KR101052063B1 - Complex Microbial Agent for Oil Pollution Purification - Google Patents

Abstract

The present invention relates to a microorganism preparation for oil pollution purification, and more specifically, microorganisms having crude oil decomposition activity in oil-contaminated tidal flats were separated, and it was confirmed that the oil-degrading activity of the separated microorganisms was excellent, and the microorganisms were mixed. The present invention relates to a functional microbial agent useful for oil pollution purification by confirming that the microbial agent has superior oil degradation activity compared to a single microorganism.

Oil pollution purification, microbial agent, oil decomposition activity

Description

Microbial preparation for oil pollution purification {Microbial consortia for the remediation of petroleum oil}

The present invention relates to a complex microbial agent for oil pollution purification.

In the natural environment, microorganisms rarely play their own role, and they interact with microorganisms, other organisms, or the surrounding environment, and these characteristics are associated with wastewater treatment and water purification systems, survival of pathogenic microorganisms, antibiotic resistance, and contaminated environments. It is found in almost all microbial phenomena found around us, including restoration and corrosion of metals. Complex microbial agents can effectively play roles that are difficult to perform as a single microorganism by complementing one another with special functions that are not complete with one species of microorganism. To this end, complex information analysis, such as research on the function of each microorganism and complementary functions, is required.

At present, the importance of complex microorganisms is increasingly recognized as a research model of important biological resources and interactions between cells, but the full-fledged acquisition and research of complex microbial agents has not been carried out yet. The study of degradation metabolism using a single microbial strain is mainly focused on the redesign of the degraded microbial cells and the development of probes for biomonitoring.

M Vinas confirmed the usefulness of microbial complexes in crude oil degradation through experiments using five microbial complexes to decompose aromatic compounds [J of Industrial Microbiol. and Biotechnol. 2002, 28: 252-260.

Fatima Menezes Bento conducted microbial complex degradation experiments on soils contaminated with diesel and confirmed that microbial complexes effectively restored soils contaminated with diesel [Braz. J. Microbiol. 2003, 34: 65-68.

Among the isolates after the incubation culture, the well-growing species were Enterobacter and Ochrobacterium as a result of 16S rDNA sequencing, and the same species were found in the t-RFLP analysis. In addition, they were found to have a significant effect on degradation activity [Wat. Air Soil Poll. 2003, 3: 103-115.

Laurie et al. Quantified the amount of nahAc and phnAc (phenanthrene dioxygenase) from two soils in Waikato, New Zealand, PAH-contaminated, uncontaminated Siberian and Antarctic islands [Appl. Environ. Microbiol. 2000, 66: 1814-1817.

Yeates et al. Conducted PCR and hive using primers made from known aromatic hydrocarbon degradation genes for soil samples from two aromatic hydrocarbon-contaminated and two non-contaminated soils in four of Wales, Australia. New gene search and their function were observed by the hybridization method [Environ. Microbiol. 2000, 2: 644-653.

In addition, Jeon et al. Attempted to analyze the naphthalene-degrading microorganisms in situ using radioisotope techniques in coal tar-contaminated areas and to link the phylogenetic analysis and functional characteristics of the microorganisms [Jeon et al., 2003].

The oil degradation experiments of the microorganisms known to date are not completely decomposed by the use of a single microorganism, and the problem of difficult environmental adaptation has been caused, and a complex microbial agent is urgently required to solve these problems.

Therefore, the present inventors are performing a combination of microorganisms in nature rather than acting as a single microorganism, but since biotechnology has been concentrated on a single microorganism, biodegradation of marine crude oil is lacking in experiments related to research on useful microorganisms. After securing the microorganisms to confirm the functional characteristics, the present invention was completed by confirming the significantly superior oil degradation activity of the complex microbial agent by comparing the crude oil decomposition activity of the complex microbial agent and the single microorganism mixed with the microorganism.

Accordingly, an object of the present invention is to provide a single microorganism having a crude oil resolution obtained from oil contaminated tidal flat, and a combination of these microorganisms.

The present invention is a microbacterium oxydans M101 [KCTC 11366BP] having oil degradation activity, Rhodobacteraceae bacterium M116 [KCTC 11367BP], Pseudomonas marincola ( Pseudomonas marincola ) Each is characterized by M157 [KCTC 11368BP].

In addition, the present invention is another feature of the complex microbial agent mixed with two or more microorganisms.

Hereinafter, the present invention will be described in detail.

The present invention isolated microorganisms having crude oil decomposition activity in oil-contaminated tidal flats, it was confirmed that the oil-degrading activity of the separated microorganisms is excellent, and the complex microbial agent mixed with the microorganisms has superior oil degradation activity compared to a single microorganism The present invention relates to a functional microbial agent useful for the purification of oil pollution.

In the present invention, a medium used to secure oil-degrading microorganisms from tidal flats contaminated with high concentration of oil was used as a liquid medium obtained by dissolving Bushnell-Haas (BH) in artificial seawater and l% (w / v). A medium to which sterilized crude oil was added was used. A functional microbial community was secured through integrated culture in the prepared medium, and microorganisms were purely separated therein. Pure oil-separated microorganisms were screened for crude oil-degrading microorganisms, and DNA extracted from the selected microorganisms was identified for genetic identification and pure-separated microorganisms. Purely isolated oil-degrading microorganisms include Microbacterium oxydans M101 (hereinafter referred to as M101), Rhodobacteraceae bacterium M116 (hereinafter referred to as M116) and Pseudomonas marincola ) It was identified as M157 [hereinafter referred to as M157], and was deposited with the Korea Biotechnology Research Institute Gene Bank on July 23, 2008. The accession numbers were assigned to KCTC 11366BP, KCTC 11367BP and KCTC 11368BP, respectively.

As a result of analyzing oil resolution of microorganisms known to be effective for oil decomposition, selected microorganisms and complex microorganisms, the compound microorganisms had the highest resolution at 92%, and the selected oil-degrading microorganisms also had resolutions of 58 to 72%. It was confirmed that there is. In the case of the mixed microbial agent, the resolution of 80% was slightly better than that of a single microorganism. However, most other microorganisms did not even grow in marine environments and at low temperatures.

After cultivating the selected microorganisms, it was possible to grow oil in marine agar and R2A agar. It was confirmed that it is significantly lowered. The three selected microorganisms were microorganisms that could grow by using organic carbon sources other than crude oil, and crude oil resolution was quickly lost in the absence of crude oil as a carbon source. Therefore, in order to maintain oil resolution was cultured in a medium containing crude oil as a carbon source, it was confirmed that the crude oil resolution is maintained well.

In the preparation of the complex microbial preparation, each of three selected oil-degrading microorganisms was cultured, mixed in the same amount of the cells, and mixed and suspended using artificial seawater for adaptation to the marine environment. When mixed, each microorganism is preferably 24 to 40% of the total strain amount.

Therefore, the composite microbial agent according to the present invention was found to have excellent adaptation and crude oil resolving power in the marine environment, and its usefulness was also verified, and thus, it is expected to be very useful for marine oil spill accidents.

The composite microbial preparation according to the present invention has better oil resolution than a single microorganism, and the composite microbial preparation is considered to be more useful in a contaminated environment where several conditions are affected than a single microorganism. The development of bioremediation processes for marine oil pollution using complex microbial products will be accelerated, and this is expected to create economically significant added value as well as technical achievements in the purification of polluted environment.

Hereinafter, the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited to these Examples.

Example  1: Securing Oil-Degrading Functional Microbial Communities from Tidal Flats

BH medium (Table 1) was made using artificial seawater (Table 2) from Gomso Port tidal flats contaminated with oil, and 10,000 ppm of crude oil was added and cultured for 10 days at 24 ℃ and 120 rpm. This highest functional microbial community FMC-CR8 was secured.

TABLE 1

Ingredients of BH Medium

Furtherance Addition amount per L (g) Magnesium Sulfate (MgSO ₄ ) 0.2 Calcium chloride (CaCl ₂ ) 0.02 Potassium phosphate (KH ₂ PO ₄ ) 1.0 Diammonium Hydrogen Phosphate
((NH ₄ ) ₂ HPO ₄ ) 1.0 Potassium Nitrate (KNO ₃ ) 1.0 Ferric chloride (FeCl ₃ ㆍ 6H ₂ O) 0.05

TABLE 2

Composition of Artificial Seawater

Furtherance Addition amount per L (g) NaCl 24.54 MgCl ₂ · 6H ₂ O 11.10 Na ₂ SO ₄ 4.09 CaCl ₂ 1.16 KCl 0.69 NaHCO ₃ 0.20 KBr 0.10 H ₃ BO ₃ 0.03 SrCl ₂ · 6H ₂ O 0.04 NaF 0.003

Example 2: Isolation and Identification of Crude Microorganisms

The cultured microorganisms were isolated from the obtained functional microbial community FMC-CR8 by culturing at 24 ° C. for 48 hours using the media of Table 3 below. Visually observed, 12 different colonies were purely separated.

[Table 3]

Medium composition for pure separation

division Badge composition Addition amount per L (g) R2A
Baby Yeast extract 0.5 Proteos peptone
(Proteose Peptone) No.3 0.5 Cassamino
(Casamino Acids) 0.5 Dextrose 0.5 Soluble starch 0.5 Sodium citrate 0.3 K ₂ HPO ₄ 0.3 MgSO ₄ 0.05 Baby 15 Marine Baby peptone 5.0 Yeast extract 1.0 Citrate iron 0.1 Sodium chloride 19.45 Magnesium chloride 5.9 MgSO ₄ 3.24 Calcium chloride 1.8 Potassium chloride 0.55 NaHCO ₃ 0.16 KBr 0.08   SrCl₂ 34.0 Boric acid 22.0 Sodium silicate 4.0 Sodium fluoride 2.4 Ammonium Nitrate 1.6 Na ₂ HPO ₄ 8.0 Badge condition R2A baby Marine Baby R2A Agar + 10,000 ppm Crude Oil Marine Agar + 10,000 ppm Crude Oil

The crude oil degradation activity of the isolated microorganisms was analyzed. Each sample was inoculated by diluting with saline to 10 ⁷ cfu / ml. BH medium was dissolved in artificial seawater (Table 2) to make a medium, and 10,000 ppm of crude oil was added, followed by shaking culture for 10 days at 20 ° C. and 120 rpm for 10 days. As a result, high crude oil resolution was confirmed in the three isolated microorganisms. M101 had a resolution of 72%, M116 58%, and M1577 67% [Fig. 1]. The three isolated microorganisms were identified by genomic DNA extraction kit (intron), DNA extraction, PCR, and then solgent. Identification results are shown in Table 4 below.

[Table 4]

Identification of isolated microorganisms

Strain Bell Similarity M101 AM234159 Microbacterium oxydans 1028/1038 (99%) M116 AF539789 Rhodobacteraceae bacterium 942/956 (98%) M157 AB301071 Pseudomonas marincola 860/860 (100%)

Example 3: Characteristics of Selected Oil-Degrading Microorganisms

In order to examine the characteristics of selected oil degradation microorganisms, genes related to oil degradation were analyzed. For this, each microorganism was extracted with a genomic DNA extraction kit (intron), and PCR was performed using the primers of Table 5 below. . M101 has alkB2 and alkB4, M116 has alkB1, alkB2, alkB4, Rnar, bphA, nahAc, xylE, and M157 has alkB1, bphA, narB, nahAc, respectively [Fig. 2]. M101 mainly contains aliphatic hydrocarbon degradation genes, M116 contains various aliphatic and aromatic hydrocarbon degradation genes, and M157 mainly contains aromatic hydrocarbon degradation genes. From these results, it was confirmed that the three selected microorganisms are capable of decomposing complex pollutant oil through various metabolic pathways.

TABLE 6

Primer used

primer Sequence (5 '-> 3') Annealing temperature
(℃) size
(bp) target alkB1f
alkB1r ATCTGGGCGCGTTGGGATTTGAGCG (SEQ ID NO: 1)
CGCATGGTGATCGCTGTGCCGCTGC
(SEQ ID NO: 2) 60 629 Alkanes hydroxylases
(alkane hydroxylase) alkB2f
alkb2r CCTGCTCCCGATCCTCGA
(SEQ ID NO: 3)
TCGTACCGCCCGCTGTCCAC
(SEQ ID NO: 4) 60 660 Alkanes hydroxylases
(alkane hydroxylase) alkB3f
alkb3r GGTGTCGACGCTCCTGCATGGC
(SEQ ID NO: 5)
CGCCTTGGTGTGAATGAGCTCG
(SEQ ID NO: 6) 60 1282 Alkanes hydroxylases
(alkane hydroxylase) alkB4f
alkB4r TACGGTCACTTCTACATCGAG
(SEQ ID NO: 7)
ATTCGCGTGGTGGTCGGAGT
(SEQ ID NO: 8) 60 440 Alkanes hydroxylases
(alkane hydroxylase) Narf
Narr TGGACCTACAGCAACACGGGAAG
(SEQ ID NO: 9)
TGCCAGAGGCGCAGCGTCAGGAA
(SEQ ID NO: 10) 58 648 Naphthalene deoxygenase
(naphthalene dioxygenases)
[ Rhodococcus sp.] bphAf
bphAr TTCCTVAACCAGTGCCGSCACC
(SEQ ID NO: 11)
CTGGATYTCSACCCAGTTCTC
(SEQ ID NO: 12) 60 810 Biphenyl deoxygenase
(biphenyl dioxygenases) narBf
narBr ACGTGCAAGAAGGCGCGAAA
(SEQ ID NO: 13)
ACGCTCCCGCGAGGCGAGAA
(SEQ ID NO: 14) 52 653 Cis-naphthalene
Dihydrodiol deoxygenase
(cis-naphthalene
dihydrodiol dehydrogenase) nahAcf
nahAcr AGYTAYCACGGCTGGGGCTT
(SEQ ID NO: 15)
CTGTTGTTCGGGAAAACSGTGC
(SEQ ID NO: 16) 60 830 Naphthalene deoxygenase
(naphthalene dioxygenases)
[ Pseudomonase sp.] xylEf
xylEr TGCAGCTGCGTGTACTGGACA
(SEQ ID NO: 17)
GGGTCGAAGAAGTAGATGGTC
(SEQ ID NO: 18) 54 750 Catechol 2,3-deoxygenase
(catechol 2,3-dioxygenase)

PCR conditions for DGGE

Composition of reaction mixture:

1 μl DNA

12.5 pmol primer F 2.5 μl

12.5 pmol primer R 2.5 μl

1 μl 10 mM dNTP mixture

5 μl of 10 ㅧ PCR buffer

0.5 μl bobbin serum albumin (BSA)

0.5 μl of Taq DNA polymerase (TaKaRa, Japan)

36 μl dH ₂ O

Reaction conditions (30 repetitions except for initial denaturation and final extension):

Initial denaturation process-95 ℃, 3 minutes

Denaturation process-94 ℃, 1 minute

Annealing process-60 ℃, 1 minute

Polymerization process-72 ℃, 1 minute

Final extension process-72 ° C, 10 minutes

PCR reactions were identified on agarose gels.

Example 4 Cultivation of Oil-Degrading Microorganisms

Selected oil degradation microorganisms were inoculated on marine agar and R2A agar used to separate the oil degradation microorganisms from the microbial community and incubated for 48 hours in a 24 ° C. incubator. As a result of analyzing the oil resolution of the primary passage and the secondary passage culture, it was confirmed that the oil resolution rapidly decreases as the culture proceeds using a medium containing no crude oil. On the other hand, the culture of crude oil containing 0.5 ~ 1% in the medium was confirmed that the oil resolution is preserved [Fig. 3].

Example  5: Complex microbial preparation

Functional microorganisms M101, M116 and M157 have the ability to degrade crude oil while growing in marine low temperature environment. The growth rate of each microorganism is similar, and it contains genes related to oil degradation, but has been found to have different degradation metabolic pathways. The complex microbial preparation is centrifuged to collect three microbial cultures in liquid culture, so that the number of cells is 2 × 10 ⁷ ~ 5 × 10 ⁷ cfu / ml each. In artificial seawater, each of the three microorganisms was mixed and suspended in the same amount of bacterial cells to prepare a liquid microbial preparation. The crude oil resolution of the three complex microbial preparations, the two complex microbial preparations, and the single oil-degrading microorganisms were analyzed. [Fig. 4].

1 shows the oil resolution of the separated microorganisms [1: M101, 2: M102, 3: M103, 4: M114, 5: M115, 6: M116, 7: M157, 8: M158, 9; M159, 10: M1510, 11: M1511, 12: M1512].

Figure 2 shows the results of analyzing the metabolic genes related to oil degradation of the isolated microorganisms.

Figure 3 shows the change in oil resolution according to the culture method of the separated oil-degrading microorganisms.

Figure 4 is a graph comparing the oil resolution of the complex microbial agent and a single microorganism [FMC167: three complex microbial agent; MC16: M101 + M116 two-combined microbial formulation, MC17: M101 + M157 two-combined microbial formulation, MC67: M116 + M157 two-combined microbial formulation].

<110> Korea Research Institute of Bioscience and Biotechnology <120> Microbial consortia for the remediation of petroleum oil          contaminated ocean environment <160> 18 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> alkB1 forward primer <400> 1 atctgggcgc gttgggattt gagcg 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> alkB1 reverse primer <400> 2 cgcatggtga tcgctgtgcc gctgc 25 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> alkB2 forward primer <400> 3 cctgctcccg atcctcga 18 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> alkb2 reverse primer <400> 4 tcgtaccgcc cgctgtccac 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> alkB3 forward primer <400> 5 ggtgtcgacg ctcctgcatg gc 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> alkb3 reverse primer <400> 6 cgccttggtg tgaatgagct cg 22 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> alkB4 forward primer <400> 7 tacggtcact tctacatcga g 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> alkB4 reverse primer] <400> 8 attcgcgtgg tggtcggagt 20 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Rnar forward primer <400> 9 tggacctaca gcaacacggg aag 23 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Rnar reverse primer <400> 10 tgccagaggc gcagcgtcag gaa 23 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> bphA forward primer <400> 11 ttcctvaacc agtgccgsca cc 22 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> bphA reverse primer <400> 12 ctggatytcs acccagttct c 21 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> narB forward primer <400> 13 acgtgcaaga aggcgcgaaa 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> narB reverse primer <400> 14 acgctcccgc gaggcgagaa 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> nahAc forward primer <400> 15 agytaycacg gctggggctt 20 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> nahAc reverse primer <400> 16 ctgttgttcg ggaaaacsgt gc 22 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> xylE forward primer <400> 17 tgcagctgcg tgtactggac a 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> xylE reverse primer <400> 18 gggtcgaaga agtagatggt c 21  

Claims (4)

Microbacterium oxydans ( Microbacterium oxydans) M101 [KCTC 11366BP] microorganisms for oil pollution purification, characterized in that it comprises. delete delete According to claim 1, Rhodobacteraceae bacterium M116 [KCTC 11367BP] and Pseudomonas marincola The microbial agent for oil pollution purification further comprising one or two microorganisms selected from M157 [KCTC 11368BP].

Images