KR101152878B1 - Method for production of gdp-l-fucose by overexpression of glucose-6-phosphate dehydrogenase and guanosine-inosine kinase in recombinant escherichia coli - Google Patents

Abstract

In addition to overexpression of related enzymes that mediate the synthetic pathway of GDP-fucose, the present invention is directed to recombinant E. coli recombinantly overexpressing glucose-6-phosphate-dehydrogenase or / and guanosine-inosine kinase. On how to produce GDP-fucose
Using a recombinant E. coli co-expressing glucose-6-phosphate dehydrogenase (G6PDH) and ManB, ManC, Gmd and WcaG, a representative NADPH reproductive enzyme present in E. coli, pH-stat fed-batch culture produced up to 235.2 ± 3.3 mg / L of GDP-fucose, a 21% improvement over recombinant E. coli without G6PDH.
In addition, using recombinant E. coli additionally expressing guanosine-inosine kinase (Gsk), GDP-fucose of up to 305.5 ± 5.3 mg / L was produced in a fed-batch culture of pH-stat method. This is a 58% improvement over recombinant E. coli without further expression of Gsk.

Description

Method for production of GDP-L-fucose by overexpression of glucose-6-phosphate dehydrogenase and guanosine-inosine kinase in recombinant Escherichia coli}

The present invention relates to a method for producing GDP-fucose in Escherichia coli, and more particularly, in addition to overexpression of a related enzyme that mediates the synthesis pathway of GDP-fucose, glucose-6-phosphate-dehydrogenase or / And a method for producing GDP-fucose using E. coli recombined to specifically overexpress by adding guanosine-inosine kinase.

There is a growing global awareness of the technical and economic value of functional sugars, especially the study of the physiological activity of medicinal sugars present in human milk or colostrum and its medicinal use. The trend is.

Human milk contains lactose (lactose), glucose (glucose), galactose (galactose), N - acetyl glucosamine (N -acetylglucosamine), fucose (fucose), sialic acid (sialic acid) or more than about 120 made in the vertical functional saccharide conjugate Recently, due to various functional and physiologically active characteristics of functional sugars of breast milk, studies are being actively conducted to produce such functional sugars and their precursors through biotechnological methods.

Functions of breast milk sugar complexes include inhibiting infection of pathogenic microorganisms, promoting the reaction of the immune system, and promoting the activity of lactic acid bacteria such as Bifidobacteria. Among the sugars present in breast milk, fucose is a precursor. Fucosyloligosaccharide is known as an important substance having the function of conferring resistance to various pathogenic microorganisms that cause the formation and diarrhea of specific antibodies in the early developmental stage of the infant.

Meanwhile, guanosine diphosphate L-fucose (hereinafter referred to as 'GDP-L-fucose' in English and 'GDP-fucose' in Korean) is a variety of fucosyltransfers. It is a nucleic acid-containing sugar that is used as a donor of sugar transfer reaction mediated by fucosyltransferase, and has a high industrial value as an essential material in the production of fucosyl sugar by metabolic or enzymatic techniques.

Therefore, there have been many efforts to economically produce GDP-fucose. For example, a chemical synthesis method (Carbohyd. Res., 242: 69 (1993)) is known, which suffers from problems of stereoselectivity and supply of substrates.

Also known are methods of producing GDP-fucose using enzymes (Agric. Biol. Chem., 48: 823 (1984), WO 93/08205, and WO 99/09180), which are expensive. Since phosphorus enzyme is used as a raw material, there is a problem that is not economical.

In addition, a method for producing GDP-fucose using recombinant microorganisms, for example, Escherichia coli, has been disclosed (Korean Patent Publication No. 2001-0050030, published June 15, 2001). There is still a lot of room for improvement in productivity and yield.

Accordingly, an object of the present invention is to develop and provide a method for producing GDP-fucose with high productivity and high yield through re-interpreting the synthetic route of GDP-fucose in E. coli.

In order to achieve the above object, the present invention, in the method for producing GDP-fucose by culturing E. coli, E. coli, GDP-D- mannose-4,6-dehydratase, GDP-4-keto- Recombinant 6-deoxymannose 3,5-epimerase-4-reductase, phosphomannomutase, mannose-1-phosphate guanyltransferase and glucose-6-phosphate-dehydrogenase It provides a production method of GDP-fucose characterized in that using the E. coli.

In addition, the present invention provides a method for producing GDP-fucose by culturing E. coli, wherein E. coli, GDP-D-mannose-4,6-dehydratase, GDP-4-keto-6-deoxy Characterized by using E. coli recombined to overexpress mannose 3,5-epimerase-4-reductase, phosphomannomutase, mannose-1-phosphate guanyltransferase and guanosine-inosine kinase It provides a method of producing GDP-fucose.

In addition, the present invention is a method for producing GDP-fucose by culturing E. coli, E. coli, GDP-D-mannose-4,6-dehydratase, GDP-4-keto-6-deoxymannose To overexpress 3,5-epimerase-4-reductase, phosphomannomutase, mannose-1-phosphate guanyltransferase, glucose-6-phosphate-dehydrogenase and guanosine-inosine kinase It provides a method for producing GDP-fucose characterized in that using the recombinant Escherichia coli.

On the other hand, in the GDP-fucose production method of the present invention, overexpression of the related enzyme is preferably controlled by an induction promoter. The regulation of overexpression by the induction promoter initiates the overexpression of the enzyme by the addition of an inducer, which is characterized in that the time of expression can be appropriately controlled in culture.

On the other hand, in the GDP-fucose production method of the present invention, the culture is preferably a fed-batch culture of pH-stat method. At this time, more preferably fed-batch culture of pH-stat method is to supply a limited supply of glucose while maintaining the pH of the culture medium. The pH-stat is to supply glucose automatically when the pH of the fermentation tank is higher than the preset value, and can supply glucose more smoothly than the fed-batch culture of glucose limited feeding, which fixes the glucose infusion rate. There is an advantage.

PH-stat method by using recombinant E. coli co-expressing G-6PDH and G-6PDH, a representative NADPH reproductive enzyme present in E. coli The fed-batch culture produced up to 235.2 ± 3.3 mg / L of GDP-fucose, a 21% improvement over recombinant E. coli without G6PDH.

In addition, using recombinant Escherichia coli further expressing guanosine-inosine kinase (Gsk), GDP-fucose of up to 305.5 ± 5.3 mg / L was produced in a fed-batch culture of pH-stat method. This is a 58% improvement over recombinant E. coli without further expression of Gsk.

Figure 1 shows the biosynthetic pathway of GDP-L-fucose in E. coli.
2 shows an overview of the carbon metabolism pathway of E. coli and enzymes involved in NADPH reproduction.
Figure 3 shows the biosynthetic pathway of GDP-L-fucose and guanosine nucleotide in Escherichia coli.
4 shows the plasmids used in this experiment.
5 is a GDP- fucose E. coli strains expressing biosynthetic enzyme (E. Coli) BL21 star ( DE3) / a fed-batch culture results in a pH- stat method pmBCGW. Dry cell mass (●), glucose concentration (□), acetic acid concentration (■), GDP-fucose concentration (▲), and expression of GDP-fucose biosynthetic enzyme by IPTG addition (arrow).
6 is a GDP- fucose biosynthesis enzymes and E. coli strains that co-expression of G6PDH (E. Coli) BL21 star (DE3) / pmBCGW + is a fed-batch culture results in a pH- stat method pMWzwf. Dry cell mass (●), glucose concentration (□), acetic acid concentration (■), GDP-fucose concentration (▲), and expression of GDP-fucose biosynthetic enzyme by IPTG addition (arrow).
7 is a GDP- fucose biosynthesis enzymes and GuaA and E. coli strains that co-express the GuaB (. E coli) BL21 star (DE3) / pmBCGW + is a fed-batch culture results in a pH- stat method pHguaBA. Dry cell mass (●), glucose concentration (□), acetic acid concentration (■), GDP-fucose concentration (▲) and expression of GDP-fucose biosynthetic enzyme by IPTG addition (arrow).
8 is a GDP- fucose biosynthesis enzymes and E. coli strains that co-express the GuaC (E. Coli) BL21 star (DE3) / pmBCGW + is a fed-batch culture results in a pH- stat method pHguaC. Dry cell mass (●), glucose concentration (□), acetic acid concentration (■), GDP-fucose concentration (▲), and expression of GDP-fucose biosynthetic enzyme by IPTG addition (arrow).
9 is a GDP- fucose biosynthesis enzymes and E. coli strains that co-express the Gsk (E. Coli) BL21 star (DE3) / pmBCGW + is a fed-batch culture results in a pH- stat method pHgsk. Dry cell mass (●), glucose concentration (□), acetic acid concentration (■), GDP-fucose concentration (▲), and expression of GDP-fucose biosynthetic enzyme by IPTG addition (arrow).
10 shows the results of analysis of guanosine nucleotide concentration in cells of recombinant E. coli. (a) E. coli BL21 star (DE3) / pACYCDuet-1, (b) E. coli BL21 star (DE3) / pHgsk.
Figure 11 is a summary of fed-batch culture results by the pH-stat method of the control and experimental groups performed in Examples 1 and 2 of the present invention.

Hereinafter, the content of the present invention will be described in more detail below. However, the scope of the present invention is not limited only to the following examples, but includes modifications of equivalent technical ideas.

As shown in FIG. 1, GDP-D-mannose is derived from glucose by fructose-6-phosphate, mannose-6-phosphate and mannose-6-phosphate. It is produced through -1-phosphate (mannose-1-phosphate), and the enzyme that catalyzes the mannose-6-phosphate isomerase (ManA), phosphomannomutase (ManB) ) And mannose-1-phosphate guanyltransferase (ManC).

The resulting GDP-D-mannose was GDP-4-keto using co-enzyme of GDP-D-mannose-4,6-dehydratase (GDP) and NADPH. GDP-fucose by 6-6-deoxymannose-3,5-epimerase-4-reductase (GDP-4-keto-6-deoxymannose-3,5-epimerase-4-reductase; WcaG) Final conversion.

Thus, as an important factor in GDP-fucose production, ' de The efficient supply of GDP-D-mannose, which is used as a substrate for the novo GDP-L-fucose biosynthetic pathway, the smooth reproduction of NADPH and the sufficient supply of GTP may be considered first.

In the present invention, co-expression of glucose-6-phosphate (G6PDH; gene name ' zw f'), which is a representative NADPH reproductive enzyme in Escherichia coli, improves NADPH reproduction performance and guanosine nucleotides. By adjusting the biosynthetic pathway of guanosine nucleotides, we tried to improve the production of GDP-fucose by increasing the concentration of guanosine nucleotides such as GTP, GMP and GDP.

On the other hand, the expression system of the enzyme related to the present invention used in Example 1 and Example 2 was constructed as follows.

Phosphomannomutase (ManB) from Escherichia coli K-12, mannose-1-phosphate guanyltransferase (ManC), GDP-D-mannose-4,6-dehydrata ManB , manC , g md , the genes encoding Aze (Gmd) and GDP-4-keto-6-deoxymannose-3,5-epimerase-4-reductase (WcaG), respectively And obtaining the genetic information of the wcaG using a database (GeneBanK, Blast, SGD), etc., which was obtained by PCR for the gene and other genetic engineering techniques using the appropriate primers (Table 1).

In addition, glucose-6-phosphate derived from Escherichia coli K-12 (hereinafter referred to as 'G6PDH'. However, the gene name is referred to as ' zwf ' below), inosine 5'-monophosphate dehydrogenase (inosine 5'-monophosphate (IMP) dehydrogenase (hereinafter referred to as 'GuaB'), guanosine 5'-monophosphate (GMP) synthetase (hereinafter referred to as 'GuaA'), GMP li reductase kinase (GMP reductase, hereinafter 'GuaC' termed) and a guanosine-inosine kinase (guanosine-inosine kinase, or less 'Gsk' termed) of the zwf, guaB, guaA, gua C gene coding for each And Genetic information of gsk was obtained using a database (GeneBanK, Blast, SGD), etc., and genes were obtained through PCR and other genetic engineering techniques using appropriate primers (Table 1).

The primers used in the experiment were as follows.

Primer sequences designed for expression of GDP-fucose, NADPH and guanosine nucleotide biosynthesis related enzymes PCR primer Sequence (5 '-> 3') Remarks manC_F ( Nco I) ACATGCCATGGATGGCGCAGTCGAAACTCTAT manC and manB are PCRs together because they exist side by side as a cluster manB_R ( Eco RI) ACCGGAATTCTTACTCGTTCAGCAACGTCAG zwf_F ( Nco I) CATGCCATGGCGGTAACGCAAACAGC zwf_R ( Eco RI) ACCGGAATTCTTACTCAAACTCATTCCAGGAAC guaBA_F ( Nde I) GGAATTCCATATGCTACGTATCGCTAAAGAA guaB and guaA PCR with the search because it exists side by side with Kloster (cluster) guaBA_R ( Xho I) CCGCTCGAGTCATTCCCACTCAATGGTAGC guaC_F ACATGCCATGGGCATGCGTATTGAAGAAGATCTG guaC_R ( Sac I) AAAACTGCAGTTACAGGTTGTTGAAGATGCG gsk_F ( Nco I) ACATGCCATGGGCATGAAATTTCCCGGTAAACGT gsk_R ( Sac I) AAAACTGCAGTTAACGATCCCAGTAAGACTC

Subsequently, expression genes were prepared by inserting respective genes into pETDuet-1 and pACYCDuet-1 (Invitrogen), which are plasmids in which protein expression is induced by the T7 promoter. Expression plasmids were transformed into E. coli BL21 star (DE3) [F- omp T hsd S _B (r _B m _B ) gal dcm rne131 (DE3)] strains according to the Sambrook's method. A strain for producing fucose was constructed. Strains and plasmids used in the experiment are summarized in Table 2 and FIG.

Plasmids designed for expression of GDP-fucose, NADPH and guanosine nucleotide biosynthesis-related enzymes and for production of GDP-fucose gene Remarks pETDuet-1 - 2 T7 promoters and MCS, pBR322 replicon, Amp ^r pACYCDuet-1 - 2 T7 promoters and MCS, p15A replicon, Cm ^r pmBCGW manB , manC , gmd , wcaG pETDuet-1 + gmd - wcaG ( Nde I / Xho I) + manB - manC ( Nco I / Sac I) pMWzwf zwf pACYCDuet-1 + zwf ( Nco I / Eco RI) pHguaBA guaA , guaB pACYCDuet-1 + guaA - guaB ( Nde I / Xho I) pHguaC guaC pACYCDuet-1 + guaC ( Nco I / Sac I) pHgsk gsk pACYCDuet-1 + gsk ( Nco I / Sac I)

Meanwhile, in the present invention, batch cultures (spawn culture and preculture) and fed-batch culture (main culture) were performed in Examples 1 and 2 below as E. coli cultures.

Batch culture for seed culture and preculture was performed using Luria-Bertani (LB) medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) to obtain plasmid DNA, and pure culture. Appropriate antibiotics were used to do this. Cell culture was performed in a 500 mL flask containing 200 mL of LB medium at a culture temperature of 25 ° C. and a stirring speed of 250 rpm.

The fed-batch culture for the main culture is a restriction medium containing 20 g / L of glucose for high concentration cell culture [13.5 g / L KH ₂ PO ₄ , 4.0 g / L (NH ₄ ) ₂ PO ₄ , 1.7 g / L citric acid, 1.4 g / L MgSO ₄ 7H ₂ O, 10 ml / L trace metal solution (10.0 g / L FeSO ₄ 7H ₂ O, 2.0 g / L CaCl ₂ , 2.2 g / L ZnSO ₄ 7H ₂ O, 0.5 g / L MnSO ₄ 4H ₂ O, 1.0 g / L CuSO ₄ 5H ₂ O, 0.1 g / L (NH ₄ ) ₆ Mo ₇ O ₂₄ 4H ₂ O, 0.02 g / L Na ₂ B ₄ O ₇ 10H ₂ O) and pH 6.8 ] Was used and the temperature was maintained at 25 ° C.

In order to facilitate the supply of glucose for fed-batch culture after the initial consumption of all the glucose, a 'pH-stat' feeding method was introduced. The pH-stat method is a culture method in which a certain volume of feed solution (800g / L glucose, 20g / L MgSO ₄ 7H ₂ O) is automatically supplied into the reactor when the pH rises above a predetermined value after glucose is consumed. . The pH in the reactor was maintained at 6.8 using a 28% aqueous ammonia solution, and the stirring speed was gradually increased from 1000rpm to 1300rpm to increase the amount of dissolved oxygen. Aeration rate was maintained at about 1vvm. When dry cell mass concentration reached approximately 35 g / L, GDP-fucose production was performed by inducing the expression of GDP-fucose biosynthesis related enzymes with 0.1 mM IPTG.

On the other hand, the dry cell mass concentration in Examples 1 and 2 was measured at 600nm using a spectrophotometer. In addition, glucose and acetic acid were measured by using a 'M930 high performance liquid chromatography' instrumented with a 'HPX-87X' column.

On the other hand, the following methods were used to quantify GDP-fucose and confirm protein expression in Examples 1 and 2 below. Cells recovered during the cultivation were centrifuged at 13000 rpm for 5 minutes to remove the supernatant, and then the precipitated cells were suspended in an extraction solution (50 mM Tris-HCl buffer, pH 7.5, 150 mM NaCl, 10 mM MgCl ₂ , 5 mM βmercaptoethanol and 5 mM EDTA). After crushing the cells through sonication (sonication) was centrifuged at 13000rpm for 30 minutes at 4 ℃ to separate the cell extract (crude enzyme extract). Cell extracts were used to quantify intracellular GDP-fucose and confirm protein expression. GDP-fucose quantification was quantified using 'Agilent 1200 series HPLC' equipped with a 'CAPCELL PAK C18' column. The mobile phase was used with a concentration gradient of 98-96% (v / v) 20 mM TEAA and 2-4% (v / v) acetonitrile, and the absorption of GDP-fucose was observed at 254 nm. Intracellular protein concentration was measured using a protein quantification kit, and SDS-PAGE (Sodium dodecyl sulfate-polyacryamide gel electrophoresis) analysis was performed based on the 'Laemmli method' to confirm protein expression. Gels were stained using a 'Coomasie blue R-250' solution, and a decolorizing solution (20% methanol, 10% acetic acid) was used for decolorization.

On the other hand, to quantify the guanosine nucleotides in the cells in Examples 1 and 2 as follows. The cells recovered during the cultivation were centrifuged at 13000 rpm for 5 minutes to remove the supernatant, and the precipitated cells were suspended in an extraction solution (50 mM Tris-HCl buffer, pH 7.5, 150 mM NaCl, 10 mM MgCl ₂ , 5 mM βmercaptoethanol and 5 mM EDTA). After crushing the cells through sonication (sonication) was centrifuged at 13000rpm for 30 minutes at 4 ℃ to separate the cell extract (crude enzyme extract). Guanosine nucleotide quantification was performed using 'Agilent 1200 series HPLC' equipped with 'Partisil 10 SAX' column. 100 to 0% (v / v) 7 mM KH ₂ PO ₄ (pH 4.0) and 0 to 100% (v / v) 250 mM KH ₂ PO ₄ (containing pH 4.5, 500 mM KCl) It was. The absorption of GMP, GDP and GTP was observed at 254 nm to quantify guanosine nucleotides.

Example  One: pH - Stats  Way Oil price  In the fermentation process NADPH  By introducing reproductive enzyme GDP - Fucose  Increase production

As shown in FIG. 2, a gene ( zwf ) encoding glucose-6-phosphate-dehydrogenase (G6PDH), an enzyme involved in NADPH metabolism in the pentose phosphate pathway of Escherichia coli, was cloned, and an expression system was constructed. It was introduced into recombinant E. coli for GDP-fucose production. In addition, the production pattern of GDP-fucose was observed through the fed-batch culture process.

In the fed-batch fermentation process of the present inventors conducted as part of the preliminary experiments by a glucose-limited supply method of recombinant E. coli introduced with NADPH reproductive enzyme ( zwf ), the production of GDP-fucose was insignificant. The glucose infusion rate in the diet was too low. In preliminary experiments, during fed-batch cultures, glucose was added at a rate of 7 g / L per hour so that glucose and acetic acid did not accumulate in the medium and the dissolved oxygen levels remained relatively high, but this did not provide enough glucose for the reproduction of NADPH. There was a downside.

Therefore, under the assumption that low glucose infusion rate may impede the production of GDP-fucose, the process is improved by a fermentation method that nearly doubled the glucose infusion rate. It was.

Since the pH-stat is a method of automatically supplying glucose when the pH of the fermentation tank is higher than a predetermined value, there is an advantage that can supply the glucose more smoothly than the limited glucose supply method of the conventional glucose infusion rate.

In this example, the control group overexpresses E. coli BL21 star (DE3) / pmBCGW, a strain overexpressing ManB, ManC, Gmd, and WcaG, and the experimental group overexpresses ManB, ManC, Gmd, WcaG, and G6PDH. The fed-batch fermentation was performed using the strain E. coli BL21 star (DE3) / pmBCGW + pMWzwf.

Figure 5 shows the results of the protein expression trend according to the fed-batch culture process and process time of the control E. coli BL21 star (DE3) / pmBCGW. Due to the increased glucose supply rate, protein expression was induced by IPTG at a cell concentration of 35 g / L about 2-3 hours faster than the conventional process.

Protein expression was induced at 19.5 hours after fermentation, with a sharp rise in the concentration of GDP-fucose for about 11 hours. However, since the accumulation of acetic acid, the production rate of GDP-fucose decreased, and after 30 hours of fermentation, GDP-fucose production no longer increased.

Incubation resulted in a total of 193.6 mg / L of GDP-fucose and a productivity of 10.2 mg / L? H. This resulted in a 14% increase in productivity and a 52% increase in productivity compared to the conventional fed-batch fed diet with a glucose infusion rate of 7 g / L per hour. However, there was no difference in specific GDP-L-fucose content, which acts as an important measure when deciding whether to improve strains. Four enzymes were stably expressed until late in fermentation (presentation of data on enzyme expression is omitted).

On the other hand, Figure 6 shows the results of the protein expression tendency according to the fed-batch cultivation process and processing time of E. coli BL21 star (DE3) / pmBCGW + pMWzwf, a strain additionally expressing the experimental group G6PDH.

Unlike recombinant E. coli of the control group introduced plasmid pmBCGW, the GDP-fucose concentration did not increase rapidly, but it was found to increase linearly until the end of fermentation. There was little accumulation of acetic acid, which seems to be the result of further expression of G6PDH.

Incubation resulted in a total of 235.2 mg / L of GDP-fucose and a productivity of 12.7 mg / L? H. This resulted in a 66% increase in production and a 120% increase in productivity compared to the conventional fed-batch fed diet with a glucose infusion rate of 7 g / L per hour.

In addition, the 'non-GDP-fucose content', which acts as an important measure when deciding whether to improve strains, increased 47% from 1.9mg / g cells to 2.8mg / g cells in fed-batch fed glucose-limited diets. .

In addition, this result is an increase of 21% in production and 25% in productivity compared to a control group that does not overexpress G6PDH. Five enzymes, including G6PDH, were stably expressed until late in fermentation (data omitted). Non-enzymatic titers of G6PDH were maintained above 2U / mg cellular protein (data omitted).

From the results presented in FIG. 6, it can be seen that supply of sufficient glucose is an important factor for smooth reproduction of NADPH, and ultimately, these are important factors for increasing productivity of GDP-fucose.

Meanwhile, the yield of GDP-fucose on the consumed glucose was 1.3 mg GDP-L-fucose / g glucose, which was 30% higher than the control group without overexpressing G6PDH. This is because the additional expression of G6PDH resulted in more efficient sugar metabolism, resulting in improved GDP-fucose production.

Example  2: pH - Stats  Way Oil price  In the fermentation process Guanosine Nucleotides  With the introduction of biosynthetic enzymes GDP - Fucose  Increase production

As shown in FIG. 3, glucose is converted into phosphoribosylpyrophosphate (PRPP) via ribose-5-phosphate through an pentose pathway, and this PRPP is used as a starting material. Inosine 5'-monophosphate (IMP) is produced through a number of steps. The resulting IMP is known to be converted to GMP by IMP dehydrogenase (IMP dehydrogenase; GuaB) and GMP synthetase GuaA, and then to GDP and GTP through a series of phosphorylation ( de novo pathway).

In addition, it is known that IMP or GMP is produced by inosine-guanosine kinase (Gsk) as external inosine, guanine or guanosine is introduced into cells. (salvage pathway).

In order to biosynthesize guanosine nucleotides such as GMP and GDP, it is necessary to regulate metabolic pathways from IMP or guanosine and inosine, which are the starting materials for GMP synthesis.

According to a previous study published by the Ajinomoto group in Japan, the productivity of inosine was improved in recombinant E. coli crushed with enzymes such as GuaB, GuaA, Gsk, and XapA (Ref .: Biosci. Biotechnol. , 65: 570 (2001), Biosci. Biotechnol. Biochem., 65: 1230 (2001), Biosci. Biotechnol. Biochem., 70: 3069 (2006). It has also been found that GuaB and GuaA are major enzymes for GTP production (Ref. Appl. Environ. Microbiol., 34: 337 (1977)).

Therefore, in this experiment, we tried to reverse the results of previous studies to induce the conversion of guanosine nucleotides from inosine or IMP. In other words, it was intended to increase the guanosine pool in cells by increasing the conversion of inosine to IMP or by increasing the metabolic rate from IMP to GMP. Therefore, among the enzymes involved in the biosynthesis of guanosine nucleotides' de Genes encoding GuaA, GuaB, GuaC, enzymes involved in the novo guanosine nucleotide biosynthetic pathway, and Gsk, enzymes involved in the 'salvage pathway', were selectively introduced into recombinant E. coli for GDP-fucose production. The best productive and efficient enzymes were selected.

First, GuaB and GuaA are enzymes involved in the GMP biosynthesis pathway from IMP, and because they exist in clusters, plasmids were designed to express both enzymes simultaneously (pHguaBA). In order to increase intracellular concentrations of IMP and GMP, a plasmid expressing Gsk, an enzyme synthesizing IMP and GMP from inosine or guanosine, was designed (pHgsk). For comparative experiments, a plasmid expressing GuaC, an enzyme that induces reduction from GMP to IMP, was designed and compared with the two systems (pHguaC).

Figure 7 shows the results of the protein expression trend according to the fed-batch cultivation process and process time of E. coli BL21 star (DE3) / pmBCGW + pHguaBA, a GDP-fucose producing strain further expressing GuaB and GuaA have. After inducing protein expression with 0.1 mM IPTG at about 22 hours of fermentation, cell growth and production of GDP-fucose continued to increase. Cell concentration was increased up to 100 g / L, which resulted in a 20% increase in cell concentration compared to the case without further expression of GuaB and GuaA. Thanks to sustained cell growth, a total of 261.7 mg / L of GDP-fucose was produced, with a productivity of 13.8 mg / L? H (35% increase in both yield and productivity than without further expression of GuaB and GuaA). On the other hand, acetic acid was hardly accumulated, and the yield of GDP-fucose on the consumed glucose was 1.5 mg GDP-L-fucose / g glucose, which was 50% higher than that without overexpressing GuaB and GuaA. This is due to the fact that the additional expression of GuaB and GuaA was used for the production of guanosine nucleotides efficiently, which helped to improve GDP-fucose production.

However, as shown in FIG. 8, in the fed-batch fermentation process of the GDP-fucose producing strain further expressing GuaC, the above-described improvement of GDP-fucose production was not achieved. 171.9 mg / L of GDP-L-fucose was produced and the productivity was 9.8 mg / L? H (11% production and 4% productivity reduction compared to no additional GuaC). This is believed to be due to the fact that GuaC is an enzyme involved in the reduction of GMP to IMP, resulting in an inadequate supply of guanosine nucleotides leading to a decrease in GDP-fucose production.

On the other hand, Figure 9 shows the results of the protein expression trend according to the fed-batch cultivation process and process time of E. coli BL21 star (DE3) / pmBCGW + pHgsk, GDP-fucose production strains further expressing Gsk have. After protein induction by IPTG at about 21 hours of fermentation, the GDP-fucose concentration was rapidly increased. In about 20 hours, 305.5 mg / L of GDP-L-fucose was produced and the productivity was 15.7 mg / L? H. Compared with recombinant E. coli without additional Gsk expression, productivity increased by 58% and productivity by 54%. However, unlike strains expressing GuaB and GuaC, cell growth was not well achieved. When the dry cell mass reached about 80 g / L, cell growth began to slow down, and glucose tended to accumulate in the medium. The yield of GDP-fucose on consumed glucose was 1.5 mg GDP-L-fucose / g glucose, which was 50% higher than that of fed-batch culture without overexpressing Gsk. This is similar to the result of fed-batch culture of recombinant Escherichia coli expressing GuaB and GuaA, and the additional expression of Gsk also played an important role in producing guanosine nucleotides, which helped to improve GDP-fucose production. Judging.

Of particular note is the high specific GDP-L-fucose content of 3.5 mg / g cells, which serves as an important measure of strain improvement. This is because the guanosine nucleotide pool was improved in the cells differently from the expression of GuaB and GuaA. Previous studies have shown that when E. coli Gsk mutant genes that are not subjected to feedback inhibition by the resulting GMP are expressed in E. coli, the guanosine nucleotide pool increases rapidly but causes severe cell growth inhibition. (J. Biol. Chem., 274: 5348 (1999)). As in the previous study, GBS overexpression increased the concentration of guanosine nucleotide in the cell due to the overexpression of Gsk in the fed-batch culture process, resulting in the increase of GDP-fucose production, but the growth of cells and glucose metabolism Appeared to inhibit.

Degree 10 shows the results of HPLC analysis of the intracellular guanosine nucleotide content of the recombinant E. coli BL21 star (DE3) / pHgsk overexpressed Gsk. Recombinant Escherichia coli (a) overexpressing the parental vector, pACYCDuet-1, had a 'specific GMP content' of 1.54 mg / g cell, whereas recombinant Escherichia coli (b) overexpressing pHgsk was 2.44 mg / g. g cell increased GMP by 58%. As the intracellular GMP concentration increased, the supply of GTP required for GDP-fucose production was smoothed, and ultimately, the productivity of GDP-fucose was improved.

On the other hand, 'non GMP content' of recombinant E. coli overexpressing GuaB and GuaA or overexpressing GuaC did not increase (data omitted).

On the other hand, Figure 11 is a summary of the results of the fed-batch culture process of the pH-stat method performed in Example 1 and Example 2 above.

Claims (4)

In the method of producing GDP-fucose by culturing E. coli,
With E. coli,
GDP-D-mannose-4,6-dehydratase, GDP-4-keto-6-deoxymannose 3,5-epimerase-4-reductase, phosphomannomutase, mannose-1 -Method for producing GDP-fucose, characterized in that the recombinant E. coli is used to overexpress phosphate guanyltransferase, glucose-6-phosphate-dehydrogenase and guanosine-inosine kinase
The method of claim 1,
The overexpression,
GDP-fucose production method characterized by being controlled by an induction promoter
The method according to claim 1 or 2,
The culture,
GDP-fucose production method characterized in that the pH-stated fed-batch culture
delete

Images