KR101054851B1 - Production of Colorectal Cancer Cell Surface Specific Protein-Antibody Complexes in Transgenic Plants - Google Patents

Abstract

The present invention produces a protein-antibody complex fused to an Fc region having an oligo mannose chain of a colon cancer cell surface protein and an immunoglobulin heavy chain portion for rapid stimulation of immune cells with antigen recognition ability. Present the skills to do. The vaccine according to the present invention mass-produces an antibody protein that can specifically react to colon cancer cells in plant cells, and the vaccine using the same acts more efficiently on the immune system, thereby preventing the rapid immune cells before and after the onset of colon cancer. Activation is expected to remove cancer cells.

Colon Cancer, Immunoglobulins, Oligomannose, Antibodies, Vaccines

Description

Production of colorectal cancer cell surface specific protein-antibody complex in transgenic plant {Production of GA733-2 and antibody Fc complex in transgenic plant}

The present invention provides a method for mass-producing a protein-antibody complex using plant cells, in which protein-antibody complexes fused with an immunoglobulin Fc region having a specific protein present on the surface of human colon cancer and immune cell recognition ability and using the same It relates to a colorectal cancer treatment vaccine.

With the recent westernization of diet, the number of colon cancer patients is increasing significantly. In fact, the number of patients with colorectal cancer surged 11 times in the past 23 years, from 1318 in 1982 to 15,233 in 2005. According to statistics in 2005, colorectal cancer accounted for 12.3% of the newly developed cancer patients, ranking second in cancer incidence. As a cause of colorectal cancer, studies to date indicate that genetic predisposition is only 15 to 20%, and about 80% of cancers are caused by environmental factors such as eating habits and lifestyle. Colorectal cancer, however, can increase preventive and immune functions through vaccines. However, the current research and production of antibodies and vaccines against colorectal cancer are inadequate, and the antibodies and vaccines produced by some studies are too expensive to be used in Korea. Therefore, there is no economic burden, and it is required to develop a vaccine in the form of a protein-antibody complex that can increase colon cancer cognitive ability. If we combine the technology of producing protein-antibody complex that can specifically respond to human colon cancer cells and produce antibodies using our plant cells, we can produce a large amount of not only colon cancer but also other diseases. It is thought that vaccine protein production will be possible.

Therefore, the present invention provides a vaccine for treating colorectal cancer by mass-producing antibodies by using a transformation technology for introducing a antibody into a plant cell line capable of cell culture and mass production of a colon cancer cell surface specific protein-antibody complex. do.

Accordingly, an object of the present invention is to provide a method for producing colon cancer-specific antibody protein using plant cells.

Another object of the present invention is to provide a vaccine for treating colorectal cancer comprising the antibody protein produced by the above method.

It is another object of the present invention to provide an immune enhancing vaccine protein through the vaccine.

The present invention relates to a method for producing colorectal cancer cell surface specific protein-antibody complex using plant cells and a vaccine protein using the same. In more detail, plant-cells can be used to mass-produce protein-antibody complexes in which the Fc region of the colon cancer cell surface protein and the oligo mannose chain of the immunoglobulin heavy chain is fused. It relates to a method and a vaccine for treating colorectal cancer using the same.

The present invention provides a gene for the GA733-2 protein, which is a surface protein of human colon cancer cells, and simultaneously binds to an antigen, and has an Fc region having an immune cell recognition ability, which is a molecule capable of delivering information about an antigen to immune cells. Obtain genes from (Fc region).

The gene having the Fc region is characterized by having an oligo mannose chain of the immunoglobulin heavy chain portion, which has the binding force of the surface receptors of the immune cells and promotes the induction of immune response, thus effectively acting on the immune system.

Hereinafter, the present invention will be described in detail.

At this time, if there is no other definition in the technical terms and scientific terms used, it has a meaning commonly understood by those of ordinary skill in the art.

Repeated descriptions of the same technical constitution and operation as those of the conventional art will be omitted.

RNA is isolated from SW948, a colorectal cancer cell line, and cDNA can be synthesized through reverse transcriptase reaction (RT-PCR). Synthesis of cDNA was performed by mixing oligo dT primer and reverse transcriptase superscript III (Invitrogen) with RNA samples and performing reverse transcription at 42 ° C for 50 minutes.

Through polymerase chain reaction method, a large amount of DNA gene in cDNA producing amino acid of GA733-2 can be obtained, and the antibody producing DNA gene is polymerase chain reaction from human genomic DNA. Amplification can be produced through the reaction method.

To amplify the two genes, the DNA denaturation step is performed at 95 ° C. for 20 seconds, at the primer binding step at 64 ° C. for 20 seconds, and for the DNA synthesis step at 72 ° C. for 20 seconds.

Two types of genes amplified for recombination were PCR amplified using restriction enzyme-specific primers to include restriction enzyme recognition sequences at both ends, and then in JM110 E. coli using pGEM-Teasy vector suitable for bacterial cloning. Do mass production. Culture conditions of JM110 E. coli are incubated for 16 hours using an incubator shaking at 37 ℃ temperature in LB medium. The next step is to expose KDEL to the amino acid terminal of the final product, including a DNA sequence capable of producing KDEL (5'-aaagatgaactc-3 ') amino acid at the Fc 3' end of the vesicle storage induction sequence. This induces the produced protein to be present in the endoplasmic reticulum in the transformed cell without being secreted outside the plant cell.

Two genes containing restriction enzymes at both ends (GA733-2 & Fc) were cleaved using restriction enzymes Nco I and Bam HI, and then reacted with T4 ligase for 1 hour at room temperature followed by ligation reaction at 4 ° C for 24 hours. Can be produced as a complete GA733-2 & Fc complex gene.

The gene encoding the colorectal cancer specific antibody, which is a recombinant protein through molecular biological cloning technology, is shown in SEQ ID NO: 1 below.

Recombinant colorectal cancer-specific protein-antibody complexes were inserted into Agrobacterium using a plant expressible pBINplus vector controlled by appropriate promoter and terminator signals, followed by Agrobacterium on plants. Gene transfer can be used to transform plants. The plant thus produced can produce a protein having both GA733-2 and an Fc region, and the protein complex thus produced is stored in the endoplasmic reticulum by the KDEL sequence and contains post-translational processes that can occur in the plant. -translational modification). In this process, it can be produced as a complex containing oligo-mannose chains, which can effectively remove cancer cells by rapid stimulation of immune cells with antigen recognition ability and rapid activation of immune cells. The structure of the antibody protein produced from the plant is shown in FIG.

As described above, an effective vaccine can be produced at low cost by expressing and mass producing a colorectal cancer vaccine antibody complex protein having an immune response induction promotion using plant cells. Ultimately, it is expected that the vaccine can be prevented and the immune function itself can be enhanced through vaccine administration before and after colon cancer.

Hereinafter, the present invention will be described in more detail with reference to specific examples. However, the present invention is not limited to the following examples, and it will be apparent to those skilled in the art that various changes or modifications can be made within the spirit and scope of the present invention.

[ Example 1 ]

RNA was isolated from SW948, a colon cancer cell line, and oligo dT primer and superscript III (Invitrogen), a reverse transcriptase, were mixed with RNA samples and cDNA was synthesized by reverse transcription at 42 ° C. for 50 minutes. Through polymerase chain reaction method, a large amount of DNA gene in cDNA producing amino acid of GA733-2 was obtained, and primers including specific restriction enzyme recognition sequence were designed for recombination. 5 'direction: 5'- gcccatggatacggcgacttttgccgc -3', 3 'direction: 5'- ttttagaccctgcattgagaattcaggtg -3.

Antibody-producing DNA genes were amplified and produced from polymerase chain reaction (Polymerase Chain Reaction) method from human genomic DNA. Like the GA733-2 gene, the Fc portion includes a restriction enzyme recognition portion and designed a primer sequence for polymerase chain reaction.The sequence is 5 'direction: 5'- ggatccgttgagcccaaatcttgtgac -3', 3 'direction: 5'- gctctagatcagagttcatctttacccggg -3 '.

In order to amplify the two genes, the DNA denaturation step was used for 20 seconds at 95 ° C, primer binding step at 64 ° C for 20 seconds, and DNA synthesis step at 72 ° C for 20 seconds.

Subsequently, JM110 E. coli was transformed using pGEM-Teasy vector containing empicillin resistance suitable for bacterial cloning, and cultured for 16 hours in shaker at 37 ° C in LB medium for mass production. At the end, a DNA sequence capable of producing KDEL (5'- aaagatgaactc-3 ') amino acid was induced to expose KDEL to the amino acid terminal of the final product. Two genes (GA733-2 & Fc) containing restriction enzymes at both ends were cleaved using restriction enzymes Nco I and Bam HI to perform ligation reactions. The ligation reaction was performed using T4 ligase for 1 hour at room temperature followed by 24 hours at 4 ° C to produce a perfect GA733-2 & Fc complex gene.

Figure 1 illustrates the production of colorectal cancer-specific protein-antibody complex using plant cells.

2 is a structure of antibody protein produced from plants.

A: Sugar structure change of antibody protein by translating process from endoplasmic reticulum to Golgi

B: Morphological distribution of antibody-proteins extracted from the leaves of transgenic plants capable of producing antibodies

<110> Wonkwang University Center for Industry-Academy Cooperation <120> production to vaccine for colorectal cancer with GA733-2 and          antibody Fc complex in transgenic plant <160> 1 <170> KopatentIn 1.71 <210> 1 <211> 492 <212> PRT <213> Artificial Sequence <220> <223> Fusion protein of GA733-2 protein and immunoglobulin Fc region <400> 1 Met Asp Thr Ala Thr Phe Ala Ala Ala Gln Glu Glu Cys Val Cys Glu   1 5 10 15 Asn Tyr Lys Leu Ala Val Asn Cys Phe Val Asn Asn Asn Arg Gln Cys              20 25 30 Gln Cys Thr Ser Val Gly Ala Gln Asn Thr Val Ile Cys Ser Lys Leu          35 40 45 Ala Ala Lys Cys Leu Val Met Lys Ala Glu Met Asn Gly Ser Lys Leu      50 55 60 Gly Arg Arg Ala Lys Pro Glu Gly Ala Leu Gln Asn Asn Asp Gly Leu  65 70 75 80 Tyr Asp Pro Asp Cys Asp Glu Ser Gly Leu Phe Lys Ala Lys Gln Cys                  85 90 95 Asn Gly Thr Ser Thr Cys Trp Cys Val Asn Thr Ala Gly Val Arg Arg             100 105 110 Thr Asp Lys Asp Thr Glu Ile Thr Cys Ser Glu Arg Val Arg Thr Tyr         115 120 125 Trp Ile Ile Ile Glu Leu Lys His Lys Ala Arg Glu Lys Pro Tyr Asp     130 135 140 Ser Lys Ser Leu Arg Thr Ala Leu Gln Lys Glu Ile Thr Thr Arg Tyr 145 150 155 160 Gln Leu Asp Pro Lys Phe Ile Thr Ser Ile Leu Tyr Glu Asn Asn Val                 165 170 175 Ile Thr Ile Asp Leu Val Gln Asn Ser Ser Gln Lys Thr Gln Asn Asp             180 185 190 Val Asp Ile Ala Asp Val Ala Tyr Tyr Phe Glu Lys Asp Val Lys Gly         195 200 205 Glu Ser Leu Phe His Ser Lys Lys Met Asp Leu Thr Val Asn Gly Glu     210 215 220 Gln Leu Asp Leu Asp Pro Gly Gln Thr Leu Ile Tyr Tyr Val Asp Glu 225 230 235 240 Lys Ala Pro Glu Phe Ser Met Gln Gly Leu Lys Gly Ser Val Glu Pro                 245 250 255 Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu             260 265 270 Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp         275 280 285 Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp     290 295 300 Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly 305 310 315 320 Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn                 325 330 335 Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp             340 345 350 Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro         355 360 365 Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu     370 375 380 Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn 385 390 395 400 Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile                 405 410 415 Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr             420 425 430 Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys         435 440 445 Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys     450 455 460 Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu 465 470 475 480 Ser Leu Ser Pro Gly Lys Asp Glu Leu *** Ser Arg                 485 490  

Claims (9)

delete delete delete delete delete delete delete 1) preparing a recombinant gene encoding the amino acid sequence of SEQ ID NO: 1; 2) preparing a recombinant vector by inserting the recombinant gene of step 1) into a plant cell expression vector; 3) transforming plant cells with the recombinant vector of step 2) to obtain transformed plant cells; 4) Producing a fusion protein of colorectal cancer specific cell surface protein and immunoglobulin Fc region from the transgenic plant cell of step 3): Method of producing a fusion protein of colorectal cancer specific cell surface protein and immunoglobulin Fc region from plant cells. The method of claim 8, Method for producing a fusion protein of colorectal cancer-specific cell surface protein and immunoglobulin Fc region from plant cells, characterized in that the plant cell expression vector of step 2) is a pBINplus vector.

Images