KR101044785B1 - Method for producing human embryonic stem cell in culture system without components derived from animal and human embryonic stem cell by produced thereof - Google Patents

Abstract

PURPOSE: A method for preparing human embryonic stem cells without components derived from animal is provided to differentiate the stem cells to various organs. CONSTITUTION: A method for preparing human embryonic stem cells in a culture system without components derived from animal comprises: a step of culturing human foreskin cells(ATCC, CRL-2429, USA) into a feeder layer using humanized CELLstart; a step of performing co-culturing an embryo of human 4-cell stage with the feeder layer; a step of removing zona pellucida using Tyrode's solution; a step of removing trophoblase by mechanical dissection to isolate an inner cell mass(ICM); a step of performing co-culture of the ICM on the feeder layer in a medium containing 15% knockout SR xeno-feee, 8ng/ml of bFGF; and a step of isolating ICM and performing co-culture of the ICM dome with the feeder layer.

Description

METHOD FOR PRODUCING HUMAN EMBRYONIC STEM CELL IN CULTURE SYSTEM WITHOUT COMPONENTS DERIVED FROM ANIMAL AND HUMAN EMBRYONIC STEM CELL BY PRODUCED THEREOF

The present invention relates to a method for producing human embryonic stem cells from human embryos and human embryonic stem cells produced thereby.

Generally, stem cells refer to undifferentiated cells that can differentiate into all kinds of mature functional cells that make up the human body. Embryonic stem (ES) cells are pluripotent cells derived from embryos and have the ability to differentiate and develop into all kinds of organs, tissues, and cells that make up the human body.

Human embryonic stem cells require a feeder layer during the culturing stage to maintain undifferentiated state and sustained proliferation. Until now, mouse embryonic fibroblasts (MEFs) are mainly used to culture human embryonic stem cells. Used as feeder cell layer. However, when the human embryonic stem cells are cultured together with the heterologous cells, there is a risk of infection with the virus, and due to the influence of the heterologous cells, there is a limit to the direct application to the clinical.

Xu et al. (2001) succeeded in culturing human embryonic stem cells without the feeder cell layer derived from heterologous cells by using the culture medium of mouse embryonic fibroblasts as a culture medium for human embryonic stem cells. However, this method does not completely exclude the problem of exposure to heterologous cells in that human embryonic stem cells are cultured using the culture medium obtained after culturing mouse embryonic fibroblasts.

In addition, even if it is cultured without a feeder layer, since it is cultured using an animal-derived substrate such as matrigel, there is still a problem in applying human embryonic stem cells directly to clinical practice (Rajala K et al., 2010). .

Accordingly, the present invention provides a culture method for stably producing human embryonic stem cells while maintaining undifferentiated characteristics in a culture system in which animal-derived substrates consisting of human-derived substrates, human foreskin feeders, and xeno-free cultures are excluded. I would like to.

The present invention provides a method for producing human embryonic stem cells from human four-cell embryos in a culture system in which animal-derived substrates consisting of human-derived substrates and human foreskin feeders and xeno-free cultures are excluded. It is intended to provide human embryonic stem cells.

The present invention comprises the steps of culturing human foreskin cells into a feeder layer using a human-derived substrate; 2) separating the inner cell mass by removing the zona pellucida and trophoblast cells from the embryo after coculture with the feeder cell layer formed in step 1; And co-culturing the inner cell mass separated in step 2 with the xeno-free culture solution in the feeder cell layer formed in step 1, to produce human embryonic stem cells. The present invention relates to a method for producing human embryonic stem cells in a culture system in which components are excluded.

In the present invention, the human-derived substrate is any one selected from the group consisting of human collagen, human gelatin, human fibronectin, human vironectin, and human laminin, or a combination thereof.

In the present invention, the zona pellucida of the embryo is characterized in that it is removed using a Tyrode's solution.

In the present invention, the trophoblast cells are removed by a mechanical dissection method.

In the present invention, the xeno-free culture is characterized in that it further comprises bFGF (basic fibroblast growth factor).

In the present invention, the concentration of bFGF (basic fibroblast growth factor) is characterized in that 1 to 20 ng / ml.

In the present invention, after extracting only the internal cell mass dome (ICM dome) portion of the inner cell mass co-cultured in the step 3, and co-cultured with the new human foreskin feeder cell layer formed in step 1 to produce human embryonic stem cells It further comprises.

In the present invention, the human embryonic stem cells of the fourth step is characterized in that it further comprises five steps of forming a cell colony (colony) and passage when the number thereof increases.

The present invention also relates to human embryonic stem cells obtained by the above production method.

The human embryonic stem cells of the present invention is one or more selected from the group consisting of alkaline phosphatase, Oct-4, SSEA-3, SSEA-4, Tra-1-60 and Tra-1-81, which are cell membrane markers of undifferentiated cells It is characterized by positive reaction in immunocytochemical staining for the marker factor.

The human embryonic stem cells of the present invention is characterized by expressing one or more mRNAs selected from the group consisting of Oct-4, Nanog, Sox-2, Rex-1 and TERT mRNA known as essential elements for establishing a multipotential stem cell do.

The human embryonic stem cells of the present invention is characterized in that to form an embryoid body (embryoid body) under differentiation conditions.

The human embryonic stem cells of the present invention are characterized by expressing at least one protein selected from the group consisting of HNF3β, an endoderm marker protein, Brachyury, a mesoderm marker protein, and Nestin, a ectoderm marker protein.

In the present invention, human embryonic stem cells were established from human four-cell embryos in a culture system in which animal-derived substrates and animal-derived components consisting of human foreskin cells and xeno-free cultures were excluded.

Human embryonic stem cells prepared in the present invention retain the cytological, immunological and genetic characteristics of undifferentiated cells.

Human embryonic stem cells prepared in the present invention form embryos under differentiation conditions, and have the ability to differentiate into various tissues.

Therefore, the cell culture method of the present invention can be usefully used in the field of treatment and research using human embryonic stem cells.

1 and 2 is a schematic diagram of a process for forming human embryonic stem cells by separating the inner cell mass in human four-cell embryo.
Figure 3 is a diagram showing the morphological characteristics of cells cultured by separating the inner cell mass after removing the zona pellucida and trophoblast cells in human four-cell embryo.
Figure 4 is a diagram showing the morphological characteristics of human embryonic stem cells formed by coculture with human foreskin cells (ICM dome) isolated from the inner cell mass.
Figure 5 is a diagram showing the morphological characteristics of the newly established human embryonic stem cell colony (colony) in the human foreskin feeder cell layer and xeno-free nutrient medium cultured with a human-derived substrate.
Figure 6 is an enlarged view of the morphological characteristics of human embryonic stem cell colony (colony) 6 days after the seventh passage of human embryonic stem cells of Figure 5D.
Figure 7 is a karyotype analysis of human embryonic stem cells prepared by coculture with the human foreskin feeder cell layer and inner cell mass cultured with a human-derived substrate.
8 is a view showing the DNA fingerprinting results for the individual identification of human embryonic stem cell line according to the present invention.
9 is a diagram showing alkaline phosphatase activity in human embryonic stem cell line according to the present invention.
10 shows the expression of undifferentiated marker expression characteristics of Oct-4, SSEA-3, SSEA-4, Tra-1-60 and Tra-1-81 in human embryonic stem cell lines by immunocytochemistry staining. The figure shown.
Figure 11 is a diagram showing the expression of Oct-4, Nanog, Sox-2, Rex-1 and TERT mRNA markers of undifferentiated cells in human embryonic stem cell line according to the present invention.
12 is a diagram confirming the formation of the embryoid body from the human embryonic stem cell line according to the present invention.
Figure 13 is a diagram showing the expression characteristics of the trioderm markers of embryonic bodies formed from human embryonic stem cell lines according to the present invention by immunocytochemistry (endoderm: HNF3β, mesoderm: Brachyury, ectoderm: Nestin).

Hereinafter, the present invention will be described in detail.

(a) Step 1: Formation of human foreskin feeder cell layer using human substrate

The extracellular matrix component that can be used in the present invention is collagen, gelatin, fibronectin, beronectin or laminin, and consists of human collagen, human gelatin, human fibronectin, human beronectin and human laminin, instead of substrates derived from existing animals. It is preferably any one selected from the group or a combination thereof.

In the present invention, in order to produce a feeder cell layer using a human-derived substrate, it is preferable to use human foreskin cells, human epithelial cells, human uterine cells and the like, and more preferably to use human foreskin cells. Through the use of such human-derived feeder cells, human embryonic stem cells can be prevented from being contaminated by animal-derived foreskin or epithelial feeder cell layers and can be directly used for clinical treatment.

The cell density of the foreskin cell layer affects the stability and performance of these cells. The cell density constituting the feeder cell layer is preferably 0.5 × 10 ⁴ to 2 × 10 ⁴ per cm ² , More preferably 0.8 × 10 ⁴ to 1.5 × 10 ⁴ . In the present invention, human foreskin cells are formed in IMDM (Invitrogen) culture containing 10% fetal bovine serum (FBS) (Hyclone, USA) and 0.5% penicillin-streptomycin (Invitrogen) for 72 hours. Preferably, the cells are cultured, and after the culture, the growth of these feeder cells is preferably treated to prevent growth. Several methods can be used, for example to treat chemicals such as radiation or mitomycin C. Most preferably, the feeder cells are treated with mitomycin C.

(b) Step 2: Remove the zona pellucida, trophoblast cells and isolate the inner cell mass

Stem cells that can be established by the production method of the present invention may be animal cells, preferably mammalian cells, more preferably primate cells, but may be cultured in an undifferentiated state using the culture system of the present invention. Cell types include stem cells derived from humans. For human stem cells, human embryonic stem cells are preferred, and human embryonic stem cells can be derived from pre-implantation embryos, such as embryos, blastocysts or lost embryos.

In the present invention, it is preferable to use a human four-cell embryo (second embryo after fertilization), and it is also possible to thaw the four-cell embryo (two embryos after fertilization) stored in liquid nitrogen. When thawed and fertilized human 4-cell embryos (day 2 after fertilization) are used, the embryos are thawed and co-cultured on a human-derived substrate and human foreskin feeder cell layer in G1.5 / HSA culture for 1 day (day 1 of culture). ), From 2nd day of culture to 4th day of culture (6 days after fertilization), co-culture on human-derived substrate and human foreskin feeder cell layer in G2.5 / HSA culture. On day 4 of coculture of the human foreskin feeder cell layer and the embryo, zona pellucida is removed to separate only the inner cell mass from the embryo (FIG. 2).

In the present invention, the method for removing the zona pellucida from the four-cell embryo includes physical methods such as pronase treatment, Tyrode's solution, and laser dissection.

As above, once the zona pellucida is removed from the embryo, trophoblast cells are exposed. The trophoblast cells are preferably completely separated from the inner cell mass. In the present invention, both an immunosurgical method using an antibody or a mechanical method using a pipette may be used to separate trophoblast cells from an inner cell mass. More preferably, the trophoblast cells are removed by mechanical dissection using a glass pipette to remove the zona pellucida and the remaining inner cell mass is separated.

(c) step 3 to 5: preparation of human embryonic stem cells by co-culture of endothelial cell and feeder cell layers

The isolated inner cell masses are cultured in a fibroblast feeder layer of human foreskin (ATCC, CRL-2429, USA) to maintain undifferentiated state. In some cases, the leukemia inhibitory factor (hLIF) may be used to keep the inner cell mass undifferentiated in place of the feeder cell layer, but in human cells, even in the case of high concentrations of LIF, cells may be absent. It cannot be maintained in an undifferentiated state.

The isolated apoptotic cells can be co-cultured with the human foreskin feeder cell layer cultured on a human-derived matrix, and from day 2 of the coculture with the isolated inner cell mass, a xeno-free medium is used. Co-cultured with the human foreskin feeder cell layer. The isolated inner cell mass forms a dome as the number of cells increases, and the trophoblast, which is little left around the inner cell mass, grows wide and flat and is clearly distinguished. On the 6th day after the coculture, only the well grown IMC dome was extracted using a glass pipette and transferred to a new human foreskin feeder cell layer.

Human embryonic stem cells (hESCs) form cell colonies and are passaged when their number increases, and human embryonic stem cells prepared in the present invention are continuously undifferentiated human embryonic stems even after passage. Possesses the characteristics of.

In the present invention, the culture medium used for co-culture of the inner cell mass separated from the human foreskin feeder cell layer is a culture medium in which serum derived from an animal is removed as a Xeno-free culture medium. The xeno-free means that the origin of the reagent is not a foreign source. That is, it means that the reagent does not contain substances of non-human animal origin for the cultivation of human stem cells.

In addition, the feeder cell layer of the present invention can be maintained in Xeno-free culture for stem cell production, suitable Xeno-free culture is 15% xeno-free in DMEM / F12 medium (xeno-free). ) Serum replacement, culture supplemented with 0.1 mM beta-mercaptoethanol, 1% non-essential amino acids (NEAA), 0.5% penicillin-streptomycin.

In addition, the culture medium may further include bFGF (basic fibroblast growth factor), the concentration of the bFGF (basic fibroblast growth factor) is preferably 0.1 to 40 ng / ml, more preferably 1 to 20 can be selected from ng / ml.

Human embryonic stem cells established by the production method of the present invention is a marker of undifferentiated cells, alkaline phosphatase (octakaline phosphatase), Oct-4 (octamer-binding transcription factor-4), stage specific embryo antigen (SSEA) -3, one or more markers selected from the group consisting of stage specific embryo antigen (SSEA-4), Tra-1-60 and Tra-1-81, preferably alkaline phosphatase, Oct-4, SSEA-3 , SSEA-4, Tra-1-60 and Tra-1-81.

The human embryonic stem cells of the present invention is characterized in that to form an embryoid body (embryoid body) under differentiation conditions.

Human embryonic stem cells established by the method of the present invention are characterized in undifferentiated embryonic stem cells (ESC), embryonic germ cells (EGC) and embryonic carcinoma cells (ECC). Expresses one or more mRNAs selected from the group consisting of Oct-4, Nanog, Sox-2, Rex-1 and TERT mRNAs, which are known to be essential for establishing multipotential stem cells, and preferably Oct-4, Nanog, It expresses all Sox-2, Rex-1 and TERT mRNA.

Human embryonic stem cells of the present invention can continuously culture human embryonic stem cells while maintaining an undifferentiated state until passage. Therefore, the present invention enables the stable culturing of human embryonic stem cells while maintaining undifferentiated properties.

Human embryonic stem cells established by the production method of the present invention form an embryoid body well under differentiation conditions. Embryos are the forms that should be formed basically in differentiation experiments using human embryonic stem cells. Therefore, human embryonic stem cells established in the present invention can be used for future differentiation experiments into various tissues.

In addition, the human embryonic stem cells established in the present invention express one or more proteins selected from the group consisting of endoderm marker protein HNF3β, mesoderm marker protein Brachyury and ectoderm marker protein Nestin, preferably endoderm marker protein HNF3β, It expresses both mesodermal marker protein Brachyury and ectoderm marker protein Nestin, and has the ability to differentiate into various tissues.

Therefore, human embryonic stem cells according to the present invention are prepared using human-derived substrate, human foreskin feeder cells and genofree culture, and directly without fear of infection due to substrates derived from animals, animal serum and heterologous feeder cell layers. It can be used for clinical therapeutic actions of the human body.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are intended to illustrate the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention.

<Example 1> Formation of feeder cell layer by culturing human derived substrate and human foreskin cell

Instead of porcine gelatin, which is a conventionally used substrate component, humanized CELLstart ™ (Invitrogen, USA), a human-derived substrate, was diluted 1:50 using DPBS, and 7 ml of the diluted solution was added to a T75 flask for 2 hours at 37 ° C. It was applied sufficiently. After 2 hours, human foreskin cells (ATCC, CRL-2429, USA) stored in liquid nitrogen were thawed for 3 minutes in a 37 ° C constant temperature water bath, centrifuged at 1,000 rpm for 30 seconds, and only cells were taken and applied with CELLstart ™ prepared in advance. 72 hours was added to the T75 flask. At this time, the nutrient medium was cultured with IMDM (Invitrogen) containing 10% fetal bovine serum (FBS) (Hyclone, USA) and 0.5% penicillin-streptomycin (Invitrogen).

Human foreskin cells incubated for 72 hours were treated with mitomycin C (sigma, USA) for 2.5 hours to inactivate cell growth, followed by 1.1 x 10 ⁴ in a 35 mm dish coated with CellStart ™ for at least 2 hours. The cells were incubated for 24 hours at a density of cells / cm ² . The next day, human foreskin cells cultured in this 35 mm dish were used as a new feeder for passage of human embryonic stem cells.

Example 2 Removal of Choroid Cells and Trophoblast Cells and Isolation of Inner Cell Mass

Human four-cell embryos that were stored frozen in liquid nitrogen were co-cultured on the human foreskin feeder layer formed in Example 1 after thawing. The culture solution was cultured using G1.5 / HSA until day 1 and then cultured until day 4 using G2.5 / HSA. After 4 days of culture, the embryos were removed using Tyrode's solution, and then cultured in a human foreskin feeder cell layer containing a culture medium consisting of 3: 7 G2.5 / HSA and DMEM / F12 cultures. (FIG. 2).

After 5 days of culture, a thin glass pipette was used to remove trophoblast cells by mechanical dissection and to separate only the inner cell mass (ICM), which is shown in FIG. 3 (after thawing). Four-cell embryos (embryo 2 days after fertilization) (A), human 4-cell embryos (B) on coculture 3 (based on co-culture date), Tyrode's solution on day 4 after co-culture 4 cell embryo (C) from which the zona pellucida was removed, incision mark of trophoblast cell removal 5 days after co-culture (D), inner cell mass (ICM) from which the zona pellucida and trophoblast cells were removed, Removed trophoblast section (G), ICM dome form (F) formed on day 6 of coculture after separation of the inner cell mass).

Example 3 Culture of Inner Cell Mass Using Human Foreskin Cell Layer

In Example 2, the inner cell mass (ICM) from which the zona pellucida and the trophoblast were removed was co-cultured with the human foreskin feeder layer prepared in Example 1. On day 2 of coculture with isolated internal cell masses, their cocultures were 15% KNOCKOUT ™ SR XenoFree (Gibco, A10992-02), 0.1 mM beta-mercaptoethanol, 1% non-essential amino acids (NEAA), 0.5% DMEM / F12 medium containing penicillin-streptomycin, 8 ng / ml fibroblast growth factor (FGF) was used. Since the human foreskin feeder cell layer can be maintained in the stem cell culture medium, it could be maintained in the above culture medium for development of stem cells of the inner cell mass when separated and coculture.

On the 6th day after the coculture, only the well grown IMC dome was extracted by using a glass pipette, and the extracted endothelial dome was divided into two pieces and cocultured in a new human foreskin feeder cell layer. Stem cells were formed, and their morphological characteristics are shown in FIG. 4 (the first ICM dome fragment (A) extracted from the inner cell mass (ICM), FIG. 4A 5 days after passage 1 (B) ), A second fragment of the inner cell mass dome (ICM dome) extracted from the inner cell mass (ICM), 7 days after the first passage of Figure 4C (D).

The coculture of the human foreskin feeder cell layer and the inner cell mass dome was performed until undifferentiated human embryonic stem cells form colonies and their number increased, and after the formation of the stem cell colonies, micropipettes were used at regular intervals. Human embryonic cells were passaged by a mechanical method, and the morphological characteristics of the human embryonic stem cell colonies established at this time were shown in FIG. 5 (day 1 after culture 2 (A, B), day 8 after passage 2 ( C), 6 days of culture after passage 7 (D)) and FIG. 6 (colon of human embryonic stem cells of FIG. 5D are 40-fold and 100-fold magnification (A, B), respectively).

Experimental Example 1 Karyotype Analysis of Human Embryonic Stem Cell Line Established in the Present Invention

In order to analyze the undifferentiated characteristics of human embryonic stem cells established in the present invention, karyotyping of human embryonic stem cells passaged 7 times in Example 3 was carried out as follows.

First, the 100 cell groups are physically separated from the human foreskin feeder cell layer, collected in 15 ml conical tubes, and then the total volume is 2 ml using medium, and colcemid (Colcemid, 10 µg / ml) is added. 200 μl was accumulated and incubated in the cell incubator for 4 hours.

After a period of time, the precipitate was centrifuged at 1000 rpm for 8 minutes, the precipitate was washed with 1 ml dPBS, centrifuged again, and 200 µl of 0.25% trypsin-EDTA was added to the precipitate, mixed, and left for 3 minutes. 1 ml of medium was added and centrifuged, followed by bathing in 0.075 M KCl stock for 20 minutes.

Centrifugation was performed by adding 0.5 ml of Canoy fixing reagent (Methanol: Acetic acid = 3: 1), followed by primary fixation and secondary fixation. After making the sample slides, the slides were observed by staining with Giemsa banding by trypsin and Giemsa (GTG). The chromosomal aberration notation followed the naming convention of the International System for Human Cytogenetic Nomenclature (ISCN) enacted in 2009, and the results are shown in FIG. As shown in Figure 7, human embryonic stem cells cultured by the method of the present invention was confirmed to have 44 autosomal and XY sex chromosomes.

Experimental Example 2 DNA Fingerprinting of Human Embryonic Stem Cell Line Established in the Present Invention

In order to analyze the undifferentiated characteristics of human embryonic stem cells (SNUhES32) established in the present invention, DNA fingerprinting analysis was performed as follows.

Using the STR AMP FLSTR PROFILER kit (Applied Biosystems, Foster city, CA, USA) on an automated ABI 310 Genetic Analyzer (Applied Biosystems, Foster city, CA, USA) for genomic DNA and human short tanderm (STR) markers DNA fingerprinting (finger printing) analysis was performed, and the results of the analysis are shown in FIG. 8.

According to Figure 8, it can be seen that the sex of the human embryonic stem cell line karyotype analysis results established in Example 3 and DNA fingerprinting results for personal identification are the same.

Experimental Example 3 alkaline phosphatase activity of human embryonic stem cell line established in the present invention

In order to analyze the undifferentiated characteristics of human embryonic stem cells (SNUhES32) established in the present invention, after performing the alkaline phosphatase activity analysis as shown in Figure 9 it is shown.

The determination of alkaline phosphatase was performed using the alkaline phosphatase detection kit (Sigma, USA) as follows. After removing the existing culture solution was washed twice by adding PBS (phosphate buffered saline, pH 7.4). It was fixed by treating 4% paraformaldehyde (4% paraformaldehyde) for 1 minute, and then washed twice with PBS for 2 minutes. After adding FRV-Alkaline Solution to Sodium Nitrite solution for 2 minutes, Naphtol AS-BI was added and the solution prepared in advance was treated to fixed cells for 15 minutes. After 15 minutes, washed 3 times with PBS for 2 minutes to observe the color development. All the above process was carried out in a dark room at room temperature.

Human embryonic stem cells established by the present invention, as shown in Figure 9, expressing alkaline phosphatase on the cell surface, it can be seen that they are undifferentiated human embryonic stem cells.

Experimental Example 4 Immunocytochemical Staining of Human Embryonic Stem Cell Line Established in the Present Invention

In order to analyze the undifferentiated characteristics of human embryonic stem cells (SNUhES32) established in the present invention, immunostaining was performed on cell surface markers of undifferentiated embryonic stem cells.

The marker factor proteins used in this example are stage specific markers, Oct-4, SSEA-3, SSEA-4, Tra-1-60 and Tra-1-81, and immunocytochemical staining as follows. Was carried out. To identify specific surface antigens of stem cells, immunocytochemical staining was performed using monoclonal antibodies for each marker factor as primary antibodies (Oct-4 (SC-5279; Santa Cruz Biotechnology, Santa Cruz, CA, USA); SSEA-3 (MC631) and SSEA-4 (MC-813-70; Developmental Studies Hybridoma Bank, lowa City, IA, USA); TRA-1-60 and TRA-1-81 ( Chemicon, Temecula, CA, USA.After treatment with the primary antibody, Alexa Fluor 488-labelled donkey anti-mouse IgG, Alexa Fluor 594-labelled donkey anti-mouse IgG and Alexa Fluor 594 donkey anti-rabbit IgG (Molecular) Probes, Inc., Eugene, OR, USA) was treated by fluorescence microscopy.

Confirmation of the expression of each marker factor as described above is shown in Figure 10 (Oct-4 (A), SSEA-3 (B), SSEA-4 (C), Tra-1-60 (D) , Tra-1-81 (E)). As shown in Figure 10, human embryonic stem cells cultured by the production method of the present invention is the cell surface markers of undifferentiated embryonic stem cells Oct-4, SSEA-3, SSEA-4, Tra-1-60 and Tra Positive reaction was found for -1-81, confirming that they were undifferentiated stem cells.

Experimental Example 5 Confirmation of Expression of Oct-4, Nanog, Sox-2, Rex-1 and TERT mRNA in Human Embryonic Stem Cell Line Established in the Present Invention

In order to analyze the differentiation characteristics of human embryonic stem cells (SNUhES32) established in the present invention, the expression of Oct-4, Nanog, Sox-2, Rex-1 and TERT mRNA was observed.

First, total RNA was isolated from human embryonic stem cells according to the method of Chomczynski and Sacchi (1987), and RT-PCR (Reverse Transcription-Polymerase Chain Reaction) for cDNA synthesis was performed as a template.

Polymerization chain reaction using each of the forward and reverse primers to determine the expression of the positive control GAPDH, Oct-4, Nanog, Sox-2, Rex-1, TERT mRNA as a template PCR) was performed, and the primers used for each gene are shown in Table 1. Meanwhile, a primer of GAPDH was used for RNA that did not perform reverse transcription reaction as a negative control.

number gene Forward primer Reverse primer One GAPDH AGCCACATCGCTCAGACACC GTACTCAGCGGCCAGCATCG 2 Oct-4 CTACAACGCCTACGAGTCCTACA TTCTGGCGCCGGTTACAGAACCA 3 Nanog CTGAGATGCCTCACACGGAGACTG GTCACACCATTGCTATTCTTC 4 Sox-2 GGCAGCTACAGCATGATGCAG GCTCTGGTAGTGCTGGGACATG 5 Rex-1 GCGTACGCAAATTAAAGTCCAGA CAGCATCCTAAACAGCTCGCAGAAT 6 TERT AGCTATGCCCGGACCTCCAT GCCTGCAGCAGGAGGATCTT

In this case, the PCR reaction conditions were denatured at 94 ° C. for 40 seconds, polymerized at 61 ° C. for 40 seconds, and then PCR was performed to repeat the reaction for 35 seconds at 72 ° C. for 40 seconds. PCR products were electrophoresed on a 2% agarose gel to confirm DNA bands, and the results are shown in FIG. 11 (100 bp ladder (lane 1), GAPDH (lane 2), negative control (lane 3), Oct-4 (lane 4). ), Nanog (lane5), Sox-2 (lane6), Rex-1 (lane7), TERT (lane8)).

As shown in Figure 11, human embryonic stem cells cultured by the method of the present invention is confirmed to express Oct-4, Nanog, Sox-2, Rex-1, TERT mRNA expression markers of undifferentiated human embryonic stem cells It became.

Experimental Example 6 Confirmation of Embryonic Formation and Differentiation Ability of Human Embryonic Stem Cell Line Established in the Present Invention

In order to confirm whether human embryonic stem cells (SNUhES32) cultured by the method of the present invention can properly differentiate under differentiation conditions, differentiation was induced.

Human embryonic stem cells were fractionated into approximately 500 embryonic stem cell clumps and transferred to a floating culture dish containing 4 ml embryonic culture medium and cultured. This was incubated for three weeks, replacing the medium once every two days.

Embryonic cultures use DMEM / F12 medium containing 15% KNOCKOUT ™ SR XenoFree (Gibco, A10992-02), 0.1 mM beta-mercaptoethanol, 1% non-essential amino acids (NEAA), 0.5% penicillin-streptomycin It was.

While culturing the cells under differentiation-inducing conditions as described above, the formation of an embryoid body was observed, and the results are shown in FIG. 12. As shown in Figure 12, human embryonic stem cells cultured by the method of the present invention well formed embryoid body.

Therefore, it can be seen that human embryonic stem cells cultured by the method of the present invention can be differentiated into various tissues by appropriately adjusting the conditions.

In order to confirm that human embryonic stem cells (SNUhES32) established in the present invention using the formed embryoid bodies are pluripotent embryonic stem cells capable of differentiating into various tissues, immunocytochemical analysis was performed using a trioderm marker. Endoderm marker HNF3β, mesoderm marker Brachyury, ectoderm marker Nestin were used as primary antibodies and biotinylated anti-rabbit, anti-mouse or anti-goat antibodies were used as secondary antibodies. . The immune response was confirmed with a fluorescence microscope, and the results are shown in FIG. 13.

According to Figure 13, it was confirmed that the human embryonic stem cells (SNUhES32) expression of endoderm marker protein HNF3β, mesoderm marker protein Brachyury, ectoderm marker protein Nestin. Therefore, the cells obtained in the present invention was found to be pluripotent embryonic stem cells with the ability to differentiate into various tissues.

Claims (13)

Culturing human foreskin cells (ATCC, CRL-2429, USA) into a feeder layer using humanized CELLstart, a human-derived substrate;
After coculture with the feeder cell layer formed in step 1, the human 4-cell embryo is removed from the embryo using a Tyrode's solution, and the trophoblast is subjected to mechanical dissection using a glass pipette. Two steps of separating the inner cell mass by removing the cells (trophoblast); And
In the feeder cell layer formed in step 1, the internal cell mass separated in step 2 was separated by 15% KNOCK serum substitute (SR) xeno-free, basic fibroblast growth factor (bFGF) 8 ng / ml. A method for producing human embryonic stem cells in a culture system in which animal-derived components are excluded, comprising the steps of co-culturing in culture medium containing human embryos.
delete delete delete delete delete 4. The method of claim 1, wherein after extracting only the internal cell mass dome (ICM dome) from the co-cultured intracellular mass in step 3, cocultured with a new human foreskin feeder cell layer formed in step 1 to prepare human embryonic stem cells. Method for producing human embryonic stem cells, characterized in that it further comprises a step.
The method of claim 7, wherein the human embryonic stem cells of the fourth stage further comprise five stages of subculture when the number of the embryonic cells forms a colony.
delete delete delete delete delete

Images