KR101145348B1 - Gene Implicated in Osteoarthritis and Use Thereof - Google Patents

Abstract

The present invention relates to a method for screening a composition for preventing or treating arthritis, an arthritis diagnosis kit, and an arthritis therapeutic composition using a Barx 1 (BarH-like homeobox 1) molecule.
The present invention can be used for the fundamental prevention or treatment of arthritis through maintaining the function of joint tissues and improving the viability of chondrocytes, in particular, degenerative arthritis in which rheumatoid arthritis and its pathological etiology are clearly distinguished by controlling the underlying pathogens. It can also be useful for the treatment of.

Description

Gene Implicated in Osteoarthritis and Use Thereof}

The present invention relates to the development of a therapeutic agent for degenerative arthritis using a Barx1 (BarH-like homeobox 1) molecule.

Arthritis is one of the most prevalent diseases among human beings. In particular, degenerative arthritis is a representative senile disease that nearly 100% of people over 65 years old are aged 70-80%. At present, more than 10% of the population in Korea suffers from degenerative arthritis, and the prevalence is increasing very rapidly due to the rapid aging of Korean society. It is also estimated that there are more than 500 million patients with degenerative arthritis worldwide. In addition, as the duration of human social activities increases with the extension of the average life expectancy of humans, it is taking an important position among the senile diseases to be urgently overcome in terms of the quality of human life.

Cartilage tissue, which is surrounded by a membrane at the end of the bone and acts as a structural buffer, prevents pain and bone wear that can occur when the bones are in direct contact with each other. Chondrocytes are the only cellular components in cartilage tissue, which plays a role in synthesizing, secreting, and degrading collagen and proteoglycan matrix, which are essential for cartilage tissue to maintain normal function, and decomposing at an appropriate rate, thereby maintaining functional homeostasis of articular cartilage tissue. It plays an essential role in giving. Therefore, maintaining the activity of these chondrocytes is directly linked to the structural functional preservation of joint tissues.

In order for the function of chondrocytes in the chondrocytes to function normally, the chondrocytes should be properly formed and differentiated, the survival of the chondrocytes generated should be well protected, and the calcification of the chondrocytes existing is continuously suppressed. Hardening should be prevented. The most common cause of degenerative arthritis is that the intrinsic functionality of these articular chondrocytes is lost with aging (FIG. 1).

One of the key factors in inducing degenerative arthritis is the quantitative loss of cartilage tissue in the joint, which is closely related to the differentiation and maintenance of cartilage cells in cartilage tissue (FIG. 1). Another key factor in inducing degenerative arthritis is the hardening of cartilage in the joint, which is directly related to the calcification of chondrocytes (FIG. 1). As degenerative arthritis progresses, the proteoglycan matrix of cartilage tissues wears out mechanically, resulting in the loss of cartilage tissue and the resulting subchondral bones. Also, at this stage, small projections generated by the calcification of cartilage cells are deposited around them, causing hardening of the cartilage tissues, thereby accelerating the loss of cartilage tissues due to abrasion. Such complex joint structure deformation causes inflammation and pain, and when the symptoms worsen, joint deformation and exercise restriction are caused.

Therefore, the most fundamental and efficient approach for the treatment of degenerative arthritis is to secure targets that regulate the processes of chondrocyte production and differentiation, killing, calcification, etc. and developing effective control techniques (Fig. 2).

Existing arthritis treatment targets are mainly associated with inflammatory control processes and most are focused on the treatment of rheumatoid arthritis. However, degenerative arthritis, which causes pain and inflammation due to loss of cartilage tissue, and rheumatoid arthritis, in which joint tissue is destroyed as a result of an inflammatory response due to abnormal immune function, are clearly distinguished from pathological causes and symptoms (FIG. 3). . In the case of degenerative arthritis, inflammatory expression itself cannot be regarded as a causative agent of disease, and a inflammatory control approach cannot provide a fundamental cure for degenerative arthritis.

To date, no effective target material commercialized for the treatment of degenerative arthritis has been developed worldwide, and there is no fundamental cure for degenerative arthritis. Therefore, there is an urgent need to develop a fundamental therapeutic technique that directly acts on the underlying cause of degenerative arthritis, rather than on a symptomatic approach such as inflammation control.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have made diligent research efforts to develop compositions for more fundamental prophylaxis and treatment rather than existing symptomatic inflammatory control treatments for arthritis. As a result, the present invention was completed by discovering that the expression changes of Barx1 gene and protein are very closely related to the development and progression of degenerative arthritis.

Accordingly, an object of the present invention is to provide a composition for preventing or treating arthritis.

Another object of the present invention to provide an arthritis diagnostic kit.

It is another object of the present invention to provide a method for screening an arthritis therapeutic composition.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to an aspect of the present invention, the present invention provides a composition for preventing or treating arthritis, comprising a nucleic acid molecule that inhibits the expression of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2 sequence.

The present inventors have made diligent research efforts to develop compositions for more fundamental prophylaxis and treatment rather than existing symptomatic inflammatory control treatments for arthritis. As a result, it was found that the expression changes of Barx1 gene and protein are closely related to the onset and progression of degenerative arthritis. According to the present invention, the amino acid sequence of SEQ ID NO: 2 is an amino acid sequence of the Barx1 protein.

The inventors have found that the Barx1 gene inhibits ubiquitination (1) of I-κB protein by Nkx3.2, which is required for the maintenance of chondrocyte survival (FIG. 5), and also in this context, Nkx3.2. It was observed that the activation of transcriptional function of NF-κB induced by is significantly inhibited by Barx1 (FIG. 6). Therefore, when inhibiting the expression of the nucleotide sequence of the present invention, NF-κB activity associated with the survival of chondrocytes is increased.

As used herein, the term “inhibition of expression” means a modification on the nucleotide sequence that causes a decrease in the function of the target gene, which preferably means that the target gene expression becomes undetectable or is present at an insignificant level.

According to a preferred embodiment of the present invention, the nucleotide sequence whose expression is inhibited in the present invention consists of the nucleotide sequence of SEQ ID NO: 1.

According to the present invention, the nucleotide sequence of SEQ ID NO: 1 is the nucleotide sequence of the Barx1 gene.

It is apparent to those skilled in the art that the nucleotide sequence whose expression is inhibited in the present invention is not limited to the nucleotide sequence described in the attached sequence listing.

Variations in nucleotides do not result in changes in proteins. Such nucleic acids include functionally equivalent codons or codons that encode the same amino acid (eg, by degeneracy of the codon, six codons for arginine or serine), or codons that encode biologically equivalent amino acids. And nucleic acid molecules.

Considering the above-described variations having biologically equivalent activity, the nucleic acid molecules used in the present invention are also interpreted to include sequences that exhibit substantial identity with the sequences listed in the Sequence Listing. Such substantial identity is at least 60% when the sequences of the present invention are aligned with each other as closely as possible and the aligned sequences are analyzed using algorithms commonly used in the art. By a sequence that shows homology, more preferably 70% homology, even more preferably 80% homology, and most preferably 90% homology.

Alignment methods for sequence comparison are known in the art. Various methods and algorithms for alignment are described in Smith and Waterman, Adv . Appl . Math . 2: 482 (1981) ; Needleman and Wunsch, J. Mol . Bio. 48: 443 (1970); Pearson and Lipman, Methods in Mol . Biol . 24: 307-31 (1988); Higgins and Sharp, Gene 73: 237-44 (1988); Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc . Acids Res . 16: 10881-90 (1988); Huang et al., Comp . Appl . BioSci . 8: 155-65 (1992) and Pearson et al., Meth . Mol . Biol . 24: 307-31 (1994). The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol . Biol . 215: 403-10 (1990)) is accessible from the National Center for Biological Information (NBCI) and the like, and is available on the Internet in blastp, blasm, It can be used in conjunction with sequencing programs such as blastx, tblastn and tblastx. BLSAT is accessible at http://www.ncbi.nlm.nih.gov/BLAST/. Sequence homology comparison methods using this program can be found at http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html.

According to a preferred embodiment of the invention, the nucleic acid molecule of the invention is shRNA, siRNA, miRNA, ribozyme, peptide nucleic acids (PNA) or antisense oligonucleotide. More preferably, the nucleic acid molecule of the present invention is shRNA.

As used herein, the term “shRNA (small hairpin RNA)” refers to a nucleotide composed of 50-70 single strands, and in Stem-loop structure in vivo . In other words, shRNAs are RNA sequences that create tight hairpin structures for inhibiting gene expression through RNA interference. Long RNAs of 19-29 nucleotides complementary to both loop regions of 5-10 nucleotides form base pairs to form a double stranded stem. The shRNA is transduced into the cell via a vector containing the U6 promoter so that it is always expressed and is usually delivered to the daughter cell so that gene expression inhibition is inherited. The shRNA hairpin structure is cleaved by intracellular mechanisms, becomes siRNAs, and binds to RISC (RNA-induced silencing complex). These RISCs bind to and cleave mRNA. shRNA is transcribed by RNA polymerase III.

As used herein, the term “siRNA” refers to a short double-chain RNA capable of inducing RNA interference (RNAi) through the cleavage of a particular mRNA. It consists of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a sequence complementary thereto. Since siRNA can inhibit expression of a target gene, it is provided as an efficient gene knockdown method or as a method of gene therapy.

siRNAs are not limited to the complete pairing of double-stranded RNA pairs paired with RNA, but paired by mismatches (the corresponding bases are not complementary), bulges (there are no bases corresponding to one chain), etc. May be included. The total length is 10 to 100 bases, preferably 15 to 80 bases, most preferably 20 to 70 bases. The siRNA terminal structure can be blunt or cohesive, as long as the expression of the target gene can be suppressed by the RNAi effect. The cohesive end structure is possible in both a three-terminal protruding structure and a five-terminal protruding structure. The number of protruding bases is not limited. For example, the number of bases may be 1 to 8 bases, preferably 2 to 6 bases. In addition, siRNA is a low-molecular RNA (e.g., a natural RNA molecule such as tRNA, rRNA, viral RNA or artificial RNA) in the protruding portion of one end to the extent that can maintain the expression inhibitory effect of the target gene Molecules). The siRNA terminal structure does not need to have a cleavage structure at both sides, and may be a stem loop type structure in which one terminal portion of the double chain RNA is connected by a linker RNA. The length of the linker is not particularly limited as long as it does not interfere with pairing of stem portions.

As used herein, the term “miRNA (microRNA)” regulates gene expression and has a total length of 20-50 nucleotides, preferably 20-45 nucleotides, more preferably 20-40 nucleotides, even more preferably 20- It refers to a single stranded RNA molecule consisting of 30 nucleotides, most preferably 21-23 nucleotides. miRNAs are oligonucleotides that are not expressed intracellularly and have a short stem-loop structure. miRNAs are homologous, in whole or in part, with one or more mRNAs (messenger RNAs) and inhibit target gene expression through complementary binding to the mRNAs.

As used herein, the term “ribozyme” refers to an RNA molecule having a function such as an enzyme that recognizes a base sequence of a specific RNA and cleaves it by itself as a kind of RNA. Ribozyme is a complementary nucleotide sequence of a target messenger RNA strand consisting of a region that binds with specificity and a region that cleaves the target RNA.

As used herein, the term “PNA (Peptide nucleic acid)” refers to a molecule having both nucleic acid and protein properties, and a molecule capable of complementarily binding to DNA or RNA. PNA was first reported in 1999 as analogous DNA with nucleobases linked by peptide bonds (Nielsen PE, Egholm M, Berg RH, Buchardt O, "Sequence-selective recognition of DNA by strand displacement with a thymine-"). substituted polyamide ", Science 1991, Vol. 254: pp 1497-1500]. PNA is not found in nature but is artificially synthesized by chemical methods. PNAs hybridize with native nucleic acids of complementary base sequences to form double strands. PNA / DNA double strands are more stable than DNA / DNA double strands and PNA / RNA double strands are more stable than DNA / RNA double strands. It is most commonly used as a peptide basic skeleton that N- (2-aminoethyl) glycine is repeatedly connected by an amide bond. In this case, the backbone of the peptide nucleic acid is electrically different from that of the negatively charged natural nucleic acid. As neutral. The four nucleic acid bases present in the PNA have approximately the same spatial size and distance between nucleic acid bases as for natural nucleic acids. PNA is not only chemically stable than natural nucleic acids, but also biologically stable because it is not degraded by nucleases or proteases.

As used herein, the term “antisense oligonucleotide” refers to DNA or RNA or derivatives thereof that contain a nucleotide sequence complementary to a sequence of a particular mRNA, and binds to a complementary sequence within the mRNA to inhibit translation of the mRNA into a protein. Antisense nucleotide sequence of the present invention refers to a DNA or RNA sequence complementary to the mRNA of the target gene and capable of binding to the mRNA of the target gene, translation of the mRNA of the target gene, translocation into the cytoplasm, May inhibit the essential activity for maturation or any other overall biological function.

The antisense oligonucleotides can be modified at one or more bases, sugars or backbone positions to enhance efficacy (De Mesmaeker et al., Curr Opin Struct Biol . , 5 (3): 343-55, 1995). Oligonucleotide backbones can be modified with phosphorothioates, phosphoesters, methyl phosphonates, short chain alkyls, cycloalkyls, short chain heteroatomics, heterocyclic sugar schollfonae, and the like. In addition, antisense nucleic acids may comprise one or more substituted sugar moieties. Antisense oligonucleotides may comprise modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-methyl pyrimidine (particularly 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosil HMC, 2-aminoadenine, 2 Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine, etc. There is this.

The composition of the present invention may be prepared as a pharmaceutical composition containing a pharmaceutically effective amount of the nucleic acid molecule of the present invention.

As used herein, the term “pharmaceutically effective amount” means an amount sufficient to achieve the above-described preventive, alleviating or treating efficacy or activity of arthritis.

Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like It doesn't happen. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and agents are Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, topical administration, transdermal administration, joint cavity administration, etc. Can be administered. Most preferably, it is administered by joint cavity administration.

The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . Meanwhile, the preferred dosage of the pharmaceutical composition of the present invention is 0.0001-100 mg / kg per day.

The pharmaceutical compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporating into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

According to a more preferred embodiment of the present invention, the nucleic acid molecule of the present invention is included in a gene delivery system.

As used herein, the term "gene transporter" refers to a medium for introducing and expressing a desired target gene into a target cell. The ideal gene carrier should be harmless to the human body, easy to mass produce, and able to deliver the gene efficiently.

As used herein, the term “gene delivery” means that a gene is carried into a cell and has the same meaning as intracellular transduction of the gene. At the tissue level, the term gene delivery has the same meaning as spread of a gene. Thus, the gene carriers of the present invention may be described as gene penetration systems and gene diffusion systems.

In order to prepare the gene carriers of the invention, the nucleotide sequences of the invention are preferably present in a suitable expression construct. In the expression construct, the nucleotide sequence of the present invention is preferably operably linked to a promoter. As used herein, the term “operably linked” refers to a functional binding between a nucleic acid expression control sequence (eg, an array of promoters, signal sequences, or transcriptional regulator binding sites) and other nucleic acid sequences, thereby The regulatory sequence will control the transcription and / or translation of said other nucleic acid sequence. In the present invention, the promoter bound to the nucleotide sequence of the present invention is preferably a promoter derived from a mammalian virus that can operate in animal cells, more preferably mammalian cells to regulate transcription of the relaxin gene. And promoters derived from genomes of mammalian cells, such as CMV (mammal cytomegalovirus) promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, tk of HSV Promoter, RSV promoter, EF1 alpha promoter, metallothionine promoter, beta-actin promoter, promoter of human IL-2 gene, promoter of human IFN gene, promoter of human IL-4 gene, promoter of human lymphotoxin gene and human Promoters of the GM-CSF gene, including, but not limited to, the U6 promoter. Most preferably, a CMV promoter is used.

The gene carrier of the present invention can be produced in various forms, including (i) naked recombinant DNA molecules, (ii) plasmids, (iii) viral vectors, and (iii) the naked Naked recombinant DNA molecules or It may be prepared in the form of liposomes or niosomes containing plasmids.

Nkx3.2 nucleotide sequence may be applied to any gene transfer system for use in a conventional gene therapy, preferably a plasmid, adenovirus (Lockett LJ, et al., Clin. Cancer Res . 3: 2075-2080 (1997)), Adeno-associated viruses: AAV, Lashford LS., Et al., Gene Therapy Technologies , Applications and Regulations Ed. A. Meager, 1999), retroviral (Gunzburg WH, et al., Retroviral vectors. Gene Therapy Technologies , Applications and Regulations Ed. A. Meager, 1999), lentiviruses (Wang G. et al., J. Clin . Invest . 104 (11): R55-62 (1999)), herpes simplex virus (Chamber R., et al., Proc . Natl. Act. Sci USA 92: 1411-1415 (1995)), basinian virus (Puhlmann M. et al., Human Gene Therapy 10: 649-657 (1999)), liposomes (Methos in Molecular Biology, Vol 199, SC Basu and M. Basu (Eds.), Human Press 2002) or niosomes. Most preferably, the gene carrier of the present invention is prepared by applying the nucleotide molecule of the present invention to a lentivirus.

In the present invention, when the gene carrier is produced based on a viral vector, the contacting step is performed according to a virus infection method known in the art. Infection of host cells with viral vectors is described in the references cited above.

In the present invention, when the gene carrier is a naked recombinant DNA molecule or plasmid, the micro-injection method (Capecchi, MR, Cell , 22: 479 (1980); and Harland and Weintraub, J. Cell) Biol . 101: 1094-1099 (1985)), calcium phosphate precipitation (Graham, FL et al., Virology , 52: 456 (1973); and Chen and Okayama, Mol . Cell . Biol . 7: 2745-2752 (1987) ), Electroporation (Neumann, E. et al., EMBO J. , 1: 841 (1982); and Tur-Kaspa et al., Mol . Cell Biol . , 6: 716-718 (1986)), liposome-mediated transfection (Wong, TK et al., Gene , 10:87 (1980); Nicolau. Etene, Biochim . Biophys . Acta , 721: 185-190 ( 1982) and Nicolau. Et al., Methods Enzymol . , 149: 157-176 (1987)), DEAE-dextran treatment (Gopal, Mol . Cell Biol . , 5: 1188-1190 (1985)), and gene balm (Yang et al., Proc . Natl . Acad. Sci . , 87: 9568-9572 (1990)). have.

According to a preferred embodiment of the invention, the arthritis which can be prevented or treated by the present invention is Osteoarthritis.

As used herein, the term "Osteoarthritis" refers to a disease in which joint tissue required for joint movement is damaged due to quantitative loss of cartilage tissue.

According to the present invention, the composition of the present invention activates the recovery of cartilage tissue by controlling the abnormality of the chondrocytes. Thus, unlike conventional inflammatory control approaches to treat rheumatoid arthritis in which joint tissues are destroyed by inflammatory reactions due to immune dysfunction, the compositions of the present invention provide a fundamental treatment for degenerative arthritis. .

According to another aspect of the invention, the invention provides an arthritis diagnostic kit comprising an antibody or aptamer specifically binding to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 sequence.

As used herein, the term “diagnosis” refers to determining the susceptibility of an object to a particular disease or condition, determining whether an object currently has a particular disease or condition (eg, metabolic abnormalities or diabetes mellitus). Identification), determining the prognosis of an object with a particular disease or condition, or terrametrics (e.g., monitoring the condition of an object to provide information about treatment efficacy). do. According to the present invention, when using the polypeptide of the present invention as a marker, the expression level thereof is significantly higher than that of a normal person is confirmed by the above-described method increases the viability and activity of bone growth plate cartilage cells increases the risk of developing arthritis It is high.

According to the present invention, the polypeptide of the present invention can be detected according to an immunoassay method using an antigen-antibody reaction and used to diagnose arthritis.

Such immunoassays can be performed according to various immunoassays or immunostaining protocols developed in the prior art.

For example, when the method of the invention is carried out in accordance with radioimmunoassay methods, an antibody labeled with a radioisotope (eg, C ¹⁴ , I ¹²⁵ , P ³² and S ³⁵ ) detects the polypeptide of the invention. It can be used to.

The antibody to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 sequence used in the present invention is a polyclonal or monoclonal antibody, preferably a monoclonal antibody.

Antibodies to the polypeptides of the invention may be prepared by methods conventionally practiced in the art, for example, by fusion methods (Kohler and Milstein, European). Journal of Immunology , 6: 511-519 (1976)), recombinant DNA methods (US Pat. No. 4,816,567) or phage antibody library methods (Clackson et al, Nature , 352: 624-628 (1991) and Marks et al, J. Mol . Biol, 222:. 58, can be prepared by 1-597 (1991)). General procedures for antibody preparation are described in Harlow, E. and Lane, D., Using Antibodies : A Laboratory Manual , Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies : A Manual of Techniques , CRC Press, Inc., Boca Raton, Florida, 1984; And Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY , Wiley / Greene, NY, 1991. For example, the preparation of hybridoma cells producing monoclonal antibodies is accomplished by fusing an immortalized cell line with an antibody-producing lymphocyte, and the techniques necessary for this process are well known and readily practicable by those skilled in the art. Polyclonal antibodies are injected into a suitable animal with a polypeptide antigen consisting of the amino acid sequences of SEQ ID NO: 2, the antiserum collected from the animal, and the antibody isolated from the antiserum using known affinity techniques. Can be obtained.

Arthritis can be diagnosed by analyzing the final signal intensity by the above-described immunoassay process. That is, when a signal for a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 in the human sample is stronger than a normal sample, it is diagnosed that the risk of developing arthritis is high.

The kit of the present invention may use an aptamer that specifically binds to a polypeptide marker consisting of the amino acid sequence of SEQ ID NO: 2 in place of the antibody. As used herein, the term “aptamer” refers to a single-stranded nucleic acid (RNA or DNA) molecule or peptide molecule that exhibits a high affinity and specificity for binding to a specific target. For general information about aptamers, see Bock LC et al., Nature 355 (6360): 5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med . 78 (8): 42630 (2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA . 95 (24): 142727 (1998).

According to another aspect of the invention, the present invention provides a diagnostic kit for arthritis comprising a primer or probe specifically binding to the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2 sequence.

As used herein, the term “nucleotide” is a deoxyribonucleotide or ribonucleotide present in single- or double-stranded form and includes analogs of natural nucleotides unless otherwise specified (Scheit, Nucleotide). Analogs , John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990).

As used herein, the term “primer” refers to an oligonucleotide, which is a condition in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, i.e., the presence of a polymerizer such as nucleotide and DNA polymerase, and It can serve as a starting point for the synthesis at conditions of suitable temperature and pH. Preferably, the primer is deoxyribonucleotide and single chain. Primers used in the present invention may comprise naturally occurring dNMP (ie, dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primer may also include ribonucleotides.

The primer of the present invention may be an extension primer annealed to the target nucleic acid to form a sequence complementary to the target nucleic acid by a template-dependent nucleic acid polymerase, which extends to the position where the immobilized probe is annealed to Occupies the annealed area.

The extension primer used in the present invention includes a hybridizing nucleotide sequence complementary to the first position of the target nucleic acid. The term “complementary” means that the primer or probe is sufficiently complementary to selectively hybridize to a target nucleic acid sequence under certain annealing or hybridization conditions, and is substantially complementary and perfectly complementary. It has the meaning encompassing all, and preferably means completely complementary. As used herein, the term “substantially complementary sequence” as used in connection with a primer sequence is intended to partially match the sequence to be compared, as well as to the exact match, as well as to the extent that it may serve as a primer by annealing to a particular sequence. Mismatched sequences are also included.

The primer should be long enough to prime the synthesis of the extension product in the presence of the polymerizer. Suitable lengths of the primers depend on a number of factors, such as temperature, application and source of the primer, but are typically 15-30 nucleotides. Short primer molecules generally require lower temperatures to form hybrid complexes that are sufficiently stable with the template. The term “annealing” or “priming” refers to the placement of an oligodioxynucleotide or nucleic acid into a template nucleic acid, where the polymerase polymerizes the nucleotide to form a nucleic acid molecule that is complementary to the template nucleic acid or portion thereof. Let's do it.

The sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and it is sufficient to have sufficient complementarity within a range that can hybridize with the template to perform the primer-specific function. Therefore, the primer in the present invention does not need to have a sequence that is perfectly complementary to the above-described nucleotide sequence as a template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing to the gene sequence and acting as a primer. The design of such primers can be easily carried out by those skilled in the art with reference to the above-described nucleotide sequence, for example, by using a program for primer design (eg, PRIMER 3 program).

As used herein, the term “nucleic acid molecule” is meant to encompass DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides, which are the basic structural units in nucleic acid molecules, modify not only natural nucleotides, but also sugar or base sites. It also includes analogues (Scheit, Nucleotide) Analogs , John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990).

If the starting material in the kit of the invention is gDNA, isolation of gDNA can be carried out according to conventional methods known in the art (Rogers & Bendich (1994)).

If the starting material is mRNA, total RNA is isolated and performed by conventional methods known in the art (see Sambrook, J. et al., Molecular) . Cloning . A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001); Tesniere, C. et al., Plant Mol . Biol . Rep . 9: 242 (1991); Ausubel, FM et al., Current Protocols in Molecular Biology , John Willey & Sons (1987); And Chomczynski, P. et al., Anal. Biochem . 162: 156 (1987). The isolated total RNA is synthesized into cDNA using reverse transcriptase. Since the total RNA is isolated from humans (e.g., obese or diabetic patients), it has a poly-A tail at the end of the mRNA and easily synthesizes cDNA using oligo dT primer and reverse transcriptase using this sequence characteristic. (See PNAS) USA , 85: 8998 (1988); Libert F, et al., Science , 244: 569 (1989); And Sambrook, J. et al., Molecular Cloning . A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001).

In the kit of the present invention, the identification of the specific sequence may be carried out by applying various methods known in the art. For example, a technique that can be applied to the present invention is fluorescent phosphorus Sea hybridization (FISH), direct DNA sequencing, PFGE analysis, Southern blot analysis, single-strand conformation analysis (SSCA, Orita et al., PNAS , USA 86: 2776 (1989)), RNase protection assay (Finkelstein et al. ., Genomics, 7:.. 167 (1990)), datteu blot analysis, a modified gradient gel electrophoresis (DGGE, Wartell et al, Nucl Acids Res . , 18: 2699 (1990)), proteins that recognize nucleotide mismatches (for example, a method using the E. coli mutS protein of a) (Modrich, Ann Rev Genet, 25:... 229-253 (1991)), and Allele-specific PCR, including but not limited to.

Other techniques generally employ probes or primers that are complementary to the nucleotide sequences of the present invention.

For example, in RNase protection assays riboprobes that are complementary to sequences comprising the nucleotides of the invention are used. The riboprobe and DNA or mRNA isolated from humans are hybridized and then cleaved with an RNase A enzyme capable of detecting mismatches. If there is a mismatch and RNase A recognizes, a smaller band is observed.

In assays using hybridization signals, probes complementary to sequences comprising the nucleotides of the invention are used. In this technique, hybridization signals of probes and target sequences are detected to directly determine the risk of disease.

As used herein, the term “probe” refers to a linear oligomer having naturally occurring or modified monomers or bonds, including deoxyribonucleotides and ribonucleotides that can hybridize to a particular nucleotide sequence. Preferably, the probe is single stranded for maximum efficiency in hybridization. The probe is preferably deoxyribonucleotide.

As the probe used in the present invention, a sequence that is perfectly complementary to the sequence including the nucleotide may be used, but a sequence that is substantially complementary to the extent that does not prevent specific hybridization may be used. It may be. Preferably, the probe used in the present invention comprises a sequence that can hybridize to a sequence comprising the nucleotide of the present invention. More preferably, the 3′-end or 5′-end of the probe has a base complementary to the nucleotide. In general, in a probe having a base complementary to the nucleotide base at the 3'- or 5'-end, since the stability of the duplex formed by hybridization tends to be determined by the matching of the terminal sequence If the terminal portion does not hybridize, these duplexes may disintegrate under stringent conditions.

Conditions suitable for hybridization are described in Joseph Sambrook, et al.,Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Haymes, B. D., et al.,Nucleic Acid Hybridization , A Practical ApproachDecisions may be made with reference to those disclosed in IRL Press, Washington, D.C. (1985). Stringent conditions used for hybridization can be determined by adjusting temperature, ionic strength (buffer concentration), the presence of compounds such as organic solvents, and the like. Such stringent conditions can be determined differently depending on the sequence being hybridized.

According to a preferred embodiment of the present invention, the nucleotide sequence of the present invention consists of the nucleotide sequence of SEQ ID NO: 1.

According to a preferred embodiment of the present invention, the arthritis that can be diagnosed by the present invention is osteoarthritis.

According to a preferred embodiment of the invention, humans with high expression of the nucleotides or polypeptides of the invention exhibit an increased risk of arthritis.

As used herein, the term “high expression” means a case where the expression level of the nucleotide or polypeptide of the present invention is significantly higher than that of a normal person, and preferably the expression level of the nucleotide or polypeptide of the present invention is 130% or more of a normal person. it means.

According to another aspect of the present invention, the present invention provides a method for screening an arthritis therapeutic composition comprising the following steps:

(a) contacting a sample to be analyzed with a cell comprising the nucleotide sequence of SEQ ID NO: 1; And

(b) measuring the expression level of the nucleotide sequence, and when the expression of the nucleotide sequence is reduced, the sample is determined to be an arthritis therapeutic composition.

According to the screening method of the present invention, first, a sample to be analyzed is contacted with a cell including the nucleotide sequence of SEQ ID NO: 1. Preferably, the cell comprising the nucleotide sequence of SEQ ID NO: 1 is human chondrocyte. As used to refer to the screening method of the present invention, the term "sample" refers to an unknown substance used in screening to examine whether it affects the expression level of the nucleotide sequence of SEQ ID NO: 1. The sample includes, but is not limited to, chemicals, nucleotides, antisense-RNAs, small interference RNAs (siRNAs), and natural extracts. Next, the expression level of the nucleotide sequence of the first sequence of the sequence list in the cell treated with the sample is measured. The measurement of the expression level is as described above, and when the result of the measurement indicates that the expression of the nucleotide sequence of SEQ ID NO: 1 is inhibited, the sample may be determined as an arthritis therapeutic composition.

According to another aspect of the present invention, the present invention provides a method for screening an arthritis therapeutic composition comprising the following steps:

(a) contacting a sample to be analyzed with a cell comprising a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2; And

(b) measuring the binding of the sample to be analyzed with the polypeptide, and when the binding between the polypeptide and the sample to be analyzed is increased, the sample is determined as an arthritis therapeutic composition.

According to the present invention, the inventors confirmed that Barx1 effectively inhibits Nkx3.2 ubiquitination of I-κB protein to induce activation of NF-κB (FIG. 5). In addition, it was confirmed that the binding of the I-κB protein that Nkx3.2 must be essential for NF-κB activation is blocked by direct protein binding between Barx1 and Nkx3.2 (FIG. 7). Thus, a substance that competitively binds with Barx1 and inhibits direct protein binding between Barx1 and Nkx3.2 will increase NF-κB activity and enhance the viability of chondrocytes.

According to the screening method of the present invention, a sample to be analyzed is contacted with a cell containing a Barx1 protein, which is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2. Preferably, the Barx1 protein used in the present invention may be present in the form displayed on the cell surface, in the form displayed on the virus (eg bacteriophage) or in the cell, or isolated. ) May be in purified form.

When using the Barx1 protein exhibited or present on the cell surface or on the virus surface, it is preferred that the cell or virus is immobilized on a solid substrate for rapid or automated screening. It is also desirable to immobilize Barx1 protein in isolated or purified form on a solid substrate. Available as substrates can be any conventionally used in the art, including, but not limited to, hydrocarbon polymers such as polystyrene and polypropylene, glass, metals and gels. Solid phase substrates may be provided in the form of dipsticks, microtiter plates, particles (eg beads), affinity columns and immunoblot membranes (eg polyvinylidene fluoride membranes). See US Pat. No. 5,143,825. 5,374,530, 4,908,305 and 5,498,551). Most preferably, the solid substrate is a microtiter plate.

The screening methods of the present invention can be carried out in a variety of ways, in particular in a high throughput manner according to various binding assays known in the art.

In the screening method of the present invention, the test substance or Barx1 protein may be labeled with a detectable label. For example, the detectable label may be a chemical label (eg biotin), an enzyme label (eg horseradish peroxidase, alkaline phosphatase, peroxidase, luciferase, β-galacto Cidase and β-glucosidase), radiolabels (eg, C ¹⁴ , I ¹²⁵ , P ³² And S ³⁵ ), fluorescent labels [eg, coumarin, fluorescein, fluoresein Isothiocyanate (FITC), rhodamine 6G (rhodamine B), rhodamine B (6-carboxy-tetramethyl-rhodamine), Cy -3, Cy-5, Texas Red, Alexa Fluor, DAPI (4,6-diamidino-2-phenylindole), HEX, TET, Dabsyl and FAM], luminescent labels, chemiluminescent labels, fluorescence resonance energy transfer) label or metal label (eg, gold and silver).

When using a Barx1 protein or test substance labeled with a detectable label, the binding between the Barx1 protein and the test substance can be analyzed by detecting a signal from the label. For example, when alkaline phosphatase is used as a label, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate (naphthol-AS-B1-phosphate) Signal is detected using a chromogenic reaction substrate such as) and enhanced chemifluorescence (ECF). When hose radish peroxidase is used as a label, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate), resorupin benzyl ether, luminol, Amplex Red Reagent (10-acetyl-3,7-dihydroxyphenoxazine), p-phenylenediamine-HCl and pyrocatechol (HYR), tetramethylbenzidine (TMB), ABTS (2,2'-Azine-di [3-ethylbenzthiazoline sulfonate]), o -phenylenediamine (OPD), and substrates such as naphthol / pyronin to detect the signal.

Alternatively, binding of the test substance to the Barx1 protein may be analyzed without labeling the interactants. For example, a microphysiometer can be used to analyze whether the test substance binds to Barx1 protein. Microphysiometers are analytical tools that measure the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). The change in acidification rate can be used as an indicator for binding between test substance and Barx1 protein (McConnell et al., Science 257: 19061912 (1992).

Binding capacity of the Barx1 protein of the test substance can be analyzed with the real-time bimolecular interaction analysis (BIA) (Sjolander & Urbaniczky, Anal Chem 63:.... 23382345 (1991), and Szabo et al, Curr Opin Struct. Biol . 5: 699705 (1995). BIA is a technique for analyzing specific interactions in real time and can be performed without labeling of the interactions (eg, BIAcore ™). Changes in surface plasmon resonance (SPR) can be used as indicators for real-time reactions between molecules.

In addition, the screening method of the present invention can be carried out according to a two-hybrid analysis or a three-hybrid analysis method (US Pat. No. 5,283,317; Zervos et al., Cell 72, 223232, 1993; Madura et al., J. Biol . Chem . 268, 1204612054, 1993; Bartel et al., BioTechniques 14, 920924, 1993; Iwabuchi et al., Oncogene 8, 16931696, 1993; And WO 94/10300). In this case, the Barx1 protein can be used as a bait protein. According to this method, substances which bind to Barx1 protein, in particular proteins can be screened. Two-hybrid systems are based on the modular nature of the transcription factors composed of cleavable DNA-binding and activation domains. For simplicity, this assay uses two DNA constructs. For example, in one construct, a Barx1 protein coding polynucleotide (eg, a nucleotide of SEQ ID NO: 1) is fused to a DNA binding domain-encoding polynucleotide of a known transcription factor (eg, GAL-4). In another construct, a DNA sequence encoding a protein of interest (“prey” or “sample”) is fused to a polynucleotide encoding the activation domain of the known transcription factor. If bait and prey interact in in vivo to form a complex, the DNA-binding and activation domains of the transcription factors are contiguous, which triggers transcription of the reporter gene (eg, LacZ). Expression of the reporter gene can be detected, which indicates that the protein of analysis can bind to the Barx1 protein, and consequently, can be used as an angiogenesis inhibitor.

The screening method of the present invention will be described in detail with several specific examples as follows:

The first exemplary method is performed according to phage display binding assays. Barx1 protein encoding phage display Barx1 protein. Angiogenesis inhibitors are screened by contacting the test substance with the Barx1 protein exhibited on the phage (eg, T7) surface to determine whether the test substance binds to the Barx1 protein.

According to a preferred embodiment of the present invention, before the step (a) further comprises the step of treating a polynucleotide consisting of the amino acid sequence of SEQ ID NO: 3 to the cell comprising the Barx1 protein. According to the present invention, the amino acid sequence of SEQ ID NO: 3 is an amino acid sequence of Nkx3.2 (NK3 homeobox 2) protein.

That is, before contacting a test substance to a cell containing Barx1 protein, Nkx3.2 protein that specifically binds to Barx1 protein is treated to the cell and bound to the cell, and then the test substance is treated to the cell and the Barx1 protein. Analyze whether the test compound competes with the Nkx3.2 protein for binding to. Excess treatment of the test substance binding to Barx1 protein causes the Nkx3.2 protein bound to Barx1 protein to be released from the Barx1 protein.

To facilitate the assay, the Nkx3.2 protein can be labeled with a detectable label. For example, the detectable label may be a chemical label (eg biotin), an enzyme label (eg horseradish peroxidase, alkaline phosphatase, peroxidase, luciferase, β-galactosidase and β- Glucosidase), radiolabels (eg, C ¹⁴ , I ¹²⁵ , P ³² And S ³⁵ ), fluorescent labels [eg, coumarin, fluorescein, fluoresein Isothiocyanate (FITC), rhodamine 6G (rhodamine B), rhodamine B (6-carboxy-tetramethyl-rhodamine), Cy -3, Cy-5, Texas Red, Alexa Fluor, DAPI (4,6-diamidino-2-phenylindole), HEX, TET, Dabsyl and FAM], luminescent labels, chemiluminescent labels, fluorescence resonance energy transfer) label or metal label (eg, gold and silver).

The method of the present invention can be carried out according to the cytoplasmic staining method. Cytoplasmic staining methods can utilize, for example, Nkx3.2 protein-coumarin conjugates and cytoplasmic staining can be observed by fluorescence microscopy.

Specifically, the cytoplasmic staining method first treats Barx1 protein containing cells with Nkx3.2 protein-coumarin conjugate before step (a) above. Excess test material is then treated to Nkx3.2 protein-coumarin conjugated Barx1 protein containing cells. In this case, when the cytoplasmic stained cells by the Nkx3.2 protein-coumarin conjugate are decolorized by the test substance, the test substance has a binding affinity to the Barx1 protein, i.e., it is determined as a candidate of the arthritis therapeutic agent.

Optionally, the present invention may be carried out by treating the Nkx3.2 protein with the test substance-treated Barx1 protein-containing cells to examine whether the Nkx3.2 protein binds to the Barx1 protein.

According to a preferred embodiment of the invention, the method of the invention is used for the screening of degenerative arthritis therapeutic compositions.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a composition for preventing or treating arthritis, an arthritis diagnosis kit, and an arthritis therapeutic composition using a Barx 1 molecule.

(b) The present invention can be usefully used for the fundamental prevention and treatment of arthritis through maintaining the function of joint tissues and improving chondrocyte viability.

1 is a diagram schematically illustrating the pathogenesis of degenerative arthritis in terms of maintaining cartilage tissue function.
Figure 2 is a diagram schematically illustrating the logical basis that the present invention can be used to prevent and treat degenerative arthritis.
Figure 3 is a diagram illustrating a problem of current arthritis treatment technology in terms of healing degenerative arthritis.
Figure 4 is a diagram showing the expression patterns of Nkx3.2 and Barx1 complementary observed in embryonic cartilage tissue development. This figure refers to the results contained in a previously published document for the background of the invention (2). Expressed in cartilage tissue generation process mutually complementary expression patterns observed between Nkx3.2 and in situ hybridization to Barx1.
FIG. 5 shows that ubiquitination of I-κB protein induced by Nkx3.2 is inhibited by Barx1.
As can be seen in the first panel, it was observed that the ubiquitination (lane 2) of I-κB protein induced by overexpression of Nkx3.2 can be completely inhibited when Barx1 is overexpressed (lane 4). . The second panel shows the protein binding (lane 2) between Nkx3.2 and I-κB in the process of inducing ubiquitination of I-κB protein, where Barx1 coexists with I-κB and Nkx3. It is also shown that the protein binding between the two is lost (lane 4).
Figure 6 shows that NF-κB transcriptional activation induced by Nkx3.2 is inhibited by Barx1. It was confirmed that functional activation of NF-κB by lane Nkx3.2 (lane 2) as previously revealed was effectively inhibited (lane 4) by Barx1.
FIG. 7 is a photograph showing that the formation of Nkx3.2 and I-κB is blocked by binding between Barx1 and Nkx3.2. As can be seen in the first panel, it was observed that protein binding (lane 2) between Nkx3.2 and I-κB was significantly inhibited (lane 3) when Barx1 was overexpressed together. The second panel shows that protein binding between Nkx3.2 and Barx1 takes precedence over protein binding between Nkx3.2 and I-κB in environments where Nkx3.2, I-κB and Barx1 coexist. ).
Figure 8 is a diagram showing the results confirming the effect of promoting cartilage cell death by overexpression of Barx1. As can be seen in lanes 3 and 5, much higher levels of cell death were observed in chondrocytes overexpressing Barx1 compared to control vectors (lanes 2 and 4).
9 is a diagram showing the results of confirming the inhibitory effect of chondrocyte death by Barx1 knockdown. When analyzed by the chondrocyte death induction experiment (1) through the inhibition of NF-κB activity established in the previous study by the inventor, the Barx1 shRNA virus, in contrast to the chondrocytes (lane 2) infected with the control shRNA virus Was infected with chondrocytes (lane 4) it was confirmed that apoptosis is effectively inhibited.
10 is a graph showing the results of Western blot changes in the expression of Barx1 in articular chondrocytes of patients with degenerative arthritis. Western blotting analysis of GAPDH and Barx1 of chondrocytes isolated from articular cartilage of normal and degenerative arthritis patients showed quantitative comparison of GAPDH expression in Nkx3 in articular chondrocytes of degenerative arthritis patients. .2 protein levels were observed to be significantly higher.
11 is a diagram showing the results of comparing the apoptosis of normal and degenerative arthritis chondrocytes by FACS analysis. The viability of chondrocytes was confirmed by measuring the degree of binding of Annexin-V. As shown in the left lanes, much higher levels of cell death were observed in chondrocytes in patients with degenerative arthritis (24.3%) compared to normal (5.15%), and also for cell death induced additionally by inhibition of NF-κB activity. Cartilage cells in patients with degenerative arthritis (68.11%) caused significantly higher levels of cell death than normal (19.93%).

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Experiment method

Inhibition of Ubiquitinylation of I-κB Protein by Barx1

Nkx3.2 ubiquitizes the I-κB protein for activation of NF-κB (1), and the inventors have determined whether Barx1 inhibits the activation of NF-κB by inhibiting this ubiquitination of Nkx3.2. In order to perform immunoprecipitation experiments.

3-6 mg of the expression plasmid of each pCS2 backbone (based on p100 plate) was subjected to transient transfection according to user instructions using Roche's FuGene6 product on an ATDC5 chondrocyte line (3) using Roche's FuGene6 product. Overexpression of I-κB protein. Subsequently, immunoprecipitation was performed using the anti-Myc antibody (Upstate Biotechnology) that recognizes the Myc tag labeled on the I-κB protein, as described in the literature previously published by the inventors (Park, M., Yong). , Y., Choi, SW, Kim, JH, Lee, JE, and Kim, DW Constitutive RelA activation mediated by Nkx3.2 controls chondrocyte viability.Nat . Cell Biol . 9: 287-298 (2007)).

Western blotting was performed with an anti-Flag antibody that recognizes a flag tag labeled on the ubiquitin protein to determine the degree of ubiquitination present in the immunoprecipitated I-κB protein. Western blotting experiments of the invention were performed by conventional techniques (Harlow E., and Lane D. In: Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988)), each antibody The star specificities can be summarized as follows:

1) Anti-GAPDH: AbFrontier, Cat. No. LF-PA0018, dilution multiple 1: 5000, PBST with 2% milk

2) Anti-Barx1: Abcam, Cat. No. ab26156, dilution multiple 1: 2000, TBST with 1% milk

Block formation of Nkx3.2 and I-κB by binding between Barx1 and Nkx3.2

3-6 mg of each expressed pCS2 backbone (p100 plate) was transiently transformed into ATDC5 chondrocytes (3) using Roche's FuGene6 product to induce overexpression of the protein and then to Nkx3.2 protein. Immunoprecipitation was performed using an anti-Myc antibody recognizing a labeled Myc tag. In order to measure the amount of I-κB protein bound to immunoprecipitated Nkx3.2 protein, Western blotting was performed with an anti-Flag antibody that recognizes a flag tag labeled on the I-κB protein.

Transcriptional Activity of NF-κB by Barx1

100-200 ng of the expression plasmid of each pCS2 backbone (based on 12 well plates) was transiently hemostatically converted to ATDC5 chondrocytes (3) using Roche's FuGene6 product to induce overexpression of the protein and then specific for NF-κB. 4x-kB-Luc reporter with 4 repeats of DNA binding site (Park, M., Yong, Y., Choi, SW, Kim, JH, Lee, JE, and Kim, DW Constitutive RelA activation mediated by Nkx3.2 Control chondrocyte viability, Nat. Cell Biol . 9: 287-298 (2007)) was used to measure the transcriptional activation of NF-κB in cells.

Survival Changes of Chondrocytes by Barx1 Overexpression

5 mg of Barx1 expressing plasmid of pCol2 backbone (based on p100 plate) was transiently transformed to ATDC5 chondrocyte line (3) using Fucheene6 product of Roche, and the overexpression of chondrocytes was determined by Annexin-V binding. It confirmed by measuring a degree. The lentiviral used for gene overexpression was prepared using the pLentiM1.4 backbone, and a virus solution containing 10 ⁶ -10 ⁷ TU (transduction unit) per ml was used for the experiment. Overall virus production was made to order by Macrogen Co., Ltd.

FACS analyzes included in the present invention were performed as follows. The cell culture to be subjected to the TUNEL assay was trypsinized and then washed twice with PBS containing 5% eluted serum and 0.09% NaN ₃ , containing 10 mM HEPES (pH 7.4), 140 mM NaCl, 2.5 mM CaCl ₂ . Washed once more with 1 × Annexin-V binding buffer. In this state, the Annexin-V-FITC purchased from BD Science was reacted with the cells at room temperature for 20 minutes, and then fluorescently labeled cells were quantitatively measured using a FA Sciencecaliber instrument of BD Science.

TUNEL assay fixed cell cultures of the target cells with 2% paraformaldehyde, performed cell membrane permeabilization with a solution containing 0.1% sodium citrate and 0.1% Triton-X-100, followed by apoptosis. Detection was performed by Roche's In Situ Cell Death Detection kit according to the user's instructions.

Survival Changes of Chondrocytes by Barx1 Knockdown

In order to confirm the inhibitory effect of chondrocyte death by Barx1 knockdown, the extent of Annexin-V binding was measured for the viability of ATDC5 chondrocytes that specifically inhibited Barx1 expression.

The shRNA lentivirus solutions for Barx1 RNA knockdown experiments were prepared as follows. HEK293T (CRL-11268) cells purchased from ATCC were incubated for 24 hours using DMEM without penicillin-streptomycin (containing 10% FBS) medium to reach 60% confluency, followed by pLKO .1 Control vectors (Openbiosystems Cat.No.RHS4080) and human Barx1 specific shRNA constructs (Openbiosystems Cat.No.RHS3979-9584168, hairpin sequence: CCGGCGGCCCAAGAAGAACTCAATTCTCGAGAATTGAGTTCTTCTTGGGCCGTTTTT) were respectively transduced. The next day, after replacing with 10 ml of DMEM (containing 10% FBS) medium containing penicillin-streptomycin, the supernatant was taken 48 hours later and used for RNA knockdown experiments. The cell culture to be used for RNA knockdown was prepared to be 60-70% confluence on the day of the experiment and 1 ml of the shRNA knockdown lentivirus prepared above was added to 8 mg / ml in DMEM containing penicillin-streptomycin (containing 10% FBS). Was infected by mixing with 1 ml of medium to which polybrene was added. After 24 hours, the medium was replaced with 1 ml of fresh DMEM containing 10% FBS containing penicillin-streptomycin and after 24 hours the cell culture was used for various assays.

Observation of Barx1 Expression in Patients with Degenerative Arthritis

Total protein of chondrocytes isolated from articular cartilage of normal and degenerative arthritis patients was isolated and Western blotting analysis for GAPDH and Barx1 was performed in the same way.

Killing of Chondrocytes in Patients with Degenerative Arthritis

The viability of chondrocytes in normal subjects and patients with degenerative arthritis was examined by FACS analysis by measuring the degree of binding of Annexin-V as described above.

Experiment result

Inhibition of Ubiquitinylation of I-κB Protein by Barx1

Based on the fact that Nkx3.2 and Barx1 show complementary expression patterns (Fig. 4) in cartilage tissues during embryonic development, the present inventors became interested in Barx1 as a target for treating arthritis. As a result, the present inventors demonstrated for the first time that Barx1 is involved in the regulation of apoptosis of chondrocytes. First, the present inventors confirmed that Barx1 effectively inhibits ubiquitination (1) of N-kB3-induced ubiquitination (1) for the activation of NF-κB (FIG. 5). In addition, it was observed that NF-κB transcriptional function activation (1) induced by Nkx3.2 was significantly inhibited by Barx1 (FIG. 6). The above results demonstrate that Barx1 can effectively inhibit the NF-κB activation of Nkx3.2.

Block formation of Nkx3.2 and I-κB by binding between Barx1 and Nkx3.2

As a result of immunoprecipitation with anti-Myc antibodies, the binding of I-κB protein (1), which Nkx3.2 is essential for NF-κB activation, can be blocked by direct protein binding between Barx1 and Nkx3.2. It was confirmed. As shown in FIG. 7, it was observed that protein binding between Nkx3.2 and I-κB is significantly inhibited when Barx1 is overexpressed together. In addition, FIG. 7 shows that protein binding between Nkx3.2 and Barx1 takes precedence over protein binding between Nkx3.2 and I-κB in an environment where Nkx3.2, I-κB and Barx1 coexist. This allows for interpretation at the molecular level of the experimental results observed in FIGS. 5 and 6.

Survival Changes of Chondrocytes by Barx1 Overexpression and Knockdown

As a result demonstrating that the observed results are actually associated with the regulation of chondrocyte death, the overexpression of Barx1 was found to be significantly higher in chondrocytes overexpressing Barx1 than in the control vector. It was confirmed that it promotes death (FIG. 8), and it was observed that 50-70% reduction in the death of chondrocytes inhibited by Barx1 expression by RNA knockdown experiment technique (FIG. 9). These results suggest that the balance between chondrocyte apoptosis activity of Barx1 and chondrocyte apoptosis inhibitory activity of Nkx3.2 is essentially related to the survival of chondrocytes.

Expression of Barx1 in Patients with Degenerative Arthritis

As a definitive clue that Barx1's chondrocyte death control function is directly linked to degenerative arthritis, Western blotting confirmed that the expression of Barx1 was significantly increased in chondrocytes isolated from degenerative arthritis patient tissues compared to normal. (FIG. 10). This is exactly the same as the results of previous Barx1 overexpression experiments, and it is an important finding to deduce that increased expression of Barx1 following the onset of degenerative arthritis inhibited the survival of articular chondrocytes, as well as a new biomarker for degenerative arthritis. It can be used as an example.

Killing of Chondrocytes in Patients with Degenerative Arthritis

As a further experiment to support this, FACS analysis was performed by measuring the degree of binding of Annexin-V. As a result, a significantly higher level of cell death was observed in articular chondrocytes isolated from patients with degenerative arthritis (Fig. 11). In addition, apoptosis induced by treatment of BAY 11-7085, an inhibitor of activity against NF-κB (1) that Nkx3.2 activates for the survival of chondrocytes, was clearly observed in chondrocytes of patients with degenerative arthritis. 11).

The above results suggest that the cartilage cell death-promoting activity of Barx1, which is increased with the onset of degenerative arthritis, is closely related to the progression of degenerative arthritis with the function of inhibiting cartilage cell death of Nkx3.2.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

references

Park, M., Yong, Y., Choi, SW, Kim, JH, Lee, JE, and Kim, DW Constitutive RelA activation mediated by Nkx3.2 controls chondrocyte viability. Nat . Cell Biol . 9: 287-298 (2007).

Vicki Church, V., Yamaguchi, K., Tsang, P., Akita, K., Logan, C., Francis-West, P. Expression and function of Bapx1 during chick limb development. Anat . Embryol . 209: 461469 (2005).

3.Atsumi, T., Miwa, Y., Kimata, K. & Ikawa, Y. A chondrogenic cell line derived from a differentiating culture of AT805 teratocarcinoma cells. Cell Differ . Dev . 30: 109-16 (1990).

4. Harlow E., and Lane D. In: Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988).

Attach an electronic file to a sequence list

Claims (16)

A composition for preventing or treating degenerative arthritis, comprising a nucleic acid molecule that inhibits the expression of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2 sequence.
According to claim 1, wherein the nucleotide sequence is degenerative arthritis preventing or treating composition, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 1 sequence.
The composition for preventing or treating degenerative arthritis according to claim 1, wherein the nucleic acid molecule is shRNA, siRNA, miRNA, ribozyme, peptide nucleic acids or antisense oligonucleotides.
4. The composition for preventing or treating degenerative arthritis according to claim 3, wherein the nucleic acid molecule is shRNA.
The composition for preventing or treating degenerative arthritis according to any one of claims 1 to 4, wherein the nucleic acid molecule is contained in a gene delivery system. delete delete delete delete delete delete delete delete delete delete delete

Images