WO2010109168A2

WO2010109168A2 - Angiogenesis methods, medicaments and agents

Info

Publication number: WO2010109168A2
Application number: PCT/GB2010/000516
Authority: WO
Inventors: David Alan Baker; Mark Guido Roukens
Original assignee: Academisch Ziekenhuis Leiden Also Acting Under The Name "Leiden University Medical Center" (Lumc)
Priority date: 2009-03-23
Filing date: 2010-03-23
Publication date: 2010-09-30
Also published as: GB0904904D0; WO2010109168A3

Abstract

A method of modulating angiogenesis in an individual in need thereof comprising administering an agent that modulates at least one function or activity of TeI to the individual. A method of identifying a modulator of angiogenesis comprising: a) providing TeI or a portion or a variant thereof, said portion or variant being capable of binding to at least one of DNA and CtBP; b) providing a test agent; c) assessing whether the test agent modulates at least one function or activity of TeI; and d) assessing whether the test agent modulates angiogenesis in an assay for angiogenesis.

Description

ANGIOGENESIS METHODS, MEDICAMENTS AND AGENTS

This invention relates to angiogenesis and in particular methods for modulating angiogenesis, as well as medicaments and agents for use in methods for modulating angiogenesis.

The listing or discussion of a prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.

Angiogenesis refers to the development of new blood vessels from the walls of existing small vessels by the outgrowth of endothelial cells. It is a vital process in neonatal growth, but is also important in wound healing and in the pathogenesis of a large variety of clinical diseases including tissue inflammation, arthritis, tumour growth, diabetic retinopathy, macular degeneration by neovascularization of retina and the like conditions. Clinical manifestations associated with angiogenesis are commonly referred to as angiogenic diseases (Folkman et al (1987) Science 235: 442-447). Angiogenesis is generally absent in adult or mature tissues, although it does occur in wound healing and in the corpeus leuteum growth cycle (Moses et a/ (1990) Science 248: 1408-1410).

Angiogenic disease stems from the excessive or insufficient growth of new blood vessels. For example, the formation of new endothelial sprouts is widely recognised as a rate-limiting process in the growth of solid tumours, with tumours that fail to attract a blood supply being severely limited in their growth. Thus, the ability to modulate angiogenesis, for example by inhibiting inappropriate or undesirable angiogenesis or enhancing angiogenesis where it is required, may be useful in the treatment of a broad array of clinical diseases. However, despite enormous effort over the past two decades, to date, effective treatments for angiogenic diseases have failed to emerge.

The inventors have now identified a new pathway for the genetic control of angiogenesis which has unveiled new targets for the development of angiogenic modulators. Specifically, the inventors have identified TeI as a master regulator of angiogenesis, which functions by forming a complex with CtBP. TeI is a member of the ETS family of transcription factors that has previously been shown to be involved in a number of chromosomal translocations in human leukaemias (Kwiatkowski et al (1998) J Biol Chem 273(28): 17525-17530). It has a highly conserved ETS DNA-binding domain at the C- terminal region and a SAM protein interaction domain. Without wishing to be bound by any theory, the inventors believe that TeI regulates angiogenesis by binding to or interacting with or down regulating inhibitors of angiogenesis. Therefore, inhibiting TeI would have the effect of increasing the activity of angiogenesis inhibitors and thus inhibiting angiogenesis. By forming a complex with the redox sensor CtBP, the inventors believe that regulation of angiogenesis is tightly linked to metabolic state. As such, targeting the activity of TeI and CtBP, for example through the production of small molecule inhibitors or enhancers, represents a new approach to the problem of modulating aberrant angiogenesis.

Accordingly, a first aspect of the invention provides a method of modulating angiogenesis in an individual in need thereof comprising administering an agent that modulates at least one function or activity of TeI to the individual.

The invention includes an in vitro method of modulating angiogenesis comprising administering an agent that modulates at least one function or activity of TeI to tissue or cells in vitro.

The invention includes the use of an agent that modulates at least one function or activity of TeI in the manufacture of a medicament for modulating angiogenesis in an individual in need thereof.

The invention includes an agent that modulates at least one function or activity of TeI for use in modulating angiogenesis in an individual in need thereof.

By TeI' we include human TeI, the amino sequence of which is provided in Figure 1A and the cDNA sequence of which is provided in Figure 1 B. Thus, preferably the agent is one which modulates at least one function or activity of human TeI as defined in Figure 1. However, it is well known that certain polypeptides are polymorphic, and it is appreciated that some natural variation of this sequence may occur. Thus, in an embodiment, the agent may be one that modulates at least one function or activity of a naturally occurring variant of human TeI, in which one or more of the amino acid residues have been replaced with another amino acid. The agent may also be one that modulates at least one function or activity of an orthologue of TeI in another species, for example TeI from a horse, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate. It will be appreciated, that when the agent is administered to a particular individual, the agent is one that modulates at least one function or activity of TeI from the same species as the individual. Thus, when the individual is human, the agent modulates at least one function or activity of human TeI, and so on.

The individual may be a human or mammalian individual, such as a horse, dog, pig, cow, sheep, rat, mouse, guinea pig or primate. Preferably, the individual is a human individual.

By 'an agent that modulates at least one function or activity of TeI' we include the meaning of an agent that affects any one or more functions or activities of the TeI protein. For example, the agent may be one that modulates at least one of: binding of TeI to a TeI binding partner; TeI transcription factor activity; cellular location of TeI; and production of TeI in a cell.

By a TeI binding partner, we mean a molecule that binds to TeI. Preferably, the molecule binds selectively to TeI. For example, it is preferred if the binding partner has a K_d value (dissociation constant) which is at least 5 or 10 times lower (i.e. higher affinity) than for at least one other protein (eg transcription factor) and more preferably more than 100 or 500 or 1000 or 5000 times lower. Preferably, the binding partner is any of DNA, CtBP, histone deacetylase (HDAC) or protein inhibitor of activated STAT (PIAS). By HDAC, we include any HDAC, preferably a human HDAC such as any of those described in Dokmonavic et al (2007) MoI Cane Res 5(10):981. By PIAS, we include any PIAS, preferably a human PIAS such as any of those described in Roukens et al (2008) MoI Cell Biol 28(7): 2342.

It is preferred if the said agent is one that modulates binding of TeI to CtBP or binding of TeI to DNA.

In a particularly preferred embodiment, the agent is one that modulates binding of TeI to CtBP. Thus, the invention provides a method of modulating angiogenesis in an individual in need thereof comprising administering an agent that modulates binding of TeI to CtBP; the invention includes an in vitro method of modulating angiogenesis comprising administering an agent that modulates binding of TeI to CtBP to tissue or cells in vitro; the invention includes the use of an agent that modulates binding of TeI to CtBP in the manufacture of a medicament for modulating angiogenesis in an individual in need thereof; and the invention includes an agent that modulates binding of TeI to CtBP for use in modulating angiogenesis in an individual in need thereof. The agent may be any of a polypeptide, an antibody, a small molecule, a natural product, a peptidomimetic or a nucleic acid that modulates at least one function or activity of TeI. Particular examples of what the agent may be are provided below.

As mentioned above, the inventors have demonstrated that an important activity of TeI, involved in its role as a regulator of angiogenesis, is the ability to bind to CtBP (see Example 1). CtBP is a redox sensor whose activity depends on the binding of the metabolite NAD(H), and so the TeI-CtBP interaction represents an important link between angiogenesis and metabolism. Further, the inventors have shown that both TeI and CtBP are indispensable for endothelial sprouting.

Thus in a preferred embodiment, the agent is one which modulates the ability of TeI to bind to CtBP.

It is appreciated that the agent may modulate the ability of TeI to bind to CtBP directly (eg by binding to TeI or CtBP) or indirectly (eg by modulating the activity of another agent involved in the TeI-CtBP interaction). With regard to the agent having an indirect effect, owing to CtBP's involvement in cellular metabolism, the inventors believe that agents which alter cellular metabolism (eg changing NAD(H) concentration) may influence Tel's ability to bind to CtBP.

By 'CtBP' we include human CtBPI and CtBP2, the amino sequences of which are provided in Figures 2A and 2C respectively, and the cDNA sequences of which are listed in Figures 2B and 2D respectively. However, it is well known that certain polypeptides are polymorphic, and it is appreciated that some natural variation of these sequences may occur such that natural variants of these sequences are also included. We also include CtBP orthologues in other species, for example CtBP from horse, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate.

It is particularly preferred if the agent is one which modulates the Tel-CtBP2 interaction since the inventors have shown that TeI has a higher affinity for CtBP2. However, agents that modulate the TeI-CtBPI interaction are also of value. In particular, since CtBPI and CtBP2 can bind to each other, either of CtBPI or CtBP2 may associate with TeI indirectly. Therefore, in one embodiment, the agent which modulates binding of TeI to CtBP is CtBPI which may modulate binding of TeI to CtBP2, and in another less preferred embodiment, the agent which modulates binding of TeI to CtBP is CtBP2 which may modulate binding of TeI to CtBPI . The inventors have aligned the C-terminal regions of TeI from different species to reveal a strongly conserved CtBP-binding motif (Figure 3). Specifically, they have demonstrated that the PxEIM motif (SEQ ID No: 1) in the C-terminal region is necessary for CtBP binding.

Accordingly in another embodiment, the agent is a portion of TeI comprising the peptide PxEIM (SEQ ID No: 1) where x is any amino acid. By virtue of the PxEIM (SEQ ID No: 1) peptide binding to CtBP such an agent will act as a competitive inhibitor where both TeI and the agent compete for binding to CtBP. Preferably, the portion of TeI comprising the peptide PxEIM (SEQ ID No: 1) cannot bind to DNA and so is unable to function as a transcription factor. Thus, the portion may not comprise part of or may not comprise the entire ETS DNA-binding domain of TeI.

Conveniently, the portion of TeI comprising the peptide PxEIM (SEQ ID No: 1) is less than 400, 350, 300, 250, 200, 150 or 100 amino acids, for example less than 90, 80, 70 or 60 amino acids, and is typically less than 50 amino acids, for example less than 45, 40, 35, 30, 25, 20, 15 or 10 amino acids.

Examples of portions of TeI comprising the peptide PxEIM (SEQ ID No: 1) include any portion of the C-terminus of TeI comprising the PxEIM (SEQ ID No: 1 ) peptide. Thus, the agent may be the C-terminus of TeI as listed in Figure 2F or any of the peptides listed in Figure 3A, or portions thereof which comprise the PxEIM (SEQ ID No: 1) peptide. The agent may comprise or consist of the C-terminal 34 amino acids of TeI which comprises the PxEIM (SEQ ID No: 1) peptide.

By 'portions' of TeI, we also include portions of variants of TeI. Variations include insertions, deletions and substitutions, either conservative or non-conservative. By "conservative substitutions" is intended combinations such as GIy, Ala; VaI, lie, Leu; Asp, GIu; Asn, GIn; Ser, Thr; Lys, Arg; and Phe, Tyr. Thus, we include portions of variants of human TeI, the sequence of which is provided in Figure 1. Preferably, the portion of TeI shares at least 60% sequence identity, for example at least 65%, 70%, 75%, 80% and 85% sequence identity and more preferably 90%, 95% or 99% sequence identity with human TeI over the length of the portion.

It will also be appreciated that the agent may be a peptidomimetic that mimics the CtBP- binding site in TeI, and so competes with TeI for CtBP binding. For example, a peptidomimetic may be engineered to mimic the PxEIM binding motif. Methods of designing and synthesising peptidomimetics are known in the art and are described in more detail below.

The inventors have also shown that amino acid residues Alanine-58 and Valine-72 within the substrate binding cleft of CtBP2 are necessary for binding to TeI. Thus, in another embodiment, the agent is a portion of CtBP2 comprising the amino acid residues Alanine-58 and Valine-72 such as a portion of CtBP2 comprising the substrate binding domain of CtBP2, the amino acid sequence of which is provided in Figure 2H. By virtue of the residues binding to TeI, such an agent will act as a competitive inhibitor where both CtBP and the agent compete for binding to TeI. Preferably the portion of CtBP2 comprising the amino acid residues Alanine-58 and Valine-72 cannot bind to NAD(H) and so may not contain the entire NAD(H) substrate binding region.

The amino acids corresponding to Alanine-58 and Valine-72 in CtBPI are Alanine-52 and Valine-66. Thus, in another embodiment the agent is a portion of CtBPI comprising the amino acid residues Alanine-52 and Valine-66 such as a portion of CtBPI comprising the substrate binding domain of CtBPI , the amino acid sequence of which is provided in Figure 2H. Preferably the portion of CtBPI comprising the amino acid residues Alanine- 52 and Valine-66 cannot bind to NAD(H) and so may not contain the entire NAD(H) substrate binding region.

Conveniently, the portion of CtBP2 or CtBPI comprising amino acid residues Alanine-58 and Valine-72 or Alanine-52 and Valine-66 as the case may be, is less than 400, 350, 300, 250, 200, 150 or 100 amino acids, for example less than 90, 80, 70 or 60 amino acids, and is typically less than 50 amino acids, for example less than 45, 40, 35, 30 or 25 amino acids (e.g. 24, 23, 22, 21 , 20, 19, 18, 17, 16 or 15 amino acids). It is appreciated that smaller peptides which retain TeI binding specificity are preferred, for example peptides which are about 20 amino acids in length.

By 'portions' of CtBP, we also include portions of variants of CtBP. Variations include insertions, deletions and substitutions, either conservative or non-conservative. By "conservative substitutions" is intended combinations such as GIy, Ala; VaI, He, Leu; Asp, GIu; Asn, GIn; Ser, Thr; Lys, Arg; and Phe, Tyr. Thus, we include portions of variants of human CtBPI or CtBP2, the sequences of which are provided in Figures 2A and 2C respectively. Preferably, the portion of CtBPI or CtBP2 shares at least 60% sequence identity, for example at least 65%, 70%, 75%, 80% and 85% sequence identity and more preferably 90%, 95% or 99% sequence identity with human CtBPI or CtBP2 over the length of the portion.

It will be also appreciated that the agent may be a peptidomimetic that mimics the Tel- binding site in CtBP, and so competes with CtBP for TeI binding. For example, a peptidomimetic may be engineered to mimic a portion of CtBP2 that comprises amino acid residues Alanine-58 and Valine-72 or a portion of CtBPI that comprises amino acid residues Alanine-52 and Valine-66 such as portions comprising the substrate binding domains described in Figure 2H. Methods of designing and synthesising peptidomimetics are known in the art and are described in more detail below.

The percent sequence identity between two polypeptides may be determined using any suitable computer program, for example the GAP program of the University of Wisconsin Genetic Computing Group and it will be appreciated that percent identity is calculated in relation to polypeptides whose sequence has been aligned optimally. The alignment may alternatively be carried out using the Clustal W program (Thompson et a/., 1994). The parameters used may be as follows: Fast pairwise alignment parameters: K- tuple(word) size; 1 , window size; 5, gap penalty; 3, number of top diagonals; 5. Scoring method: x percent. Multiple alignment parameters: gap open penalty; 10, gap extension penalty; 0.05. Scoring matrix: BLOSUM.

Another method of modulating the TeI-CtBP interaction is to use antibodies to regions of each protein that are involved either directly or indirectly in the interaction. For example, an antibody to a substrate binding site may directly block binding of the substrate. Alternatively, the antibody may bind to a region outside of the substrate binding site that is nevertheless required for a stable interaction and so indirectly affects binding.

Thus, in a further embodiment, the agent is an antibody that binds specifically to a particular region in TeI or CtBP, which region is important for the TeI-CtBP interaction.

For example, the antibody may bind to the PxEIM (SEQ ID No: 1) motif in TeI where x is any amino acid or may bind to the sterile alpha motif (SAM) domain of TeI. The inventors have shown that the PxEIM (SEQ ID No: 1) motif in TeI is essential for CtBP binding and so an antibody that binds to this motif will block CtBP binding. Similarly, the inventors have shown that TeI oligomerisation is required for CtBP binding. In particular, the SAM domain in the N-terminus of TeI is essential for TeI function by allowing self- association of TeI and for binding to co-factors. Loss of the SAM domain means that TeI is no longer able to oligomerise and thus can no longer function as a transcription factor, nor can it bind to CtBP since CtBP appears only to bind functional oligomers of TeI. Thus, an antibody that binds to the SAM domain of TeI such that oligomerisation is prevented will also reduce CtBP binding. The amino acid sequence of the SAM domain is provided in Figure 2G.

Further, the agent may be an antibody that binds to one or both of amino acids Alanine- 58 and Valine-72 within CtBP2 or an antibody that binds to one or both of Alanine-52 and Valine-66 in CtBPI; or an antibody that binds to the oligomerisation domain of CtBPI or CtBP2, the sequences of which are provided in Figure 21; or an antibody that binds to the N-terminal 10 amino acids of CtBP2. Alanine-58 and Valine-72 are believed to contact the PxEIM motif in TeI and so an antibody that binds one or both of these amino acids will block binding to TeI, as would an antibody that binds to one or both of the equivalent amino acids in CtBPI , namely Alanine-52 and Valine-66. The inventors have demonstrated that mutations in the dimerisation interface of CtBP abolished binding to TeI and so antibodies that bind to the oligomerisation domain of CtBP such that dimerisation is prevented will necessarily reduce binding to TeI. The inventors also demonstrate that the positively charged N-terminus of CtBP2 promotes stable high affinity binding to TeI and so an antibody that binds to the N-terminal 10 amino acids of CtBP2 will reduce TeI binding.

Another function or activity of TeI that the agent may modulate is the ability of TeI to bind to DNA. TeI is an ETS family transcription factor that binds to DNA by virtue of its ETS DNA binding domain. An agent that interferes with binding of TeI to DNA may therefore be used to modulate Tel's function as a transcription factor.

Thus, in one embodiment the agent is an antibody that binds to the ETS DNA-binding domain of TeI. In this case, binding to the DNA binding domain of TeI will prevent TeI from binding to DNA promoter sequences and therefore prevent it from regulating the expression of target genes.

In an alternative embodiment, the agent may be a portion of TeI that comprises or consists of the ETS DNA-binding domain, the amino acid sequence of which is provided in Figure 2F. Such an agent will compete with TeI for DNA binding and so act as a competitive inhibitor. Preferably, the portion of TeI that comprises the ETS DNA-binding site cannot bind to CtBP and cannot interact with other transcription factors or proteins, such that it cannot exert any transcriptional regulation by itself. Thus, the portion of TeI that comprises the ETS DNA-binding site may lack all or a portion of the SAM domain of TeI which is important in CtBP binding and for recruiting cofactors. It is particularly preferred if such a portion consists solely of the ETS DNA-binding domain.

Conveniently, the portion of TeI comprising the ETS DNA-binding domain is less than 400, 350, 300, 250, 200, 150, 140, 130, 120, 110, 100, 95, 90 or 85 amino acids.

It will be also appreciated that the agent may be a peptidomimetic that mimics the ETS DNA-binding domain in TeI and so competes with TeI for DNA binding, i.e. the peptidomimetic targets the ETS DNA-binding site such as to competitively disrupt TeI binding to DNA. Methods of designing and synthesising peptidomimetics are known in the art and are described in more detail below.

The inventors have shown that TeI is involved in the regulation of various angiogenic factors including matrix metallo-proteases (MMPs)-I, 2, 3, 8, 9 and 14, delta-4, VE- Cadherin, Spry-2, Spry-4, hey 1 and hey 2. Thus in another embodiment, the agent is one which modulates the transcription factor activity of TeI. It is appreciated that agents that affect the ability of TeI to bind to DNA and the ability of TeI to bind to CtBP will affect Tel's transcription factor activity; however agents may also affect the transcription factor activity by preventing it from interacting with other transcription factors or proteins. Therefore, the agent may be an antibody that binds to the SAM domain of TeI, such that its interaction with other transcription factors or proteins is reduced. Alternatively, the agent may be a portion of TeI that comprises or consists of the SAM domain. Such an agent will compete with TeI for binding to other transcription factors or proteins and so act as a competitive inhibitor. Preferably the portion of TeI that comprises the SAM domain cannot bind to DNA and so may lack the ETS DNA-binding domain.

Conveniently, the portion of TeI comprising the SAM domain is less than 400, 350, 300, 250, 200, 150, 100, 90 or 80 amino acids.

It will also be appreciated that the agent may be a peptidomimetic that mimics the SAM domain of TeI.

The inventors have shown that the interaction between TeI and CtBP is important for localisation of TeI to the nucleus. Thus in another embodiment, the agent is one which modulates the cellular location of TeI such as between the nucleus and the cytoplasm. Although TeI does not harbour a 'classic' nuclear localisation signal, the ETS DNA- binding domain of TeI and the C-terminus (containing the PxEIM (SEQ ID No: 1) motif) are known to be important in localising TeI to the nucleus. Therefore, the agent may be an antibody that binds to the ETS DNA-binding domain of TeI or an antibody that binds to the C terminus of TeI (containing the PxEIM (SEQ ID No: 1) motif).

As used herein, the term "antibody" includes but is not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by a Fab expression library. Such fragments include fragments of whole antibodies which retain their binding activity for a target substance, Fv, F(ab') and F(ab')2 fragments, as well as single chain antibodies (scFv), fusion proteins and other synthetic proteins which comprise the antigen-binding site of the antibody. Also included are domain antibodies (dAbs), diabodies, camelid antibodies and engineered camelid antibodies. Furthermore, for administration to humans, the antibodies and fragments thereof may be humanised antibodies, which are now well known in the art (Janeway et al (2001) Immunobiology., 5th ed., Garland Publishing).

Suitable antibodies described above that bind to particular regions of TeI or CtBP, can be made by the skilled person using technology long-established in the art. Methods of preparation of monoclonal antibodies and antibody fragments are well known in the art and include hybridoma technology (Kohler & Milstein (1975) "Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256: 495-497); antibody phage display (Winter et al (1994) "Making antibodies by phage display technology." Annu. Rev. Immunol. 12: 433-455); ribosome display (Schaffitzel et a/ (1999) "Ribosome display: an in vitro method for selection and evolution of antibodies from libraries." J. Immunol. Methods 231 : 119-135); and iterative colony filter screening (Giovannoni et al (2001 ) "Isolation of anti-angiogenesis antibodies from a large combinatorial repertoire by colony filter screening." Nucleic Acids Res. 29: E27). Further, antibodies and antibody fragments suitable for use in the present invention are described, for example, in the following publications: "Monoclonal Hybridoma Antibodies: Techniques and Application", Hurrell (CRC Press, 1982); "Monoclonal Antibodies: A Manual of Techniques", H. Zola, CRC Press, 1987, ISBN: 0-84936-476-0; "Antibodies: A Laboratory Manuar 1^st Edition, Harlow & Lane, Eds, Cold Spring Harbor Laboratory Press, New York, 1988. ISBN 0- 87969-314-2; "Using Antibodies: A Laboratory Manuar 2^nd Edition, Harlow & Lane, Eds, Cold Spring Harbor Laboratory Press, New York, 1999. ISBN 0-87969-543-9; and "Handbook of Therapeutic Antibodies" Stefan Dϋbel, Ed., 1^st Edition, - Wiley-VCH, Weinheim, 2007. ISBN: 3-527-31453-9. The term "peptidomimetic" refers to a compound that mimics the conformation and desirable features of a particular peptide as a therapeutic agent, but that avoids the undesirable features. For example, morphine is a compound which can be orally administered, and which is a peptidomimetic of the peptide endorphin.

There are a number of different approaches to the design and synthesis of peptidomimetics. In one approach, such as disclosed by Sherman and Spatola (1990) J. Am. Chem. Soc. 112: 433, one or more amide bonds have been replaced in an essentially isoteric manner by a variety of chemical functional groups. This stepwise approach has met with some success in that active analogues have been obtained. In some instances, these analogues have been shown to possess longer biological half- lives than their naturally-occurring counterparts. Nevertheless, this approach has limitations. Successful replacement of more than one amide bond has been rare. Consequently, the resulting analogues have remained susceptible to enzymatic inactivation elsewhere in the molecule. When replacing the peptide bond it is preferred that the new linker moiety has substantially the same charge distribution and substantially the same planarity as a peptide bond.

Retro-inverso peptidomimetics, in which the peptide bonds are reversed, can be synthesised by methods known in the art, for example such as those described in Meziere et al (1997) J. Immunol. 159 3230-3237. This approach involves making pseudopeptides containing changes involving the backbone, and not the orientation of side chains. Retro-inverse peptides, which contain NH-CO bonds instead of CO-NH peptide bonds, are much more resistant to proteolysis.

In another approach, a variety of uncoded or modified amino acids such as D-amino acids and N-methyl amino acids have been used to modify mammalian peptides. Alternatively, a presumed bioactive conformation has been stabilised by a covalent modification, such as cyclisation or by incorporation of γ-lactam or other types of bridges. See, eg, Veber et al (1978) Proc. Natl. Acad. Sci. USA, 75: 2636 and Thursell et al (1983) Biochem. Biophys. Res. Comm. 111: 166.

A common theme among many of the synthetic strategies has been the introduction of some cyclic moiety into a peptide-based framework. The cyclic moiety restricts the conformational space of the peptide structure and this frequently results in an increased affinity of the peptide for a particular biological receptor. An added advantage of this strategy is that the introduction of a cyclic moiety into a peptide may also result in the peptide having a diminished sensitivity to cellular peptidases.

One approach to the synthesis of cyclic stabilised peptidomimetics is ring closing metathesis (RCM). This method involves steps of synthesising a peptide precursor and contacting it with a RCM catalyst to yield a conformational^ restricted peptide. Suitable peptide precursors may contain two or more unsaturated C-C bonds. The method may be carried out using solid-phase-peptide-synthesis techniques. In this embodiment, the precursor, which is anchored to a solid support, is contacted with a RCM catalyst and the product is then cleaved from the solid support to yield a conformationally restricted peptide.

Another approach, disclosed by D. H. Rich in Protease Inhibitors, Barrett and Selveson, eds., Elsevier (1986), has been to design peptide mimics through the application of the transition state analogue concept in enzyme inhibitor design. For example, it is known that the secondary alcohol of staline mimics the tetrahedral transition state of the scissile amide bond of the pepsin substrate. However, the transition state analogue concept has no apparent relevance to hormone agonist/antagonist design.

Various other methodologies are known in the art for modulating at least one activity or function of TeI which can be applied in the context of the present invention. For example, the agent may be a specific regulator (i.e. inhibitor or enhancer) of TeI expression such that the production of TeI in a cell is modulated. Suitable inhibitors of TeI expression include Tel-specific RNAi, Tel-specific short hairpin RNA, use of Tel- specific antisense (eg Tel-specific morpholinos) and triplet-forming oligonucleotides, and Tel-specific ribozymes.

Thus in an embodiment, the agent is any of an antisense oligonucleotide, such as a morpholino, a short hairpin RNA (shRNA), a micro RNA (miRNA), a small interfering RNA (siRNA) or a ribozyme.

As is now well known in the art, suitable morpholinos, siRNA, shRNA, antisense or ribozyme agents can be made based on the knowledge of the TeI gene sequence provided in Figure 1 B. Particular examples of suitable TeI shRNA sequences that may be used are provided in Example 1 and are commercially available, for example from Sigma Aldrich. RNAi is the process of sequence-specific post-transcriptional gene silencing in animals initiated by double stranded RNA (dsRNA) that is homologous in sequence to the silenced gene (siRNA; Hannon et al (2002) Nature 418 (6894): 244-51 ; Brummelkamp et al (2002) Science 21, 21; and Sui et al (2002) Proc. Natl. Acad. ScL USA 99, 5515- 5520). The mediators of sequence-specific mRNA degradation are typically 21- and 22- nucleotide small interfering RNAs (siRNAs) which, in vivo, may be generated by ribonuclease III cleavage from longer dsRNAs. Duplex siRNA molecules selective for CG can readily be designed by reference to the amino acid sequences listed above. Typically, the first 21-mer sequence that begins with an AA dinucleotide which is at least 120 nucleotides downstream from the initiator methionine codon is selected. The RNA sequence perfectly complementary to this becomes the first RNA oligonucleotide. The second RNA sequence should be perfectly complementary to the first 19 residues of the first, with an additional UU dinucleotide at its 3' end. Once designed, the synthetic RNA molecules can be synthesised using methods well known in the art.

Antisense oligonucleotides are single-stranded nucleic acids, which can specifically bind to a complementary nucleic acid sequence. By binding to the appropriate target sequence, an RNA-RNA, a DNA-DNA, or RNA-DNA duplex is formed. By binding to the target nucleic acid, antisense oligonucleotides can inhibit the function of the target nucleic acid. This may be a result of blocking the transcription, processing, poly(A)addition, replication, translation, or promoting inhibitory mechanisms of the cells, such as promoting RNA degradation. Typically, antisense oligonucleotides are 15 to 35 bases in length (Witters et a/ (1999) Breast Cancer Res Treat 53: 41-50 and Frankel et al (1999) J Neurosurg 91: 261-7). However, it is appreciated that it may be desirable to use oligonucleotides with lengths outside this range, for example 10, 11, 12, 13, or 14 bases, or 36, 37, 38, 39 or 40 bases. Thus, with knowledge of the TeI cDNA sequence, polynucleotide inhibitors of TeI expression can be produced using methods well known in the art.

Ribozymes are RNA molecules capable of cleaving targeted RNA or DNA. Examples of ribozymes are described in, for example, Cech & Herschlag "Site-specific cleavage of single stranded DNA" US 5,180,818; Altman et al "Cleavage of targeted RNA by RNAse P" US 5,168,053; Cantin et al "Ribozyme cleavage of HIV-1 RNA" US 5,149,796; Cech et a/ "RNA ribozyme restriction endoribonucleases and methods", US 5,116,742; Been et al "RNA ribozyme polymerases, dephosphorylases, restriction endonucleases and methods", US 5,093,246; and Been et al "RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods; cleaves single-stranded RNA at specific site by transesterification", US 4,987,071 , all incorporated herein by reference. Ribozymes specific for TeI can be designed by reference to the TeI cDNA sequence defined above using techniques well known in the art.

shRNA molecules are typically sourced from the Sigma Aldrich Mission Library (see Example 1). However, shRNA molecules may be designed based upon knowledge of the TeI sequence for example by using a program called Oligoengine that identifies sequences of your input sequence (eg TeI) against which suitable oligonucleotides can be made.

It is appreciated that the agent which modulates at least one function or activity of TeI may itself be a polynucleotide, such as an shRNA, an antisense oligonucleotide or a ribozyme. The agent may also be a polynucleotide encoding a polypeptide which modulates at least one function of activity of TeI.

As discussed above, the inventors find that TeI activates angiogenesis by binding to or interacting with or down regulating inhibitors of angiogenesis. Therefore, an agent that modulates at least one function or activity of TeI will also modulate angiogenesis and will thus have therapeutic value.

In one embodiment the agent is an inhibitor of at least one function or activity of TeI and angiogenesis is inhibited, i.e. the agent is an inhibitor of angiogenesis. For example, the agent may inhibit any of binding of TeI to a TeI binding partner (eg DMA, CtBP, HDAC, PIAS), TeI transcription factor activity nuclear localisation of TeI, and production of TeI in a cell.

It is preferred if agent is one that inhibits binding of TeI to CtBP (CtBPI or CtBP2), and particularly binding of TeI to CtBP2.

In this case, the individual in need thereof is one who has any one or more of the following conditions characterised by undesirable angiogenesis (eg excessive angiogenesis): cancer, psoriasis, atherosclerosis, menorrhagia, endometriosis, macular degeneration and glaucoma, arthritis (both inflammatory and rheumatoid), Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation. Thus, it is appreciated that the invention provides a method of combating any one or more of the following conditions: cancer, psoriasis, atherosclerosis, menorrhagia, endometriosis, macular degeneration and glaucoma, arthritis (both inflammatory and rheumatoid), Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation; the method comprising administering an agent that modulates at least one function or activity of TeI to an individual. Preferably, the agent is one that inhibits binding of TeI to CtBP (CtBPI or CtBP2), and particularly binding of TeI to CtBP2.

The invention provides the use of an agent that modulates at least one function or activity of TeI in the manufacture of a medicament for combating any one or more of the following conditions: cancer, psoriasis, atherosclerosis, menorrhagia, endometriosis, macular degeneration and glaucoma, arthritis (both inflammatory and rheumatoid), Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation. Preferably, the agent is one that inhibits binding of TeI to CtBP (CtBPI or CtBP2), and particularly binding of TeI to CtBP2.

The invention provides an agent that modulates at least one function or activity of TeI for use in combating any one or more of the following conditions: cancer, psoriasis, atherosclerosis, menorrhagia, endometriosis, macular degeneration and glaucoma, arthritis (both inflammatory and rheumatoid), Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation. Preferably, the agent is one that inhibits binding of TeI to CtBP (CtBPI or CtBP2), and particularly binding of TeI to CtBP2.

By "combating" we include the meaning that the method can be used to alleviate symptoms of the disorder (ie the method is used palliatively), or to treat the disorder, or to prevent the disorder (ie the method is used prophylactically).

By inhibiting angiogenesis we include the meaning of reducing the rate or level of angiogenesis. The reduction can be a low level reduction of at about 10%, or about 20%, or about 30%, or about 40% of the rate or level of angiogenesis. Preferably, the reduction is a medium level reduction of about 50%, or about 60%, or about 70%, or about 80% reduction of the rate or level of angiogenesis. More preferably, the reduction is a high level reduction of about 90%, or about 95%, or about 99%, or about 99.9%, or about 99.99% of the rate or level of angiogenesis. Most preferably, inhibition can also include the elimination of angiogenesis or its reduction to an undetectable level.

In one embodiment the agent is an enhancer of at least one function or activity of TeI and angiogenesis is enhanced, i.e. the agent is an enhancer of angiogenesis. For example, the agent may enhance any of binding of TeI to a TeI binding partner (eg DNA, CtBP, HDAC, PIAS), TeI transcription factor activity, nuclear localisation of TeI, and production of TeI in a cell.

It is preferred that the agent enhances the binding of TeI to CtBP (CtBPI or CtBP2), and particularly binding of TeI to CtBP2.

In this case, the individual in need thereof is one who has any one or more of the following conditions characterised by insufficient angiogenesis: ischaemia, myocardial infarction and conditions in which blood clotting and wound healing are impaired (eg haemophilia).

Thus, it is appreciated that the invention provides a method of combating any one or more of the following conditions: ischaemia, myocardial infarction and conditions in which blood clotting and wound healing are impaired (eg haemophilia); the method comprising administering an agent that modulates at least one function or activity of TeI to an individual. Preferably, the agent is one that inhibits binding of TeI to CtBP (CtBPI or CtBP2), and particularly binding of TeI to CtBP2.

The invention provides the use of an agent that modulates at least one function or activity of TeI in the manufacture of a medicament for combating any one or more of the following conditions: ischaemia, myocardial infarction and conditions in which blood clotting and wound healing are impaired (eg haemophilia). Preferably, the agent is one that inhibits binding of TeI to CtBP (CtBPI or CtBP2), and particularly binding of TeI to CtBP2.

The invention provides an agent that modulates at least one function or activity of TeI for use in combating any one or more of the following conditions: ischaemia, myocardial infarction and conditions in which blood clotting and wound healing are impaired (eg haemophilia). Preferably, the agent is one that inhibits binding of TeI to CtBP (CtBPI or CtBP2), and particularly binding of TeI to CtBP2. By enhancing angiogenesis we include the meaning of increasing the rate or level of angiogenesis. The enhancement can be a low level increase of about 10%, or about 20%, or about 30%, or about 40% of the rate or level of angiogenesis. Preferably, the enhancement is a medium level enhancement of about 50%, or about 60%, or about 70%, or about 80% enhancement of the rate or level of angiogenesis. More preferably, the enhancement is a high level enhancement of about 90%, or about 95%, or about 99% of the rate or level of angiogenesis.

Methods and assays for determining the rate or level of angiogenesis, and hence for determining whether and to what extent an agent enhances or inhibits angiogenesis, are known in the art.

For example, US Patent No. 6,225,118 B1 (Grant et al), incorporated herein by reference, describes a multicellular in vitro assay for modelling the combined stages of angiogenesis namely the proliferation, migration and differentiation stages of cell development.

The AngioKit, Catalogue No. ZHA-1000, by TCS CellWorks Ltd, Buckingham MK18 2LR, UK, is a suitable model of human angiogenesis for analysing the angiogenic or anti- angiogenic properties of test compounds.

The rate or level of angiogenesis can also be determined using the 3D cell culture assay described in Example 1 and adapted from Nakatsu & Hughes, 2008 (Methods in Enzymology AAZ: 65-82).

Angiogenesis may also be systematically visualised in vivo using the zebrafish embryo circulatory system based on the fN1a:gfp transgenic line (Lawson and Weinstein (2002) Devel Biol 248: 307-318), as described in Example 2. In this system, the flϋa.gfp transgenic line produces embryos in which all of the endothelial cells are marked by GFP and, coupled to the optically diaphanous nature of the embryos, this allows visualisation of in vivo angiogenesis.

Whilst it is possible for the agent that modulates at least one function or activity of TeI as described herein, to be administered alone, it is preferable to present it as a pharmaceutical formulation, together with one or more acceptable carriers. The carrier(s) must be "acceptable" in the sense of being compatible with the therapeutic agent and not deleterious to the recipients thereof. Typically, the carriers will be water or saline which will be sterile and pyrogen free.

Where appropriate, the formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient (agent that modulates at least one activity or function of TeI, eg binding of TeI to CtBP) with the carrier which constitutes one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

Formulations in accordance with the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The active ingredient may also be presented as a bolus, electuary or paste.

A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (e.g. povidone, gelatin, hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (e.g. sodium starch glycolate, cross-linked povidone, cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethylcellulose in varying proportions to provide desired release profile.

Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouth-washes comprising the active ingredient in a suitable liquid carrier. The agent that modulates at least one function or activity of TeI (eg binding of TeI to CtBP) can be administered in the form of a suppository or pessary, or they may be applied topically in the form of a lotion, solution, cream, ointment or dusting powder. The agent may also be transdermal^ administered, for example, by the use of a skin patch.

Preferred unit dosage formulations are those containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of an active ingredient.

It should be understood that in addition to the ingredients particularly mentioned above (agent that modulates at least one function or activity of TeI, eg binding of TeI to CtBP) the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.

The amount of the agent which modulates at least one function or activity of TeI (eg binding of TeI to CtBP) which is administered to the individual is an amount effective to combat the particular individual's condition. The amount may be determined by the physician.

The agent that modulates at least one function or activity of TeI (eg binding of TeI to CtBP) may be targeted to the required site of angiogenesis using a targeting moiety which binds to or lodges at the site of the angiogenesis. For example, the agent may be joined to an endothelial-restricted growth factor (eg VEGF, DLL4) as a targeting moiety. However, it is appreciated that since the majority of the vasculature is in a static non- angiogenic state, the agent should not adversely affect these vessels and will only influence aberrant sprouting associated with a pathological condition.

That the inventors have identified a new control pathway for angiogenesis involving TeI opens new possibilities for screening for modulators of angiogenesis. Accordingly, a second aspect of the invention provides a method of identifying a modulator of angiogenesis comprising: a) providing TeI or a portion or a variant thereof capable of binding to a TeI binding partner; b) providing a test agent; c) assessing whether the test agent modulates at least one function or activity of TeI; and d) assessing whether the test agent modulates angiogenesis in an assay for angiogenesis.

By a "modulator of angiogenesis" we include the meaning of an inhibitor or enhancer of angiogenesis as defined above.

By a portion or variant of TeI in the context of the second aspect of the invention, we include any portion or variant of TeI that is capable of binding to a binding partner of TeI. Preferably, the portion or variant of TeI is capable of binding to any of DNA, CtBP, HDAC or PIAS, and most preferably, the portion or variant of TeI is capable of binding to CtBP.

For example, the portion or variant of TeI may be capable of binding to a DNA promoter comprising a TeI binding site. DNA promoter sequences comprising a TeI binding site contain a GGA motif. Nye et al (1992) [Genes and Development 6: 975-990] discuss the interaction of ets-1 with GGA-binding sites and establish the ETS domain as a new DNA-binding motif. Thus, the portion or variant of TeI may be one that is capable of binding to a DNA promoter comprising the sequence GGA, such as a promoter comprising the sequence A GCCGGAA TGT C. Examples of particular DNA promoters comprising a TeI binding site include the promoters of the metallo metal protease (MMP)-I , MMP2, MMP3, MMP8, MMP9, MMP14, delta-4, VE-Cadherin, Spry-2, Spry-4, ld-1 , FIM , hey 1 and hey 2 genes. Thus, the portion or variant may be capable of binding to any one of these promoter sequences. Assessing whether a protein binds to a particular DNA sequence is standard practice in the art and is described in more detail below.

In a particular embodiment, the portion or variant of TeI comprises the Ets DNA binding domain the amino acid sequence of which is provided in Figure 2F.

Conveniently, the portion of TeI that is capable of binding to DNA is less than 400, 350, 300, 250, 200, 150, 140, 130, 120, 110, 100, 95, 90 or 85 amino acids.

Additionally or alternatively, the portion or variant of Tel may be capable of binding to CtBP. It is especially preferred if the portion or variant is capable of binding to CtBP2. Determining whether two proteins interact is routine practice in the art and is described in more detail below. In a particular embodiment, the portion or variant comprises the PxEIM (SEQ ID No: 1) motif of TeI where x is any amino acid and the SAM domain of TeI, both of which have been demonstrated by the inventors to be necessary for CtBP binding. Thus, the portion or variant of TeI may comprise the SAM domain of TeI and the C-terminus of TeI comprising the PxEIM (SEQ ID No: 1) motif (eg the C-terminal 34 amino acids of TeI).

Conveniently, the portion of TeI that is capable of binding to CtBP is less than 400, 390, 380, 370, or 360 amino acids.

Additionally or alternatively, the portion or variant of TeI may be capable of binding to another TeI binding partner (eg HDAC, PIAS). The SAM domain of TeI is important in recruiting other binding partners (eg cofactors) to TeI, and so in another embodiment, the portion or variant comprises the SAM domain of TeI.

Conveniently, the portion of TeI that is capable of binding to another TeI binding partner (eg HDAC, PIAS) is less than 400, 350, 300, 250, 200, 150, 140, 130, 120, 110 or 100 amino acids, for example less than 95, 90, 85, 80 or 75 amino acids.

By a variant of TeI we include variants of TeI that have at least 60% sequence identity to Human TeI, the sequence of which is provided in Figure 1 , for example at least 65%, 70%, 75%, 80% and 85% sequence identity and more preferably 90%, 95% or 99% sequence identity with human TeI.

It will be appreciated that the portions of TeI described above may also be portions of TeI variants. Typically, the portions of TeI have at least at least 60% sequence identity to Human TeI, the sequence of which is provided in Figure 1 , for example at least 65%, 70%, 75%, 80% and 85% sequence identity and more preferably 90%, 95% or 99% sequence identity with human TeI over the length of the portion.

The test agent may be any of a polypeptide, an antibody, a small molecule, a natural product, a peptidomimetic, or a nucleic acid.

In an embodiment, the test agent is a portion of TeI comprising the peptide PxEIM (SEQ ID No: 1) where x is any amino acid, such as defined above with respect to the first aspect of the invention. Thus, the test agent may be a portion of TeI that comprises the C-terminal 34 amino acids of TeI. In an embodiment, the test agent is a portion of TeI comprising the SAM domain.

In an embodiment, the test agent is a portion of TeI comprising the ETS DNA-binding domain.

In an embodiment, the test agent is a portion of CtBP2 comprising Alanine-58 and Valine-72 such as defined in the first aspect of the invention or a portion of CtBPI comprising Alanine-52 and Valine-66 such as defined in the first aspect of the invention.

In an embodiment, the test agent is a peptidomimetic that mimics the CtBP-binding site in TeI, a peptidomimetic that mimics the Tel-binding site in CtBP, a peptidomimetic that mimics the SAM domain in TeI or a peptidomimetic that mimics the ETS DNA-binding domain of TeI such as defined in the first aspect of the invention.

In an embodiment, the test agent is an antibody that binds to the PxEIM (SEQ ID No: 1) motif in TeI where x is any amino acid or an antibody that binds to the SAM domain of TeI, or an antibody that binds to the ETS DNA-binding domain of TeI such as defined in the first aspect of the invention.

In an embodiment, the test agent is an antibody that binds to one or both of amino acids Alanine 58 and Valine 72 within CtBP2, an antibody that binds to one or both of amino acids Alanine-52 and Valine-66 within CtBPI or an antibody that binds to the oligomerisation domain of CtBP or an antibody that binds to the N-terminal 10 amino acids of CtBP2, such as defined in the first aspect of the invention.

It is particularly preferred if the test agent is a small molecule (e.g. small molecule with a molecule weight less than 5000 daltons, for example less than 4000, 3000, 2000 or 1000 daltons, or with a molecule weight less than 500 daltons, for example less than 450 daltons, 400 daltons, 350 daltons, 300 daltons, 250 daltons, 200 daltons, 150 daltons, 100 daltons, 50 daltons or 10 daltons).

It is appreciated that in some instances high throughput screening of test agents is preferred and that the method may be used as a "library screening" method, a term well known to those skilled in the art. Thus, the test agent may be a library of test agents. For example, the library may be a protein library produced, for example, by ribosome display or an antibody library prepared either in vivo, ex vivo or in vitro. Methodologies for preparing and screening such libraries are known in the art. One function or activity of TeI that may be affected by a test agent is the ability of TeI to bind to a TeI binding partner. Thus, in an embodiment, step (c) of the method of the second aspect of the invention comprises determining whether the test agent modulates binding of Tel or the portion or variant thereof, to a TeI binding partner. It will be appreciated that interactions between TeI and particular binding partners may be important for Tel's function as a transcriptional regulator directly (eg binding to DNA and CtBP) or indirectly (eg by enabling specific modifications of TeI). For example, sumoylation of TeI K11 is PIAS-dependent and is a chief mode of regulation of TeI (Roukens et al (2008) MoI Cell Biol 28(7): 2342).

Where the binding partner is DNA, step (c) of the method of the second aspect of the invention comprises determining whether the test agent modulates binding of TeI or the portion or variant thereof to DNA. Clearly, in this scenario the portion or variant of TeI must be capable of binding to DNA.

Several techniques are available in the art to detect and measure DNA-protein binding which are suitable for use in the present invention. One such technique is the electrophoretic mobility shift assay (EMSA) or gel-shift assay. This is routinely used to follow the purification of DMA binding proteins, to establish affinity binding constants and to study protein-protein assemblies on gene sequences (Sambrook et al., 2001 ; Murphy et al., 2001). The assay relies on the premise that protein-DNA complexes migrate more slowly through a non-denaturing polyacrylamide gel than free DNA fragments; that is, they have a different electrophoretic mobility. Typically, TeI or the portion or variant thereof is incubated with the DNA such as a particular promoter sequence comprising a TeI binding site. Typically, the DNA is labelled with a marker (e.g. ³²P), whereas the TeI or portion or variant thereof will be unlabelled. The reaction products are then analysed by electrophoresis and a difference in electrophoretic mobility is indicative of a protein- DNA interaction. To determine the effect of the test agent on this interaction, the agent is either incubated with the TeI protein or portion or variant thereof before addition to the DNA, or incubated with the DNA before addition of the protein. The affinity and specificity of this protein-DNA interaction can be further determined by conducting competition experiments using DNA fragments containing a binding site for TeI or the portion or variant thereof or other unrelated DNA sequences.

A variant of the EMSA is the supershift-EMSA which can also be used to detect protein- DNA binding by using specific antibodies. The supershift-EMSA is the same as the EMSA but with the addition of an antibody against the specific protein (i.e. TeI or portion or variant thereof), to the reaction mixture before, during, or after formation of the protein- DNA complex (Sambrook et al, 2001; Kako et al, 1998). Following electrophoretic separation, binding of the antibody to the protein causes the mobility of the complex to shift to a larger size ("supershift") due to the formation of a ternary complex between the antibody, DNA-binding protein and the DNA probe.

Enzyme-linked immunosorbent assay (ELISA) techniques have also been used to allow the detection of protein-DNA binding (Shen et al, 2002). Briefly, DNA fragments comprising the sequence defined above are immobilised onto a solid phase such as the wells of a 96-well polystyrene plate. The sample containing a purified protein, or a complex mixture of proteins (such as nuclear or whole cell extract preparations) is then incubated in the well and non-bound components of the sample removed by washing. Finally, an antibody specific for the putative bound protein is added and the protein- antibody complex detected. Binding of the antibody can be accomplished and detected using standard ELISA techniques with colorimetric, fluorescent, or chemiluminescent detection (Sambrook et al, 2001).

Another technique useful for determining protein-DNA binding is DNAse footprinting (Sambrook et al, 2001). This is based on the observation that a protein bound to DNA will often protect the DNA from enzymatic cleavage. Radiolabeled DNA is cut by the enzyme deoxyribonuclease (DNAse) and the fragments analysed by electrophoresis to detect the resulting cleavage pattern. The cleavage pattern of the DNA in the presence of the TeI protein or portion or variant thereof is compared to the cleavage pattern in the presence or absence of the test agent. If the test agent affects binding of the TeI protein or portion or variant thereof to the DNA, the detected "footprint" will be different.

Yet another technique that can be used to determine protein-DNA binding is a surface plasma resonance (SPR) assay as described in Plant et al (1995). In this approach, the DNA comprising a TeI binding site is secured to a flat sensor chip in a flow chamber, after which a solution containing the DNA binding protein, i.e. TeI or a portion or variant thereof is passed over the DNA in a continuous flow. Light is directed at a defined angle across the chip and the resonance angle of reflected light measured. A protein-DNA interaction causes this angle to change. By measuring the change of this angle over time, in the presence and absence of the TeI protein or portion or variant thereof, equilibrium constants can be determined and on and off rates estimated. The test agent can then be added, either to the DNA before the TeI protein or variant or portion thereof, or to the TeI protein or variant or portion thereof before its addition to the DNA, and its effect on DNA binding can be determined.

Where the TeI binding partner is CtBP, step (c) of the method of the second aspect of the invention comprises determining whether the test agent modulates binding of TeI or the portion or a variant thereof to CtBP or to a portion or variant of CtBP that is capable of binding to TeI. Clearly, in this scenario the portion or variant of TeI must be capable of binding to CtBP.

Whether a particular portion or variant of CtBP is capable of binding to TeI can be determined using standard methods in the art and as described herein. As noted above the inventors have shown that the positively charged N terminus of CtBP2, the oligomerisation domain of CtBPI and CtBP2, and amino acids Alanine-58 and Valine-72 of CtBP2 and the corresponding amino acids of CtBPI , Alanine-52 and Valine-66 are necessary for binding of CtBP to TeI. Thus in a preferred embodiment, the portion or variant of CtBP2 that is capable of binding to TeI comprises the N-terminal 10 amino acids of CtBP2, the oligomerisation domain of CtBP2 and amino acids Alanine-58 and Valine-72 of CtBP2. It is preferred if the portion of CtBP2 comprises the substrate binding domain of CtBP2 listed in Figure 2H. Similarly, the portion or variant of CtBPI that is capable of binding to TeI comprises the oligomerization domain of CtBPI and amino acids Alanine-52 and Valine-66 of CtBPL It is preferred if the portion of CtBPI comprises the substrate binding domain of CtBPI listed in Figure 2H.

Conveniently, the portion of CtBP2 or CtBPI that is capable of binding to TeI is less than 400, 350, 300, 250, 200, 150 or 100 amino acids.

By a variant of CtBP we include variants of human CtBPI or CtBP2, the sequences of which are provided in Figure 2. Preferably, the variant of CtBPI or CtBP2 shares at least 60% sequence identity, for example at least 65%, 70%, 75%, 80% and 85% sequence identity and more preferably 90%, 95% or 99% sequence identity with human CtBPI or CtBP2.

It will be appreciated that the portions of CtBP described above may also be portions of CtBP variants. Typically, the portions of CtBP have at least at least 60% sequence identity to human CtBPI or CtBP2, the sequences of which are provided in Figure 2A and C respectively, for example at least 65%, 70%, 75%, 80% and 85% sequence identity and more preferably 90%, 95% or 99% sequence identity with human CtBPI or CtBP2 over the length of the portion.

Various methods may be used to determine binding between TeI and CtBP or portions and variants thereof including, for example, enzyme linked immunosorbent assays (ELISA), surface plasmon resonance assays, chip-based assays, immunocytofluorescence, yeast two-hybrid technology and phage display which are common practice in the art and are described, for example, in Plant et al (1995) Analyt Biochem, 226(2), 342-348.and Sambrook et al (2001) Molecular Cloning A Laboratory Manual. Third Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Other methods of detecting binding between TeI and CtBP or portions or variants thereof include ultrafiltration with ion spray mass spectroscopy/HPLC methods or other physical and analytical methods. Fluorescence Energy Resonance Transfer (FRET) methods, for example, well known to those skilled in the art, may be used, in which binding of two fluorescent labelled entities (i.e. TeI and CtBP or portions or variants thereof) may be measured by measuring the interaction of the fluorescent labels when in close proximity to each other.

It will be appreciated that the test agent may be added to either the TeI protein or the portion or variant thereof before addition to the CtBP protein or portion or variant thereof, or it may be added to the CtBP protein or the portion or variant thereof before addition to the TeI protein or portion or variant thereof, and its affect on binding assessed.

It will be appreciated that it may be convenient to detectably label one or other of TeI or CtBP, or the portion or variant thereof, so as to facilitate detection of their binding and consequently the effect of the test agent. Examples of suitable labels include a peptide label, a nucleic acid label (Kerr et al (1993) JACS vol. 115, p. 2529-2531 ; and Brenner & Lerner (1992) Proc. Natl. Acad. Sci. USA vol. 89, p. 5381-5383), a chemical label (Ohlmeyer et al (1993) Proc. Natl. Acad. Sci. USA vol. 90, p. 109222-10926; and Maclean et al (1997) Proc. Natl. Acad. Sci. USA vol. 94, p. 2805-2810); a fluorescent label (Yamashita & Weinstock (SmithKline Beecham Corporation), WO95/32425 (1995); and Sebestyen et al (1993) Pept. Proc. Eur. Pept. Symp. 22nd 1992, p. 63-64), or a radio frequency tag (Nicolaou et al (1995) Angew. Chem. Int. Ed. Engl. vol. 34, p. 2289-2291 ; and Moran et a/ (1995) JACS vol. 117, p. 10787-10788).

Where the TeI binding partner is a binding partner other than DNA or CtBP such as, for example HDAC or PIAS, step (c) of the method of the second aspect of the invention, comprises determining whether the test agent modulates binding of TeI or the portion of variant thereof to that other binding partner. Clearly, in this scenario the portion or variant of TeI must be capable of binding to that other binding partner (eg it may comprise the SAM domain of TeI that is necessary for the interaction between TeI and the particular binding partner).

It will be appreciated that the same techniques can be used to assess whether a test agent modulates binding of TeI or the portion or variant thereof to HDAC or PIAS as described above in relation to CtBP.

Another activity or function of TeI that may be affected by a test agent is the expression of a reporter gene operably linked to DNA containing a TeI binding site. Thus, in one embodiment, step (c) comprises determining whether the test agent modulates expression of a reporter gene operably linked to a DNA promoter sequence comprising a TeI binding site.

Suitable DNA promoter sequences comprising a TeI binding site are as described above.

By a reporter gene we include genes which encode a reporter protein whose activity may easily be assayed as known in the art, for example β-galactosidase, chloramphenicol acetyl transferase (CAT) gene, luciferase or Green Fluorescent Protein (see, for example, Tan et a/, 1996). Such reporter genes can be operably linked to DNA promoters comprising a TeI binding site (e.g. any of a ld-1 , Fli-1 , delta-4, VE-cadherin, metallo metal protease (MMP)-I , MMP2, MMP3, MMP8, MMP9, MMP14, Spry-2, SpryΛ hey 1 or hey 2 promoter) using standard molecular biology techniques.

The reporter gene may be fatal to the cells, or alternatively may allow cells to survive under otherwise fatal conditions. Cell survival can then be measured, for example using colorimetric assays for mitochondrial activity, such as reduction of WST-1 (Boehringer). WST-1 is a formosan dye that undergoes a change in absorbance on receiving electrons via succinate dehydrogenase.

By a reporter gene we also include a gene whose expression is controlled by TeI, such as any of ld-1 , Fli-1 , delta-4, VE-cadherin, metallo metal protease (MMP)-I , MMP2, MMP3, MMP8, MMP9, MMP14, Spry-2, Spry-4, hey 1 or hey 2. Several techniques are available in the art to detect and measure expression of a reporter gene which would be suitable for use in the present invention. Many of these are available in kits both for determining expression in vitro and in vivo.

For example, levels of mRNA transcribed from a reporter gene can be assayed using RT- PCR (see Example 1 ). The specific mRNA is reverse transcribed into DNA which is then amplified such that the final DNA concentration is proportional to the initial concentration of target mRNA.

Levels of expression can also be determined by measuring the concentration of protein encoded by the reporter gene. Assaying protein levels in a biological sample can occur using any suitable method. For example, protein concentration can be studied by a range of antibody based methods including immunoassays, such as ELISAs and radioimmunoassays. Ih one such assay, a protein-specific monoclonal antibody can be used both as an immunoadsorbent and as an enzyme-labelled probe to detect and quantify a specific protein. The amount of the protein present in the sample can be calculated by reference to the amount present in a standard preparation using a linear regression computer algorithm. In another ELISA assay, two distinct specific monoclonal antibodies can be used to detect the specific protein. In this assay, one of the antibodies is used as the immunoadsorbent (primary antibody) and the other as the enzyme-labelled probe (secondary antibody).

Suitable enzyme labels include those from the oxidase group, which catalyze the production of hydrogen peroxide by reacting with substrate. Glucose oxidase is particularly preferred as it has good stability and its substrate (glucose) is readily available. Activity of an oxidase label may be assayed by measuring the concentration of hydrogen peroxide formed by the enzyme-labeled antibody/substrate reaction. Besides enzymes, other suitable labels include radioisotopes such as iodine (¹²⁵I, ¹²¹I), carbon (¹⁴C), sulfur (³⁵S), tritium (³H), indium (¹¹²In), and technetium (^99mTc), and fluorescent labels such as fluorescein and rhodamine, and biotin.

The concentration of a specific protein expressed by a marker gene may also be detected in vivo by imaging, for example when testing an agent in an animal model of angiogenesis.

Where the reporter gene is an enzyme, determining the expression of a reporter gene may comprise measuring the activity of the enzyme. Enzyme assays typically measure either the consumption of substrate or production of product over time. It is appreciated that a large range of methods exist for determining the concentrations of substrates and products such that many enzymes can be assayed in several different ways as is well known in the art (e.g. Bergmeyer (1974)).

Another activity or function of TeI that may be affected by a test agent is the cellular localisation of TeI. For example, the inventors have demonstrated that CtBP is necessary for localisation of TeI in the nucleus, such that when TeI is unable to interact with CtBP it becomes mis-localised to the cytoplasm. Thus, in one embodiment, step (c) comprises determining whether the test agent modulates the cellular location of TeI.

Various methods are available in the art to determine the cellular location of TeI, for example using immunohistological analyses as described in Example 1. Specifically, using nuclear and/or cytoplasmic stains it is possible to visualise whether TeI is predominantly expressed in the cytoplasm or nucleus.

A further means of screening for modulators of angiogenesis is to screen for agents that modulate the expression of TeI. Accordingly, a third aspect of the invention provides a method of identifying a modulator of angiogenesis comprising: a) providing a test agent; b) providing a reporter gene operably linked to a TeI promoter; c) assessing whether the test agent modulates the expression of TeI; and d) assessing whether the test agent modulates angiogenesis in an assay for angiogenesis.

By 'modulating expression of TeC we include modulating the expression of TeI mRNA and/or modulating the expression of TeI protein.

The test agent may be any of the test agents defined above with respect to the second aspect of the invention, including any of a polypeptide, an antibody, a small molecule, a natural product, a peptidomimetic or a nucleic acid.

By a reporter gene in the context of the third aspect of the invention, we include genes which encode a reporter protein whose activity may easily be assayed as known in the art and as discussed above. It is appreciated that by operably linking the TeI promoter to such a reporter protein, the effect of a test agent on TeI expression can be readily assessed by virtue of the test agent interacting with the TeI promoter. A putative sequence of the TeI promoter is provided in Figure 2K.

We also include the TeI gene itself within the meaning of a reporter gene in the context of the third aspect of the invention. Thus, providing a reporter gene operably linked to a TeI promoter may comprise providing the TeI gene in which case the method involves assessing the effect of the test agent on TeI mRNA or protein levels.

Any suitable technique such as those described above with respect to the second aspect of the invention may be used to detect and measure expression of the reporter gene.

In a particularly preferred embodiment, the test agent is any of an antisense oligonucleotide such as a morpholino, a short hairpin RNA (shRNA), a micro RNA (miRNA), a small interfering RNA (siRNA) or a ribozyme. It is appreciated that such test agents may modulate the expression of TeI for example by promoting TeI mRNA degradation or preventing TeI mRNA translation.

Once it has been assessed whether the test agent modulates at least one function or activity of TeI according to the second aspect of the invention or modulates the expression of TeI according to the third aspect of the invention, it is necessary to assess whether the test agent modulates angiogenesis in an assay for angiogenesis.

Suitable assays are as defined above with respect to the first aspect of the invention, for example, the multicellular in vitro assay described in US Patent No. 6,225,118 B1 (Grant et al), the AngioKit (Catalogue No. ZHA-1000, by TCS CellWorks Ltd, Buckingham MK18 2LR, UK), the 3D cell culture assay described in Example 1 adapted from Nakatsu and Hughes, 2008 (Methods in Enzymology 443: 65-82), or the zebrafish embryo circulatory system described in Example 2.

In one embodiment, the modulator is an inhibitor of angiogenesis. Preferably, the modulator inhibits angiogenesis by at least 10%, 20%, 30% or 40% of the rate or level of angiogenesis, more preferably by at least 50%, 60%, 70% or 80% of the rate or level of angiogenesis and yet more preferably by at least 90%, 95%, or 99% of the rate or level of angiogenesis. Most preferably, the modulator inhibits angiogenesis to an undetectable level. In an alternative embodiment, the modulator is an enhancer of angiogenesis. Preferably the modulator enhances angiogenesis by at least 10%, 20%, 30% or 40% of the rate or level of angiogenesis, more preferably by at least 50%, 60%, 70% or 80% of the rate or level of angiogenesis and yet more preferably by at least 90%, 95%, or 99% of the rate or level of angiogenesis.

It will be appreciated that the modulators of angiogenesis identified in the methods of the second and third aspects of the invention are agents that modulate at least one function or activity of TeI within the meaning of the first aspect of the invention, and so can be used as such.

The inventors have demonstrated CtBP to be of primary importance in Tel's regulation of angiogenesis wherein CtBP modulates TeI localisation and stability, and links angiogenic control to cellular metabolism. The interaction between TeI and CtBP therefore represents a highly desirable therapeutic target.

Accordingly, a fourth aspect of the invention provides a method of identifying an agent which modulates the interaction between TeI and CtBP, the method comprising determining whether a test agent enhances or reduces the interaction between (a) TeI or a portion or a variant thereof, said portion or variant being capable of binding to CtBP and (b) CtBP or a portion or variant thereof, said portion or variant being capable of binding to TeI.

Preferences for TeI, and the portion or variant thereof capable of binding to CtBP are defined above with respect the first and second aspects of the invention, as are preferences for CtBP, and the portion or variant thereof capable of binding to TeI.

The test agent may be any suitable test agent described above with respect to the second aspect of the invention including a polypeptide, an antibody, a small molecule, a natural product, a peptidomimetic or a nucleic acid. It is appreciated that a library of test agents may be screened as part of a high throughput screen.

Various techniques can be used to determine a test agent's effect on the interaction between TeI and CtBP or portions or variants thereof, for example those described above and which are well known in the art. It is appreciated that the method may further comprise assessing whether the test agent modulates angiogenesis in an assay for angiogenesis. Appropriate angiogenesis assays are described above.

In an embodiment, the agent which modulates the interaction between TeI and CtBP is one that enhances the interaction between (a) TeI or a portion or a variant thereof, said portion or variant being capable of binding to CtBP and (b) CtBP or a portion or variant thereof, said portion or variant being capable of binding to TeI. Preferably, the agent enhances the interaction by a factor of at least 10%, 20%, 30%, 40% or 50% of the original binding in the absence of the agent, and more preferably by a factor of at least 60%, 70%, 80%, 90% or 95%.

In an alternative embodiment, the agent which modulates the interaction between TeI and CtBP is one that reduces the interaction between (a) TeI or a portion or a variant thereof, said portion or variant being capable of binding to CtBP and (b) CtBP or a portion or variant thereof, said portion or variant being capable of binding to TeI. Preferably, the agent reduces the interaction by a factor of at least 10%, 20%, 30%, 40% or 50% of the original binding in the absence of the agent, and more preferably by a factor of at least 60%, 70%, 80%, 90% or 95%.

It will be appreciated that the agent identified in the fourth aspect of the invention is an agent that modulates at least one function or activity of TeI within the meaning of the first aspect of the invention and so can be used as such.

It is appreciated that in the methods described herein, which may be drug screening methods, a term well known to those skilled in the art, the test agent may be a drug-like compound or lead compound for the development of a drug-like compound.

The term "drug-like compound" is well known to those skilled in the art, and may include the meaning of a compound that has characteristics that may make it suitable for use in medicine, for example as the active ingredient in a medicament. Thus, for example, a drug-like compound may be a molecule that may be synthesised by the techniques of organic chemistry, less preferably by techniques of molecular biology or biochemistry, and is preferably a small molecule, which may be of less than 5000 daltons and which may be water-soluble. A drug-like compound may additionally exhibit features of selective interaction with a particular protein or proteins and be bioavailable and/or able to penetrate target cellular membranes or the blood:brain barrier, but it will be appreciated that these features are not essential.

The term "lead compound" is similarly well known to those skilled in the art, and may include the meaning that the compound, whilst not itself suitable for use as a drug (for example because it is only weakly potent against its intended target, non-selective in its action, unstable, poorly soluble, difficult to synthesise or has poor bioavailability) may provide a starting-point for the design of other compounds that may have more desirable characteristics.

In one embodiment, the method of the second, third or fourth aspect of the invention is performed in vitro. By in vitro we include both cell-free assays and cell-based assays. For example, the method may be performed in isolated human cell lines (e.g. human umbilical cord vein endothelial cells (HUVECs), human osteosarcoma cells (U2OS) and immortalised HUVECs (ECRF) cell lines) or in cell lines that can be easily manipulated within a laboratory (e.g. Escherichia coli and Saccharomyces cerevisiae).

In an alternative embodiment, the method of the second, third or fourth aspects of the invention is performed in vivo, for example in chicken and mouse models of angiogenesis, or in the zebrafish embryo circulatory system described in Example 2.

A fifth aspect of the invention provides a Tel/CtBP complex comprising (i) TeI or a portion or variant thereof, said portion or variant being capable of binding to CtBP, and (ii) CtBP or a portion or variant thereof, said portion or variant being capable of binding to TeI.

In a particularly preferred embodiment, the Tel/CtBP complex comprises human TeI and either CtBPI or CtBP2, the amino acid sequences of which are provided in Figures 1 and 2 respectively,

Conveniently, the complex is produced by expressing TeI or the portion or variant thereof, and CtBP or the portion or variant thereof separately, and adding the two proteins together after expression under conditions appropriate for complex formation. Alternatively, a cell may be engineered to overexpress TeI and CtBP using standard molecular biology techniques, such that the Tel/CtBP complex can be recovered from the cell lysate. Preferably, the Tel/CtBP complex is soluble. Typically, the proteins are manufactured in E. coii and purified by tagging them with 6x His tags and using nickel beads to isolate the recombinant proteins. Similarly, differently epitope tagged versions of the proteins (eg HA-TeI and Flag-CtBP), can be expressed in and purified from cells.

It is appreciated that such Tel/CtBP complexes may be useful in the methods of the second and fourth aspects of the invention in the screening for modulators of angiogenesis and for agents that modulate the interaction between TeJ and CtBP. Conveniently, either one or both parts of the complex are detectably labelled so that the presence of the complex in a sample or cell can readily be detected. Examples of labels include peptide labels, chemical labels, fluorescent labels or radio labels.

As described in Example 1 , the inventors have conducted various mutagenesis studies to investigate the interaction between TeI and CtBP. Specifically, they have identified particular regions in both TeI and CtBP that are important to the TeI-CtBP interaction.

Accordingly, a sixth aspect of the invention provides a mutant TeI protein which has reduced binding to CtBP relative to wild type TeI protein.

In one embodiment, the mutant TeI protein has at least one mutation, relative to wild type TeI, within the PxEIM (SEQ ID No: 1) motif of TeI where x is any amino acid. For example, the mutant TeI protein may be one in which the isoleucine and methionine residues (IM) of the PxEIM (SEQ ID No: 1) motif have been replaced by two glycines, or it may be one in which the PxEIM (SEQ ID No: 1) motif has been deleted entirely, such as by deleting the C-terminus containing the PxEIM (SEQ ID No: 1) motif (eg TelΔ134 mutant in which the C-terminal 34 amino acids have been deleted).

In another embodiment, the mutant TeI protein has at least one mutation, relative to wild type TeI, within the SAM domain of TeI. For example, the SAM domain may be deleted as in the TelΔSAM mutant described in Figure 8.

It is appreciated that the mutant TeI may have at least one mutation in both the PxEIM (SEQ ID No: 1) motif where x is any amino acid, and in the SAM domain.

A seventh aspect of the invention provides a mutant CtBP protein which has reduced binding to TeI relative to wild type CtBP protein. In one embodiment, the mutant CtBP protein is a mutant CtBP2 protein wherein, relative to wild type CtBP2, the amino acid Alanine-58 and/or Valine-72 are mutated. Thus, both Alanine-58 and Valine-72 may be substituted with other amino acids or just one of Alanine-58 and Valine-72 may be substituted with another amino acid.

In one embodiment, the mutant CtBP protein is a mutant CtBPI protein wherein, relative to wild type CtBPI , the amino acid Alanine-52 and/or Valine-66 are mutated. Thus, both Alanine-52 and Valine-66 may be substituted with other amino acids or just one of Alanine-52 and Valine-66 may be substituted with another amino acid.

In another embodiment, the mutant CtBP protein is a mutant CtBP2 protein which, relative to wild type CtBP2, has at least one mutation in the N-terminal 20 amino acids of CtBP2.

In an embodiment, the mutant CtBP protein is a mutant CtBPI protein which has at least one mutation relative to wild type CtBPI , in the substrate binding domain specified in Figure 2H.

In an embodiment, the mutant CtBP protein is a mutant CtBP2 protein which has at least one mutation relative to wild type CtBP2 in the substrate binding domain specified in Figure 2H.

In another embodiment, the mutant CtBP protein which, relative to wild type CtBP has at least one mutation within the oligomerisation domain of CtBP. For example, the mutant CtBP protein may be a mutant CtBPI protein in which the oligomerization domain is deleted as in the CtBPI ΔDim mutant listed in Figure 8, or it may be a mutant CtBP2 protein in which the oligomerization domain is deleted as in the CtBP2ΔDim mutant listed in Figure 8.

It is appreciated that the mutant CtBP2 protein may have at least one mutation in any one or more of (i) amino acid residues Alanine-58 and/or Valine-72, (ii) the CtBP2 substrate binding domain, (iii) the N-terminal 20 amino acids of CtBP2 and (iv) the oligomerisation domain of CtBP2. It is appreciated that the mutant CtBPI protein may have at least one mutation in any one or more of (i) amino acid residues Alanine-52 and/or Valine-66, (ii) the CtBPI substrate binding domain and (iii) the oligomerization domain of CtBPI .

By "mutation" we include insertions, deletions and substitutions, either conservative or non-conservative. By "conservative substitutions" is intended combinations such as GIy, Ala; VaI, He, Leu; Asp, GIu; Asn, GIn; Ser, Thr; Lys, Arg; and Phe, Tyr.

The mutants of the sixth and seventh aspects of the invention may be produced in any suitable way and provided in any suitable form. For example, methods of protein- engineering or conventional site-directed mutagenesis may be employed, or polymerase chain reaction-based procedures well known in the art may be used.

An eighth aspect of the invention provides a polynucleotide encoding a mutant TeI protein according to the sixth aspect of the invention or a mutant CtBP protein according to the seventh aspect of the invention.

A ninth aspect of the invention provides an expression vector capable of expressing a mutant TeI protein according to the sixth aspect of the invention or a mutant CtBP protein according to the seventh aspect of the invention. Expression vectors which are suitable for expressing the mutants of the invention include viral vectors such as retroviral vectors, lentiviral vectors, adenoviral vectors, vaccinia vectors (including the replication- deficient MVA strain).

A tenth aspect of the invention provides a host cell comprising a polynucleotide according to the eighth aspect of the invention or an expression vector according to the ninth aspect of the invention. Thus the host cell may be used to express the mutant TeI and CtBP proteins of the invention. Examples of host cells include HUVECs, U20S cells, ECRF cells, 293T kidney fibroblasts, and zebrafish fli1a:gfp cells.

An eleventh aspect of the invention provides a recombinant cell line which does not express endogenous TeI and CtBP genes. Thus the expression of endogenous TeI and endogenous CtBP may have been ablated using any suitable method in the art, for example by using shRNA expressing Antiviruses. Briefly, HUVECs may be isolated from umbilical cords by standard means, infected with Antiviruses expressing either a scrambled shRNA (control) or shRNA targeting TeI or CtBP and following infection selected in puromycin to yield stable cell lines. Similarly, as described in Example 2, expression of endogenous TeI and endogenous CtBP may have been ablated in zebrafish fli1a:gfp cells using targeted morpholinos. The inventors note that ablations of expression of endogenous TeI and CtBP in zebrafish as described in Example 2 is transient (typically over course of 5 days) and so it is appreciated that the cell lines may be stable cell lines in which expression of endogenous TeI and CtBP genes is permanently ablated, or cell lines in which the ablation is transient, for example upon induction or otherwise. It will also be appreciated that the invention provides a zebrafish embryo such as one derived from a fli1a:gfp transgenic line, which does not express endogenous TeI and endogenous CtBP; however, as noted above, ablation of expression in such embryos is generally transient.

It is appreciated that cell lines that do not express endogenous TeI or CtBP can be modified so as to express exogenous TeI and/or exogenous CtBP, or mutants thereof. Thus, in an embodiment, the recombinant cell line expresses at least one of an exogenous TeI gene and an exogenous CtBP gene. Without endogenously expressed TeI and CtBP, such cell lines are valuable in mutagenesis studies of TeI and CtBP. Thus, it will be appreciated that the cell lines may be transfected with a polynucleotide or expression vector of the eighth and ninth aspects of the invention so as to express a mutant TeI protein or a mutant CtBP protein according to the sixth and seventh aspects of the invention.

Preferably, the recombinant cell line is a HUVEC cell line, or a U2OS cell line or a ECRF cell line, or a zebrafish fli1a:gfp cell line.

A twelfth aspect of the invention provides a recombinant cell line which expresses an exogenous TeI gene and an exogenous CtBP gene. Thus a cell may be transfected with expression vectors encoding TeI and CtBP, either together on one vector or separately on individual vectors, such that both TeI and CtBP are overexpressed. Thus it is appreciated that the invention includes a polynucleotide or expression vector capable of expressing both TeI and CtBP. Preferably the cell line is a human cell line such as any of HUVECs, ECRF, 293T₁ U20S, MCF7 and K562 cell lines. Alternatively, the cell line may be a zebrafish fli1a:gfp cell, and so it will be appreciated that the invention also provides a zebrafish embryo, such as one derived from a fli1a:gfp transgenic line, which expresses an exogenous TeI gene and an exogenous CtBP gene. As mentioned above, the cell line may be a stable cell line in which there is permanent expression of exogenous TeI and CtBP, or it may be a cell line in which exogenous TeI and CtBP are transiently expressed, for example upon induction or otherwise. It is appreciated that the invention provides a vertebrate containing a genetically engineered cell which does not express endogenous TeI and CtBP genes. By a 'genetically engineered cell which does not express endogenous TeI and CtBP genes' we include a cell which has been manipulated so as to prevent expression of the endogenous TeI and CtBP genes, either by removing these genes or by otherwise preventing their expression. Such manipulation may be by any suitable technique in the art, such as, for example, antisense technology (eg morpholinos). In one embodiment, the vertebrate is a zebrafish and the genetically engineered cell is a fli1a:gfp cell.

It is appreciated that the invention also provides a vertebrate containing a genetically engineered cell which expresses an exogenous TeI gene and an exogenous CtBP gene, or mutants thereof. By a 'genetically engineered cell which expresses an exogenous TeI gene and an exogenous CtBP gene' we include a cell whose genetic makeup has been altered so as to express an exogenous TeI gene and an exogenous CtBP gene, for example as described above in relation to the twelfth aspect of the invention. In one embodiment, the vertebrate is a zebrafish and the genetically engineered cell is a fli1a:gfp cell.

Typically, the genetically engineered cell in the vertebrates of the invention is one in which expression of endogenous TeI and CtBP genes is transiently ablated, or in which expression of exogenous TeI and CtBP genes is transient, for example upon induction or otherwise. Preferably, the ablation of expression of endogenous TeI and CtBP genes, or the expression of exogenous TeI and CtBP genes is confined to endothelial cells.

In a particularly preferred embodiment, the vertebrate is a mouse in which expression of endogenous TeI and CtBP genes is ablated specifically in endothelial cells.

A thirteenth aspect of the invention provides a kit of parts comprising (a) TeI or a portion or a variant thereof, said portion or variant being capable of binding to CtBP, or a polynucleotide or expression vector encoding the same and (b) CtBP or a portion or variant thereof, said portion or variant being capable of binding to TeI, or a polynucleotide or expression vector encoding the same. It is appreciated that such a kit of parts may be useful in a method of identifying a modulator of angiogenesis in the second aspect of the invention or in a method of identifying an agent which modulates the interaction between TeI and CtBP in the fourth aspect of the invention, or in the production of a Tel/CtBP complex according to the fifth aspect of the invention.

In an embodiment, the TeI or portion or variant thereof is bound to a DNA promoter sequence comprising a TeI binding site, for example any of the metallo metal protease (MMP)-I , MMP2, MMP3, MMP8, MMP9, MMP14. ld-1 , FIM ₁ delta-4, VE-cadherin, Spry-2, Spry-4, hey 1 or hey 2 promoters. The promoter may be operably linked to a reporter gene such that a test agent's effect on Tel's ability to regulate expression can be assessed. The kit may also comprise a substrate for a protein encoded by the reporter gene. For example, when the reporter gene encodes an enzyme whose activity can be measured by an enzyme assay, the kit may comprise a substrate for the enzyme. Suitable reporter genes include those described above for the second and fourth aspects of the invention.

The kit of parts may also comprise a host cell according to the tenth aspect of the invention that expresses a mutant TeI and/or CtBP protein, or a recombinant cell line according to the eleventh aspect of the invention which does not express endogenous TeI and CtBP, or a recombinant cell line according to the twelfth aspect of the invention which expresses exogenous TeI and CtBP. Such cells may be useful as controls and may also form the basis for a cellular screening assay.

The invention will now be described in more detail with the aid of the following Figures and Examples.

Figure 1: (A) Amino acid sequence of human TeI (SEQ ID No: 2); (B) Human TeI cDNA sequence (SEQ ID No: 3).

Figure 2: (A) Amino acid sequence of human CtBPI (SEQ ID No: 4); (B) Human CtBPI cDNA sequence (SEQ ID No: 5); (C) Amino acid sequence of human CtBP2 (SEQ ID No: 6); (D) Human CtBP2 cDNA sequence (SEQ ID No: 7); (E) Alignment of CtBPI and CtBP2 proteins; (F) TeI Cterminus containing ETS domain and PxEIM motif (SEQ ID No: 8); (G) TeI SAM domain (SEQ ID No: 9); (H) Substrate binding domains of CtBPI (SEQ ID No: 10) and CtBP2 (SEQ ID No: 11); (I) CtBPI and CtBP2 dimerisation domains (SEQ ID Nos: 12 and 13 respectively); (J) Domains essential for TeI localisation: ETS DNA-binding domains and the C-terminus harbouring the PxEIM motif (SEQ ID No: 14); (K) Putative TeI promoter sequence (SEQ ID No: 15).

Figure 3: TeI associates with CtBP via a bona-fide consensus binding motif.

Figure 4: CtBP modulates TeI localisation and stability.

Figure 5: Metabolite regulation of endogenous TeI.

Figure 6: Genetic regulation of metastasis and angiogenesis factors by TeLCtBP. The figure shows that the Tel:CtBP complex is attuned to VEGF signalling and temporally limits expression of negative regulators of angiogenesis. (A) Tel/CtBP controls the expression of mmps. RNA was prepared from U2OS cells stably expressing TeI, and the expression levels of various mmps was determined by RT-qPCR. (B & C) Stable cell lines were established in which the levels of TeI, CtBP and CtBP2, were abrogated by specific shRNA-expressing lentiviruses. By the same means as above, the effects on the expression of mmp3 are shown. (D) Primary HUVECs were targeted with specific shRNA-expressing lentiviruses to diminish expression of TeI (and CtBPI and 2). Effective knock-down was confirmed by Western blotting. Expression levels of the indicated transcripts were determined by real time qPCR as described above. (E) The figure also shows that TeI primes endothelial sprouting by constraining expression of sprouting antagonists. Loss of Tel or CtBP2 augments expression of dll4, ve-cadhehn and spry genes. Stable primary HUVECs cell lines were derived following their infection with either control shRNA-expressing lentiviruses (Mock) or specific shRNA-expressing lentiviruses to diminish expression of TeI (TeIi) or CtBP2 (CtBP2i). Effective knock-down was confirmed by Western blotting. Expression levels of the indicated transcripts were determined by real time qPCR. All values were averaged relative to three different control genes: TATA binding protein (TBP), signal recognition particle receptor (SRPR) and calcium-activated neutral proteinase 1 (CAPNS1). (F) Tel:CtBP regulates dll4 expression in response to VEGFR signaling. Primary endothelial cells were cultured without serum then stimulated with 50 ng/ml VEGF for the indicated periods. Three assays were performed. The top right panel shows (by Western blotting) the kinetics of MAPK phosphorylation during the indicated time-course. Next to this are images of a P-LISA atop a graphic representation of a quantitative measure of the relative amounts of complex during the same time-course. For the bottom panel, RNA was collected at each time-point, and qPCR was performed (as above) to determine the levels of dll4 expression. (G) TeI associates with conserved elements in the dll4 promoter. Shown is an alignment of the human (SEQ ID No: 44) and mouse (SEQ ID No: 45) putative dll4 promoter. The presumed transcription start site is highlighted in italics. Conserved core consensus Ets DNA-binding sites are shown in bold. A ChIP analysis was performed on primary endothelial cells incubated with or without 50 ng/ml VEGF for the indicated times. Three different primer sets centered on the illustrated promoter region were used and a single representative is shown (all three gave very similar results). Equivalent amounts of control rabbit IgG were used as a control and results are presented as fold changes in recovery (as a fraction of input) relative to the control. The lower panel shows endogenous dll4 expression levels under identical conditions.

Figure 7: Modelling angiogenesis in 3-D culture. The figure shows that TekCtBP complex is essential for endothelial sprouting. (A) Establishment of an assay of endothelial sprouting in 3-D fibrin matrices. Primary endothelial cells were attached as a monolayer to collagen-coated beads of approximately 10OuM diameter (400 cells/bead). Beads were embedded in a fibrin matrix and overlayed with primary human fibroblasts that provide essential nutrient and growth factors, thus mimicking the stromal cell- endothelial cell interaction. Formed vessels following 7-10 days of culture vessels are shown. Vessels were stained with DAPI to demonstrate the multicellular nature of the sprouts, F-actin and the endothelium-specific marker PECAM-1. The lower panels highlight the tubular nature of the vessels: DAPI staining on the left and a CD31 stained transverse section taken from a paraffin-embedded vessel that was cultured as above. (B) TeI is required for endothelial sprouting. In the top panel, stable endothelial cell lines were derived from primary HUVECs in which the levels of endogenous TeI were abrogated by one of 4 different Tel-specific shRNA-expressing Antiviruses (TeIi #1- #4). Lentiviruses expressing a scrambled shRNA were used as a control (Mock) which had no effect on endogenous TeI levels (shown in the accompanying Western blot of cell lysates). A 3-D fibrin assay was performed as described in (A). Also shown is an analysis of canonical VEGFR signaling which demonstrates that failure of sprouting by cells lacking TeI does not simply result from a general failure of the signaling pathways, ie it is not simply toxic but specifically interferes with ability to sprout. Stable HUVEC lines (Mock and TeIi) were starved of serum for 3 hrs, then stimulated with 50 ng/ml VEGF for the indicated periods. Cells were lysed directly in Laemmli buffer and Western blotting was performed using the indicated antibodies. (C) TeI and CtBP2 are each required for endothelial sprouting. Stable HUVECs cell lines were established in which the levels of TeI or CtBP2 were abrogated by specific shRNA-expressing lentiviruses (see Western blot). A 3-D fibrin assay was performed as described in (A). To ensure specificity, at least 4 different shRNA constructs were tested and single representatives are shown. In these cells, canonical VEGFR signaling is not overtly disrupted by either loss of TeI or loss of CtBP. Stable primary HUVECs cell lines were derived following their infection with either control shRNA-expressing lentiviruses (Mock) or specific shRNA-expressing lentiviruses to diminish expression of TeI (TeIi) or CtBP2 (CtBP2i). Effective knock-down was confirmed by Western blotting. Cells were cultured in serum- free medium and stimulated with 50ng/ml VEGFA for the indicated periods of time. Cells were lysed in sample buffer and Western blotting performed with the indicated antibodies. Also shown is the effect of ablating TeI and/or CtBP2 expression in cells stimulated with 2 ng/ml or 50 ng/ml VEGF. (D) Upper panel shows that ectopic expression of TeI stimulates sprouting, and rescues the loss-of-function TeI phenotype, of primary endothelial cells. Primary endothelial cells were stably infected with lentiviruses expressing either control shRNA (Mock) or an shRNA directed against the non-coding region of tel for the down regulation of endogenous TeI (TeIi). These cell lines were subsequently further stably infected with lentiviruses for expressing either control GFP or HA epitope tagged TeI that was resistant to the inhibitory effect of the co- expressed TeI shRNA. A 3-D fibrin assay was performed as described in (A). Expression of endogenous and ectopic TeI was confirmed by Western blotting. Lower panel shows that ectopic expression of TeI but not TelΔPxEIM stimulates endothelial sprouting and rescues the loss-of-function TeI phenotype. Primary endothelial were stably infected with lentiviruses expressing either control shRNA (Mock) or an shRNA directed against the non-coding region of tel for the down regulation of endogenous TeI (TeIi). These cell lines were subsequently further stably infected with lentiviruses for expressing either control GFP or HA epitope tagged versions of TeI or TelΔPxEIM each of which were resistant to the inhibitory effect of the co-expressed Tel-specific shRNA. A 3-D fibrin assay was performed as described above. Levels of endogenous and ectopically expressed proteins were determined by Western blotting. (E) Stimulation of endothelial sprouting by ectopically expressed TeI requires CtBP2. Stable primary endothelial cell lines were established by infection with lentiviruses expressing either control shRNA (Mock) or an shRNA directed against ctbp2 for the down regulation of endogenous CtBP2 (CtBP2i). These cell lines were subsequently further stably infected with lentiviruses for expressing either control GFP or HA epitope tagged TeI. A 3-D fibrin assay was performed as described above. Levels of endogenous and ectopically expressed proteins were determined by Western blotting. (F) Inhibition of DII4 restores the sprouting of cells lacking TeI. Stable primary endothelial cell lines were established by infection with lentiviruses expressing either control shRNA (Mock) or an shRNA directed against tel or ctbp2 for the down regulation of endogenous TeI (TeIi) or CtBP2 (CtBP2i). A 3-D fibrin assay was performed as described above in the presence or absence of a neutralizing anti-DII4 antibody (5ug/ml). Endogenous protein levels were determined by Western blotting with the indicated antibodies.

Figure 8: Sequences of mutants TelΔSAM (SEQ ID No: 16), TelΔETS (SEQ ID No: 17), CtBPIΔDim (SEQ ID No: 18) and CtBP2ΔDim (SEQ ID No: 19).

Figure 9: (A) Zebrafish TeI (zTel) can replace the ability of human TeI (hTel) to stimulate sprouting of human endothelial cells. ECRF cells were stably infected with Antiviruses expressing either control shRNA (Mock) or an shRNA directed against the non-coding region of tel for the down regulation of endogenous TeI (TeIi). These cell lines were subsequently further stably infected with Antiviruses for expressing either control GFP or HA epitope tagged versions of zTel or zTelΔPxEIM each of which were resistant to the inhibitory effect of the co-expressed Tel-specific shRNA. A 3-D fibrin assay was performed as described above. (B) Levels of endogenous and ectopically expressed proteins were determined by Western blotting.

Figure 10 (A): Zebrafish embryos derived from the transgenic fli1a-gfp line were injected at the 1-2 cell stage with the indicated morpholinos (MOs). Vessels were visualized by confocal microscopy 4 days after fertilization. The dorsal aorta (DA) and dorsal longitudinal anastomotic vessel (DLAV) is highlighted. (B): Results of a typical experiment. Grade I mutants exhibited alterations of a minimum of 10-20% of the intersegmental vessels. Grade Il mutants exhibited alterations in >50% of the intersegmental vessels. At least 50 embryos of each MO injection were scored. Similar results were obtained in 5 separate experiments.

Figure 11 (A): Testing MO efficacy. Sequences that are exactly complementary to either the TeI or CtBP2 MOs were incorporated into the 5' end of a transcript encoding GFP. 50pg of capped, in vitro transcribed mRNA, prepared from each of these constructs, was injected into zebrafish embryos at the 1 -2 cell stage together with the indicated MO. Expression of GFP was determined by fluorescence microscopy. (B): Western of the indicated embryo lysates using an antibody directed against zTel and a control tubulin antibody.

Figure 12: Zebrafish embryos were injected with the indicated MOs at the 1-2 cell stage. Following 24 hours of development, RNA was prepared from 30 staged embryos from each condition. Expression levels of the indicated transcripts were determined by real time qPCR. All values were averaged relative to expression of elongation factor-1 alpha (EF-Ia) whose expression remains relatively invariant during the early stages of zebrafish development. The mean values of 3 separate experiments are shown.

Example 1: TeI as a therapeutic target for inhibiting angiogenesis

Summary

We have uncovered a new pathway for the genetic control of endothelial sprouting, the process by which new blood vessels are established by remodelling existing ones. Specifically, we have identified the Tel/CtBP complex as an essential mediator of this process. Endothelial sprouting is an integral characteristic of aberrant blood vessel formation such as tumour angiogenesis and thus, Tel/CtBP2 represents a novel target for the development of therapeutic strategies aimed at inhibiting tumour angiogenesis and thereby arresting tumour growth.

First described in 1971 , the process of tumour angiogenesis has proved to be indispensable for tumour growth and development. From this, a potential new approach to cancer therapy was conceived: inhibiting angiogenesis is a generic solution to inhibiting tumour growth. However, despite enormous effort over the past two decades, to date, effective therapies have failed to emerge.

Our identification of a new pathway for the genetic control angiogenesis has unveiled a new target for the development of tumour angiogenesis inhibitors. We are the first to show that the Tel/CtBP complex is a direct mediator of angiogenesis. As such, targeting the activity of this complex, for example through the production of small molecule inhibitors of its function, represents a completely novel approach to the problem of inhibiting illicit vascular development such as tumour angiogenesis.

We have established that the Tel/CtBP complex is indispensable for 'branching' by primary endothelial cells and also for development of the blood circulatory system of zebrafish. Importantly, we find that the Tel/CtBP complex is directly attuned to VEGF receptor signalling which is the primary promoter of angiogenesis. To demonstrate this, we isolated primary endothelial cells from umbilical cords known as human umbilical cord vein endothelial cells (HUVECs). To stimulate vessel formation by these cells we employed a 3-D cell culture assay that faithfully mimics the in vivo environment. Under these conditions we can provoke the formation of multicellular branches characteristic of those formed by angiogenesis in vivo. To delineate the role of Tel/CtBP in this process, we have established lines of HUVECs in which the expression of the Tel/CtBP complex has been ablated through use of short hairpin RNA (shRNA)-expressing lentiviruses. We found that loss of Tel/CtBP leads to a failure of angiogenesis. Thus, Tel/CtBP is an essential mediator of angiogenesis and represents an excellent target for the development of a means to inhibit aberrant angiogenesis.

Results and discussion

TeI associates with CtBP via a bona-fide consensus binding motif

Figure 3(A) highlights the conservation of the TeI CtBP-binding motif. Shown is an alignment of the TeI C-termini of different species (H. sapiens, SEQ ID No: 20; M. musculus, SEQ ID No: 21; G. gallus, SEQ ID No: 22; X. tropicalis, SEQ ID No: 23; D. rerio, SEQ ID No: 24; D. melanogaster, SEQ ID No: 25; B. mori, SEQ ID No: 26) which reveals a strongly conserved motif with significant resemblance to the previously described CtBP-binding motifs.

Figure 3(B) indicates that TeI associates most readily with CtBP2 in cells, via the PxEIM (SEQ ID No: 1) motif. 1120S cells were transfected with the indicated constructs and Tel:CtBP complexes were purified from the cells using the indicated antibodies. For this, two different buffers were employed: low stringency (left panel) and high stringency (right panel). TelΔPxEIM lacks the PxEIM (SEQ ID No: 1) motif and TeIA^* is a monomeric version of TeI that is unable to oligomerize. In the right panel, TeIIM-GG describes a mutant in which the isoleucine and methionine residues (IM) of the PxEIM (SEQ ID No: 1) motif have been replaced by two glycines (GG).

Figure 3(C) shows TeI association with endogenous CtBP2 requires the PxEIM (SEQ ID No: 1) motif. Stable cell lines expressing the indicated TeI proteins were established and association with endogenous CtBP2 was determined by immunopurification of the complexes from cell lysates using the indicated antibodies. TeIA* is a monomeric version of TeI. TelΔSAM, TelΔEts and TelΔC34 harbor respectively deletions of the SAM domain, DNA-binding domain and the C-terminal 34 amino acids (including PxEIM (SEQ ID No: 1)) (see Figure 8).

Figure 3(D) illustrates that the substrate-binding cleft of CtBP2 that interacts specifically with the PxEIM (SEQ ID No: 1) motif, is essential for binding of TeI and CtBP. Cells were transfected with the indicated constructs and complexes were purified from cell lysates using the indicated antibodies. CtBP2A58E and CtBP2V72R each express single point mutations in their substrate binding cleft. Structural analysis and computer modelling demonstrated that these amino acids should contact the PxEIM (SEQ ID No: 1) motif. CtBPKIOR harbours a substitution of lysine at position 10 for an arginine residue.

Figure 3(E) indicates that CtBPI fails to associate with DNA-bound TeI, and disrupts association of CtBP2 with DNA-bound TeI. Biotin-labelled TeI DMA-binding sites were used to co-purify the indicated proteins from cell lysates.

Figure 3(F) demonstrates that the positively charged N-terminus of CtBP2 promotes stable, high affinity binding to TeI. Also shown is an alignment of the N-termini of CtBPI (SEQ ID No: 27) and CtBP2 (SEQ ID No: 28) highlighting the charged residues of CtBP2 (bold and underlined) that were mutated either to arginine (R) or alanine (A). CtBPI ΔDim and CtBP2ΔDim each harbor mutations of the dimerization interface that abolish binding to TeI (see Figure 8). High amino acid conservation is present after the first 19 amino acids of CtBP2.

Figure 3(G) shows direct visualization of a complex between endogenous TeI and CtBP in primary endothelial cells.

In summary, Figure 3 demonstrates that TeI and CtBP form a complex in cells. This is achieved by a combination of molecular biology, biochemistry and cell imaging techniques. It also identifies the domains present in both TeI and CtBP that are essential for this association.

CtBP modulates TeI localisation and stability

Figure 4(A) demonstrates that disruption of the CtBP-interacting motif of TeI abolishes association with CtBP and leads to mis-localisation of TeI from the nucleus to the cytoplasm. Cells were transfected with indicated constructs and immunofluorescence was performed with the described antibodies. TelΔPxEIM lacks the PxEIM motif and TeIIM-GG describes a mutant in which the isoleucine and methionine residues (IM) of the PxEIM (SEQ ID No: 1) motif have been replaced by two glycines (GG).

Figure 4(B) shows that using specific, shRNA-expressing lentiviruses, the expression of tel, ctbpi and ctbp2 was ablated in U2OS cells. The effects on the corresponding protein levels was assessed by Western Blotting (top panel). Bottom panel shows the results of Western blotting with the indicated antibodies following the transfection of U2OS cells with the shown combinations of Flag-epitope tagged versions of CtBP.

In Figure 4(C) U2OS cells were transfected with the indicated constructs and Western blotting performed as shown. CtBP1ΔNAD/CtBP2ΔNAD express point mutations of the NAD(H) binding cleft that excludes association of NAD(H) with CtBP. All other constructs are described above.

In summary, Figure 4 describes our evidence for the mechanistic regulation of TeI by CtBP. In particular it provides evidence that CtBP is required for appropriate TeI stability and localization.

Metabolite regulation of endogenous TeI

In Figures 5(A) and (B), ECRF cells were cultured in the indicated conditions and the impact on the indicated proteins was assessed by Western blotting. Similar results were obtained with a number of other cell lines.

In Figure 5(C) U2OS cells were transfected with the indicated constructs and cultured for 24 hours in the indicated conditions. TeI was immunopurified from cell lysates and associated CtBP detected by Western blotting.

In summary, Figure 5 explains how the coupling of TeI and CtBP might allow metabolic regulation of TeI activity. The significance of these findings relates to the fact that the metabolism plays an "instructive" role in angiogenesis and consequently, the linking of TeI and CtBP provides a route via which the tissue metabolic status might influence angiogenesis, namely through its impact on TeI function.

Genetic regulation of metastasis and angiogenesis factors by Tel: CtBP

Figure 6(A) shows that Tel/CtBP controls the expression of mmps. RNA was prepared from U2OS cells stably expressing TeI, and the expression levels of various mmps was determined by RT-qPCR (TOP). Stable cell lines were established in which the levels of TeI, CtBP and CtBP2, were abrogated by specific shRNA-expressing Antiviruses. By the same means as above, the effects on the expression of a subset of mmps (1 & 3) are shown (B and C).

In Figure 6(D) primary HUVECs were targeted with specific shRNA-expressing Antiviruses to diminish expression of TeI (TeIi) (and CtBP2 and CtBPI , data not shown). Effective knock-down was confirmed by Westem blotting. Expression levels of the indicated transcripts were determined by RT-qPCR.

Figure 6(E) shows that loss of TeI (TeIi) and CtBP (CtBPi) leads to a sharp increase in the expression of DII4 (Delta-like 4), VE-cadherin and sprouty genes in primary endothelial cells which normally serve to constrains angiogenesis.

Figure 6(F) shows that stimulation of primary endothelial cells with VEGF triggered a wave of ERK phosphorylation during a period of approximately 30 minutes and peaking between 5-10 minutes, demonstrating that the VEGFR signal transduction pathway was activated. Concurrent to this, the endogenous Tel:CtBP complex transiently disassembled for a duration mirroring the kinetics of ERK phosphorylation. The uncoupling of the TehCtBP complex was not associated with either a global, detectable degradation or sub-cellular redistribution of the TeI or CtBP. These findings suggest that the Tel:CtBP complex is finely attuned to the VEGFR signal transduction pathway. Fig 6F also demonstrates that accompanying the transitory splitting of the TehCtBP complex, there is a sharp pulse of dll4 expression peaking between 30-60 mins.

Figure 6(G) demonstrates that TeI associates with the dll4 promoter, and that VEGF stimulated the expulsion of TeI from the dll4 promoter during a time-frame mirroring the splitting of the Tel:CtBP. Collectively, these data suggest that the Tel:CtBP complex orchestrates the temporal control of DII4 availability by VEGF signaling. Further, the data supports the notion that the Tel:CtBP complex functions to condition endothelial cells for sprouting by constraining expression of inhibitors of the process.

In summary, Figure 6 describes our analysis of the downstream targets of TeI. Specifically, we highlight MMPs (that remodel the extracellular matrix), DII4 and VE- cadherin as important targets of TeI. Importantly, we find that the Tel:CtBP complex is highly atunned to VEGF receptor signalling which is the primary impetus for angiogenesis.

Modelling angiogenesis in 3-D cultures Figure 7(A) illustrates angiogenesis in 3-D fibrin matrices. Primary endothelial cells were attached as a monolayer to collagen-coated beads of approximately 10OuM diameter (400 cells/bead). Beads embedded in a fibrin matrix on top of which were plated primary human fibroblasts that provide essential nutrient and growth factors, thus mimicking the stromal cell, endothelial cell interaction in tumors. Following one week of culture thick vessels are clearly visible. Vasculature was stained with DAPI to demonstrate the multicellular nature of the sprouts, F-actin and the endothelium-specific marker PECAM-1.

Figure 7(B & C) shows that loss of TeI (TeIi) or CtBP (CtBPi), results in a profound inhibition of endothelial sprouting.

Figure 7(D & E) demonstrates that CtBP is required for TeI regulation of endothelial sprouting. (D) Ectopic expression of wild type TeI stimulates endothelial sprouting, and expression of wild type TeI but not expression of a version of TeI that lacks the CtBP- binding motif and is thus unable to bind CtBP (TelΔPxEIM), is sufficient to rescue the loss of TeI (TeIi) phenotype. (E) TeI stimulation of endothelial sprouting requires CtBP. Ectopic expression of TeI leads to markedly enhanced endothelial sprouting in the presence (Mock) but not the absence (CtBP2i) of wild type levels of CtBP2.

Figure 7(F) shows a specific human DII4-neutralizing antibody stimulates angiogenesis as previously reported. This is expected because DII4 is an inhibitor of angiogenesis (see Ridgway, J; Zhang, G; Wu, Y; Stawicki, S; Liang, W-C; Chanthery, Y; Kowalski, J; Watts, R.J; Callahan, C; Kasman, I; Singh, M; Chien, M; Tan, C; Hongo, J-A.S; de Sauvage, F; Plowman, G; and Yan, M. Inhibition of DII4 signalling inhibits tumor growth by deregulating angiogenesis. Nature 444, 1083-1087 (2006). Fig 7(F) also shows that the same antibody rescues the loss of sprouting phenotype of cells that lack TeI.

In summary, Figure 7 describes our 3D assay of angiogenesis. Here we demonstrate unequivocally that TeI and CtBP are indispensable for endothelial sprouting. Moreover, we provide evidence that the ability of TeI to modulate endothelial sprouting depends on CtBP.

Example 2: The TeIrCtBP complex is required for normal development of zebrafish embryo vasculature in vivo In support of our studies in primary human endothelial cells (see Example 1), we explored the role of the the TeLCtBP complex in vivo. To that end, we investigated the role of the TekCtBP complex in blood vessel formation during early Danio rerio embryogenesis.

All vertebrate TeI proteins share a very high degree of homology including the consensus CtBP-binding motif. To establish if there might be functional conservation between human and Danio rerio TeI we first analysed zebrafish TeI (zTel) in human endothelial cells. Fig 9 shows that in common with ectopic expression of human TeI (hTel), zTel stimulated endothelial sprouting, whereas zTel lacking the CtBP-binding motif failed to do so. Moreover, like hTel, ectopic expression of zTel but not zTel without the CtBP-binding motif, restored the capacity to sprout of primary endothelial cells lacking endogenous TeI. Thus, in this assay, zTel could replace the ability of hTel to stimulate sprouting of human primary endothelial cells.

The founding of the zebrafish embryo circulatory system provides a readily accessible arena in which to interrogate the molecular mechanisms governing angiogenesis in vivo. It further represents an outstanding system for readily screening small molecule inhibitors of angiogenesis. The flϋa.gfp transgenic line produces embryos in which all of the endothelial cells are marked by GFP and coupled to the optically diaphanous nature of the embryos. This allows systematic visualization of in vivo angiogenesis. During the first couple of days following fertilization, the processes of vasculogenesis and angiogenesis collaboratively establish the circulatory system. Particularly striking is the reiterated pattern of intersegmental trunk vessels. These are formed by angiogenic sprouts from dorsal aorta (DA) endothelial cells that grow to the dorsal side of the trunk where they interconnect to form the dorsal longitudinal anastomotic vessel (DLAV) (see Fig 10).

Our results using primary human endothelial cells (see Example 1) raised three predictions. First, disrupting TeI function would perturb normal zebrafish embryo angiogenesis. Second, loss of CtBP2 would enhance this effect. Third, inhibiting the Tel:CtBP complex would illicitly de-repress expression of downstream target genes of the Notch/Delta pathway as well as spry4.

To test this, we employed morpholinos (MOs) targeting endogenous zebrafish TeI and CtBP2. To confirm the effectiveness of the MOs, we generated GFP mRNA transcripts that included sequences complementary to our MOs such that their translation in zebrafish embryos would be blocked by co-injection of the functional, specific MO. Fig 11 A shows that GFP mRNA including sequences complementary to either the TeI MO or CtBP2 MO efficiently produced GFP protein in zebrafish embryos when co-injected with a non-complementary MO but failed to translate GFP in the presence of its complementary MO, demonstrating that the MOs can efficiently block translation in a sequence-specific fashion.

We further confirmed the efficiency of the two TeI MOs used in the study by Western blotting of embryo lysates using a zebrafish TeI polyclonal antibody (see Fig 11 B).

Fig 10 shows that whereas injection of a control MO had no detectable effect on the pattern of intersegmental vessels, injection of 2 ng of TeI MO caused a clear disruption of the pattern in most (70-80%) of the injected embryos, manifested by a reduction in the number of vessels and the premature stalling of dorsal aorta sprouts resulting in gaps in the DLAV (embryos were scored mutant if a minimum of 10-20% of the intersegmental vessels were disrupted). Increasing the concentration of injected MOs induced proportionately more severe phenotypes in the majority (70-80%) of embryos (data not shown). Similar effects were observed with two different TeI MOs. Like the TeI MOs, injection of the CtBP2 MO (at concentrations > 1 ng) caused disruption of the intersegmental vessels in the majority of embryos that became progressively more severe as the concentration of injected CtBP2 MO was increased (data not shown). Fig 10 demonstrates that injection of 1 ng of CtBP2 MO, like the control MO, had no obvious effects on the intersegmental vessels. However, the same concentration of CtBP2 synergistically enhanced the TeI MO phenotype suggesting that in common with TeLCtBP control of human endothelial sprouting, TeI and CtBP2 cooperatively regulate normal zebrafish embryo intersegmental vessel formation (Fig 10).

To gain mechanistic insight into the role of TeI and CtBP in zebrafish embryo angiogenesis, we monitored the expression of hey 1 and hey 2, which are downstream targets of the Notch /Delta pathway, as well as spry4 which negatively regulates VEGFR signaling. Through an unbiased transcriptome analysis and by qPCR, we previously established that the TekCtBP complex controls expression of these genes in primary human endothelial cells. Fig 12 shows that loss of TeI in zebrafish embryos, led to increased expression of hey1, hey2 and spry4. Furthermore, co-injection with the CtBP2 MO enhanced this effect, particularly in the case of hey1 and hey2. The relatively low levels of expression of dll4 precluded a conclusive, quantitative analysis of its expression. These results are in agreement with previous analyses in zebrafish embryos that showed that the net effect of DII4 signaling is to inhibit angiogenesis.

Collectively, these data suggest that the Tel:CtBP complex plays an evolutionarily conserved role in the control of angiogenesis. By constraining expression of negative regulators of VEGFR signaling, in a spatio-temporally controlled manner, this complex modulates the signaling output from the opposing Notch/DII4 and VEGFR signal transduction pathways and ensures appropriate endothelial sprouting. This work also unveils a previously overlooked route by which aberrant angiogenesis might be triggered.

shRNA sequences employed in this study

All of the sequences below were obtained from the Sigma Aldrich Mission library. Below each description is provided the web page where further details may be obtained.

TeI

1 ) CCGGAGGAGCTGGATGAACAAATATCTCGAGATATTTGTTCATCCAGCTCC I I I I I I (SEQ ID No: 29)

2) CCGGGCGCCACTACTACAAACTAAACTCGAGTiTAGTTTGTAGTAGTGGCGC I I I I I (SEQ ID No: 30)

3) CCGGGTTGTTAGTATCATGGTGTTTCTCGAGAAACACCATGATACTAACAAC I I I I I (SEQ ID No: 31)

4) CCGGGCTGCTGACCAAAGAGGACTTCTCGAGAAGTCCTCTTTGGTCAGCAGCI N i l (SEQ ID No: 32)

5) CCGGCCATAAGAACAGAACAAACATCTCGAGATGTTTGTTCTGTTCTTATGG I I I I I (SEQ ID No: 33)

http://www.sigmaaldrich.com/cataloq/ProductDetail.do?N4=SHGLY- NM 0019871SIGMA&N5=RECORD SPECIBRAND KEY&F=CLON

CtBPI

1 ) CCGGGCAGAAGAAGTCAGTAGTTATCTCGAGATAACTACTGACTTCTTCTGC I I I I I (SEQ ID No: 34)

2) CCGGACCGTCAAGCAGATGAGACAACTCGAGTTGTCTCATCTGCTTGACGG I I I I I I (SEQ ID No: 35)

3) CCGGCGAGCAGGCATCCATCGAGATCTCGAGATCTCGATGGATGCCTGCTCG I I I I I (SEQ ID No: 36)

4) CCGGCTCCGCATCATCGTCCGGATTCTCGAGAATCCGGACGATGATGCGGAG I I I I I (SEQ ID No: 37)

5) CCGGCCACGCCAGTGACCAGTTGTACTCGAGTACAACTGGTCACTGGCGTGGTTTTT (SEQ ID No: 38)

http://www.siqmaaldrich.com/catalog/ProductDetail.do?N4=SHGLY- NM 001328IS!GMA&N5=RECORD SPEC[BRAND KEY&F=CLON

CtBP2

1 ) CCGGCGCATAGGATTGAAGACAGTACTCGAGTACTGTCTTCAATCCTATGCG I I I I I (SEQ ID No: 39)

2) CCGGGCCTTTGGATTCAGCGTCATACTCGAGTATGACGCTGAATCCAAAGGC I I I I I (SEQ ID No: 40)

3) CCGGCACTGCAATCTCAACGAACATCTCGAGATGTTCGTTGAGATTGCAGTG I I I I I (SEQ ID No: 41)

4) CCGGCCTGAGAGTGATCGTGCGGATCTCGAGATCCGCACGATCACTCTCAGGTTTTT (SEQ ID No: 42)

SJ CCGGTGGACAGAATTTGTGAAGGTACTCGAGTACCTTCACAAATTCTGTCCATTTTT (SEQ ID No: 43)

http://www.sigmaaldrich.com/catalog/ProductDetail.do?N4=SHGLY- NM 001329ISIGMA&N5=RECORD SPECIBRAND KEY&F=CLON

The above sequences are transcribed into shRNA.

Claims

1. A method of modulating angiogenesis in an individual in need thereof comprising administering an agent that modulates at least one function or activity of TeI to the individual.

2. An in vitro method of modulating angiogenesis comprising administering an agent that modulates at least one function or activity of TeI to tissue or cells in vitro.

3. Use of an agent that modulates at least one function or activity of TeI in the manufacture of a medicament for modulating angiogenesis in an individual in need thereof.

4. An agent that modulates at least one function or activity of TeI for use in modulating angiogenesis in an individual in need thereof.

5. A method according to Claim 1 or 2, a use according to Claim 3 and an agent according to Claim 4, wherein the agent modulates at least one of: binding of TeI to a TeI binding partner; TeI transcription factor activity; cellular location of TeI; and production of TeI in a cell.

6. A method, use or agent according to Claim 5, wherein the agent modulates binding of TeI to any of DNA, CtBP, HDAC or PIAS.

7. A method according to any of Claims 1 , 2, 5 and 6, a use according to any of Claims 3, 5 and 6, and an agent according to any of Claims 4-6, wherein the agent is any of a polypeptide, an antibody, a small molecule, a natural product, a peptidomimetic or a nucleic acid.

8. A method, use or agent according to Claim 7, wherein the agent is a portion of TeI comprising the peptide PxEIM (SEQ ID No: 1) where x is any amino acid, or a peptidomimetic which mimics the CtBP binding site in TeI.

9. A method, use or agent according to Claim 7, wherein the agent is a portion of TeI comprising the SAM domain of TeI or a peptidomimetic which mimics the SAM domain in TeI.

10. A method, use or agent according to Claim 7, wherein the agent is a portion of CtBP2 comprising Alanine-58 and Valine-72, or a portion of CtBPI comprising Alanine-52 and Valine-66, or a peptidomimetic which mimics the TeI binding site in CtBP.

11. A method, use or agent according to Claim 7, wherein the agent is an antibody that binds to the PxEIM motif in TeI where x is any amino acid or an antibody that binds to the SAM domain of TeI.

12. A method, use or agent according to Claim 7, wherein the agent is an antibody that binds to one or both of amino acids Alanine-58 and Valine-72 within CtBP2, or an antibody that binds to one or both of amino acids Alanine-52 and Valine-66 within CtBPI₁ or an antibody that binds to the oligomerisation of CtBP, or an antibody that binds to the N-terminal 10 amino acids of CtBP2.

13. A method, use or agent according to Claim 7, wherein the agent is any of an antisense oligonucleotide, a short hairpin RNA (shRNA), a micro RNA (miRNA), a small interfering RNA (siRNA) or a ribozyme.

14. A method according to any of Claims 1-13, a use according to any of Claims 3 and 5-13 and an agent according to any of Claims 4-13, wherein the agent is an inhibitor of at least one function or activity of TeI and angiogenesis is inhibited.

15. A method, use or agent according to Claim 14, wherein the individual in need thereof is one who has any one or more of the following conditions characterised by undesirable angiogenesis: cancer, psoriasis, atherosclerosis, menorrhagia, endometriosis, macular degeneration and glaucoma, arthritis (both inflammatory and rheumatoid), Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation.

16. A method according to any of Claims 1-13, a use according to any of Claims 3 and 5-13 and an agent according to any of Claims 4-13, wherein the agent is an enhancer of at least one function or activity of TeI.

17. A method, use or agent according to Claim 16, wherein the individual in need thereof is one who has any one or more of the following conditions characterised by insufficient angiogenesis: ischaemia, myocardial infarction and conditions in which blood clotting and wound healing are impaired.

18. A method of identifying a modulator of angiogenesis comprising: a) providing TeI or a portion or a variant thereof, said portion or variant being capable of binding to a TeI binding partner; b) providing a test agent; c) assessing whether the test agent modulates at least one function or activity of TeI; and d) assessing whether the test agent modulates angiogenesis in an assay for angiogenesis.

19. A method according to Claim 18, wherein the portion or variant of TeI is capable of binding to any one or more of DNA, CtBP, HDAC and PIAS.

20. A method according to Claim 18 or 19, wherein the portion or variant of TeI comprises the SAM domain of TeI.

21. A method according to any of Claims 18-20, wherein the portion or variant of TeI comprises the polypeptide PxEIM where x is any amino acid.

22. A method according to Claim 18 or 19, wherein the portion or variant of TeI comprises the SAM domain of TeI and the polypeptide PxEIM (SEQ ID No: 1) where x is any amino acid.

23. A method according to any of Claims 18-22, wherein the portion or variant of TeI is capable of binding to DNA.

24. A method according to Claim 23, wherein the portion or variant of TeI comprises the Ets DNA binding domain.

25. A method according to any of Claims 18-24, wherein step (c) comprises determining whether the test agent modulates binding of TeI or the portion or variant thereof to a binding partner.

26. A method according to Claim 25, wherein the binding partner is DNA and step (c) comprises determining whether the test agent modulates binding of TeI or the portion or variant thereof to DNA.

27. A method according to Claim 25, wherein the binding partner is CtBP and step (c) comprises determining whether the test agent modulates binding of TeI or the portion or variant thereof to CtBP or to a portion or variant of CtBP that is capable of binding to TeI.

28. A method according to Claim 27, wherein the portion or variant of CtBP is a portion or variant of CtBP2 that is capable of binding to TeI comprising the N- terminal 10 amino acids of CtBP2, the oligomerisation domain of CtBP2 and amino acids Alanine-58 and Valine-72 of CtBP2.

29. A method according to Claim 27, wherein the portion or variant of CtBP is a portion or variant of CtBPI that is capable of binding to TeI comprising the oligomerisation domain of CtBPI and amino acids Alanine-52 and Valine-66 of CtBP2.

30. A method according to Claim 25, wherein the binding partner is HDAC or PIAS and step (c) comprises determining whether the test agent modulates binding of TeI or the portion or variant thereof to HDAC or PIAS.

31. A method according to any of Claims 18-24, wherein step (c) comprises measuring the expression of a reporter gene operably linked to a DNA promoter sequence comprising a TeI binding site.

32. A method according to Claim 31 , wherein the reporter gene is any of a gene encoding chloramphenicol acetyl transferase (CAT), luciferase, β-galactosidase or Green Fluorescent Protein (GFP).

33. A method according to Claim 32, wherein the reporter gene is a gene whose expression is controlled by TeI.

34. A method according to Claim 33, wherein the reporter gene is any of metallo metal protease (MMP)-I , MMP2, MMP3, MMP8, MMP9, MMP14. Id-I ₁ FIM ₁ delta-4, VE- cadherin, Spry-2, Spry-4, hey 1 or hey 2.

35. A method according to any of Claims 18-24, wherein step (c) comprises determining whether the test agent modulates the cellular location of TeI.

36. A method of identifying a modulator of angiogenesis comprising: a) providing a test agent; b) providing a reporter gene operably linked to a TeI promoter; c) assessing whether the test agent modulates the expression of TeI; and d) assessing whether the test agent modulates angiogenesis in an assay for angiogenesis.

37. A method according to Claim 36, wherein the reporter gene is any of a gene encoding chloramphenicol acetyl transferase (CAT), luciferase, β-galactosidase or Green Fluorescent Protein (GFP).

38. A method according to Claim 37, wherein the reporter gene is the TeI gene.

39. A method according to any of Claims 18-38, wherein the modulator is an inhibitor of angiogenesis.

40. A method according to any of Claims 18-38, wherein the modulator is an enhancer of angiogenesis.

41. A method of identifying an agent which modulates the interaction between TeI and CtBP, the method comprising determining whether a test agent enhances or reduces the interaction between (a) TeI or a portion or a variant thereof, said portion or variant being capable of binding to CtBP and (b) CtBP or a portion or variant thereof, said portion or variant being capable of binding to TeI.

42. A method according to Claim 41 , wherein the portion or variant of TeI is as defined in Claim 22.

43. A method according to Claim 41 , wherein the portion or variant of CtBP is as defined in Claim 28 or 29.

44. A method according to any of Claims 41-43, further comprising assessing whether the test agent modulates angiogenesis in an assay for angiogenesis.

45. A method according to any of Claims 41-44, wherein the agent enhances the interaction between (a) TeI or a portion or a variant thereof, said portion or variant being capable of binding to CtBP and (b) CtBP or a portion or variant thereof, said portion or variant being capable of binding to TeI.

46. A method according to any of Claims 41-44, wherein the agent reduces the interaction between (a) TeI or a portion or a variant thereof, said portion or variant being capable of binding to CtBP and (b) CtBP or a portion or variant thereof, said portion or variant being capable of binding to TeI.

47. A method according to any of Claims 18_^46, wherein the test agent is any of a polypeptide, an antibody, a small molecule, a natural product, a peptidomimetic, or a nucleic acid.

48. A method according to Claim 47, wherein the test agent is a portion of TeI comprising the peptide PxEIM (SEQ ID No: 1) where x is any amino acid, a portion of TeI comprising the SAM domain of TeI, or a portion of TeI comprising the ETS DNA-binding domain of TeI.

49. A method according to Claim 47, wherein the test agent is a peptidomimetic that mimics the CtBP-binding site of TeI, a peptidomimetic that mimics the Tel-binding site in CtBP₁ a peptidomimetic which mimics the SAM domain in TeI or a peptidomimetic which mimics the ETS DNA-binding domain in TeI.

50. A method according to Claim 47, wherein the test agent is a portion of CtBP2 comprising Alanine-58 and Valine-72 or a portion of CtBPI comprising Alanine-52 and Valine-66.

51. A method according to Claim 47, wherein the test agent is an antibody that binds to the PxEIM (SEQ ID No: 1) motif in TeI where x is any amino acid or an antibody that binds to the SAM domain of TeI.

52. A method according to Claim 47, wherein the test agent is an antibody that binds to one or both of amino acids Alanine-58 and Valine-72 within CtBP2, or an antibody that binds one or both of amino acids Alanine-52 and Valine-66 within CtBPI , or an antibody that binds to the oligomerisation domain of CtBP or an antibody that binds to the N-terminal 10 amino acids of CtBP2.

53. A method according to Claim 47, wherein the test agent is any of an antisense oligonucleotide, a short hairpin RNA (shRNA), a micro RNA (miRNA), a small interfering RNA (siRNA) or a ribozyme.

54. A Tel/CtBP complex comprising (i) TeI or a portion or variant thereof, said portion or variant being capable of binding to CtBP, and (ii) CtBP or a portion or variant thereof, said portion or variant being capable of binding to TeI.

55. A Tel/CtBP complex according to Claim 54 wherein the portion or variant of TeI is as defined in Claim 22.

56. A Tel/CtBP complex according to Claim 54 or 55 wherein the portion or variant of CtBP is as defined in Claim 28 or 29.

57. A Tel/CtBP complex according to Claim 54 comprising (i) TeI and (ii) CtBP.

58. A Tel/CtBP complex according to any of Claims 54-57, wherein one or both of (i) TeI or a portion or variant thereof, said portion or variant being capable of binding to CtBP, and (ii) CtBP or a complex thereof, said portion or variant being capable of binding to TeI, are detectably labelled.

59. A polynucleotide or expression vector capable of expressing a TeI gene and a CtBP gene.

60. A mutant TeI protein which has reduced binding to CtBP relative to wild type TeI protein.

61. A mutant TeI protein according to Claim 60 which, relative to wild type TeI, has at least one mutation within the PxEIM (SEQ ID No: 1) motif of TeI where x is any amino acid.

62. A mutant TeI protein according to Claim 60 or 61 which, relative to wild type TeI has at least one mutation within the SAM domain of TeI.

63. A mutant CtBP protein which has reduced binding to TeI relative to wild type CtBP protein.

64. A mutant CtBP protein according to Claim 63, which is a mutant CtBP2 protein and wherein, relative to wild type CtBP2, the amino acid Alanine-52 and/or Valine- 66 are mutated.

65. A mutant CtBP protein according to Claim 63, which is a mutant CtBPI protein and wherein, relative to wild type CtBPI, the amino acid Alanine-52 and/or Valine- 66 are mutated.

66. A mutant CtBP protein according to Claim 63 or 64, which is a mutant CtBP2 protein and wherein, relative to wild type CtBP2, the mutant has at least one mutation in the N-terminal 20 amino acids of CtBP2.

67. A mutant CtBP protein according to any of Claims 63-66 which, relative to wild type CtBP has at least one mutation within the oligomerisation domain of CtBP.

68. A polynucleotide encoding a mutant TeI protein according to any of Claims 60-62 or a mutant CtBP protein according to any of Claims 63-67.

69. An expression vector capable of expressing a mutant TeI protein according to any of Claims 60-62 or a mutant CtBP protein according to any of Claims 63-67.

70. A host cell comprising a polynucleotide according to Claim 68 or an expression vector according to Claim 69.

71. A recombinant cell line which does not express endogenous TeI and CtBP genes.

72. A recombinant cell line according to Claim 71, which expresses at least one of an exogenous TeI gene and an exogenous CtBP gene.

73. A host cell according to Claim 70 or a recombinant cell line according to Claim 71 or 72, wherein the cell or cell line is a HUVEC cell or cell line or a U2OS cell or cell line or an ECRF cell or cell line or a 293T kidney fibroblast cell or cell line or a zebrafish fli1a:gfp cell or cell line.

74. A recombinant cell line which expresses an exogenous TeI gene and an exogenous CtBP gene.

75. A vertebrate containing a genetically engineered cell which does not express endogenous TeI and CtBP genes.

76. A vertebrate containing a genetically engineered cell which expresses an exogenous TeI gene and an exogenous CtBP gene.

77. A kit of parts comprising (a) TeI or a portion or a variant thereof, said portion or variant being capable of binding to CtBP, or a polynucleotide or expression vector encoding the same, and (b) CtBP or a portion or variant thereof, said portion or variant being capable of binding to TeI, or a polynucleotide or expression vector encoding the same.

78. A kit of parts according to Claim 77 wherein the portion or variant of TeI are as defined in Claim 22.

79. A kit of parts according to Claim 77 or 78 wherein the portion or variant of CtBP are as defined in Claim 28 or 29.

80. A kit of parts according to any of Claims 77-79, wherein the TeI or portion or variant thereof is bound to a DNA promoter sequence comprising a TeI binding site.

81. A kit of parts according to Claim 80, wherein the DNA promoter sequence is operably linked to a reporter gene.

82. A kit of parts according to Claim 81, wherein the reporter gene is as defined in any of Claims 32-34, 37 and 38.

83. A kit of parts according to Claim 81 or 82, further comprising a substrate for detecting expression of the reporter gene.

84. A kit of parts according to any of Claims 77-83, further comprising a host cell according to Claim 70 or 73 or a recombinant cell line according to any of Claims 71-74.