agar, which was added during the manufacture of the solid medium, was used as the carbon source by removing the carbon source from the composition of the minimum medium such as Kizer. The R2YE solid medium inoculated and cultured with transformants was stained with Lugol's Iodine solution, and destained with 70% ethanol solution to confirm that the agar around the colony was degraded (Widdick et al. ., 2006, Proc. Natl. Acad. Sci. USA).

As a result, agarase activity was confirmed in both the transformant into which pWHM3-TpAsmR12 was introduced and the transformant into which pWHM3-TpsAmR12 was introduced, and no agarase activity was confirmed in the transformant into which the pWHM3 vector used as a control was introduced. In particular, strong agarase activity was confirmed in the transformant into which pWHM3-TpAsmR12 was introduced.

(ii) The actinomycetes transformant was cultured in 200 ml of liquid medium containing 0.5% agar in the minimum medium from which the carbon source used in (i) was removed for 7 days while collecting and centrifuging 10 ml every day, The cells were used to draw a growth curve by measuring the amount of cells, and the supernatant from which the cells were removed was used to measure the activity of agarez.

There was no significant difference in the growth curves of the three types of actinomycetes transformants, and it was confirmed that all three strains passed the exponential phase on the 2-3rd day of culture and reached a stationary phase on the 4th day (FIG. 8). Reference).

As a result of measuring agarez activity from the culture medium of each actinomycetes transformant, agarase activity was confirmed in both the transformant into which pWHM3-TpAsmR12 was introduced and the transformant into which pWHM3-TpsAmR12 was introduced, and the pWHM3 vector used as a control Almost no agarase activity was observed in the transformant into which was introduced, and in particular, strong agarase activity was observed in the transformant into which pWHM3-TpAsmR12 was introduced (see FIG. 9). At this time, the weak agarase activity in the transformant into which the pWHM3 vector used as a control was introduced is considered to be an error caused by the weak agarase enzyme activity inherent in the Streptomyces lividans strain.

The agarez activity is measured by measuring the reducing sugar reduced by agarez from agarose using dinitrosalicylic acid (Zhang et al., 2007, Appl. Envrion. Micrbiol.) Confirmed. To 3.9 ml of a phosphate buffer in which agarose is dissolved at a concentration of 0.2%, 100 μl of the transformed actinomycetes culture solution each of the three vectors (pWHM3, pWHM3-TpAsmR12, pWHM3-TpsAmR12) was added and reacted at 40°C for 30 minutes , 4 ml of dinitrosalicylic acid solution was added, mixed well, boiled for 10 minutes, cooled immediately on ice, and the concentration of reducing sugar was measured at 540 nm.

(iii) Add 100 µl of a 100% trichloroacetic acid solution to 1 ml of the culture solution of each transformant from which the cells have been removed, mix, soak in ice for 30 minutes, and then centrifuge at 15,000 rpm for 10 minutes. Was discarded and only a protein pellet was obtained. To the protein pellet, 700 μl of a solution in which ethanol and ether were mixed at the same concentration was added, followed by centrifugation at 15,000 rpm for 5 minutes to wash, leaving the protein pellet and removing the supernatant. After drying at room temperature so that the ethanol and ether solutions were completely removed, they were suspended in a phosphate buffer solution. To see the expression pattern of agarez, the concentrated proteins were confirmed by electrophoresis on SDS (sodium dodecyl sulfate)-10% polyacrylamide gel.

As a result, the protein band was not identified in the transformant into which the pWHM3 vector was introduced, whereas in the transformant into which pWHM3-TpAsmR12 was introduced and the transformant into which pWHM3-TpsAmR12 was introduced, a DagA protein band of about 32 KDa was confirmed. -It was confirmed that the expression amount of DagA protein in the strain into which TpAsmR12 was introduced is higher than that in the strain into which pWHM3-TpsAmR12 was introduced (see FIG. 10).

Prediction example One.

It is assumed that sgtR1 and sgtR2 act on the sprT promoter to regulate transcription, so when sgtR1 and sgtR2 are included in the beta-agarez recombinant expression vector of the present invention, the highest beta-agarez production effect is expected, Even if sgtR1 or sgtR2 does not work, since the sprT promoter can independently proceed with transcription (Korean Patent Registration No. 10-0687884), pWHM3-TpAsm, pWHM3-TpAsmR1, pWHM3-TpAsmR2 disclosed in FIG. 1 and disclosed in FIG. After constructing pWHM3-TpsAm, pWHM3-TpsAmR1, pWHM3-TpsAmR2 recombinant expression vectors and introducing them into the Streptomyces dependency used as the host strain, transformants are produced, these transformants also exhibit agarez activity. It is expected to be.

Attach electronic file of sequence list

Claims (5)

A DNA fragment represented by a nucleotide sequence of SEQ ID NO: 7 including a promoter of a streptomyces griseus- derived trypsin gene ( sprT ) and a signal peptide coding region; And
A beta that is capable of transforming prokaryotes, including; a DNA fragment represented by the nucleotide sequence of SEQ ID NO: 2 from which a signal peptide code part is removed from Streptomyces coelicolor- derived beta-agarase gene ( dagA ) Agarez recombinant expression vector. The method of claim 1,
A beta-agarase recombinant expression vector, further comprising a DNA fragment represented by the nucleotide sequence of SEQ ID NO: 12 comprising a sgtR1 gene and a sgtR2 gene derived from Streptomyces griseus . The method of claim 1,
The beta-agarase recombinant expression vector is a beta-agarase recombinant expression vector, characterized in that selected from pWHM3-TpsAm, pWHM3-TpsAmR1, pWHM3-TpsAmR2 and pWHM3-TpsAmR12. Actinomycetes transformed with the recombinant expression vector of any one of claims 1 to 3. A method for producing beta-agarase, comprising culturing the transformed actinomycetes of claim 4 and obtaining beta-agarase from the culture solution.

Images