KR100991293B1

KR100991293B1 - Novel human beta defensin homolog and its usage as anti-atopic dermatitis agent

Info

Publication number: KR100991293B1
Application number: KR1020080078307A
Authority: KR
Inventors: 김수정; 정대현; 모상현; 이정훈; 김형식; 서효현
Original assignee: (주)바이오에프디엔씨
Priority date: 2008-08-11
Filing date: 2008-08-11
Publication date: 2010-11-01
Also published as: KR20100019632A

Abstract

본 발명은 신규한 인간 베타 디펜신 유사 항균 펩타이드 및 이의 아토피 피부염 개선 소재로서의 활용에 관한 것으로, 더욱 구체적으로는, 항균 활성을 가지는 인간 베타 디펜신 유사 펩타이드 및 이를 포함하는 아토피 피부 개선용 화장료 조성물에 관한 것이다. The present invention relates to a novel human beta defensin-like antimicrobial peptide and its use as an atopic dermatitis improving material, and more particularly, to a beta-defensin-like peptide having antimicrobial activity and a cosmetic composition for improving atopy skin comprising the same It is about.

본 발명에 따른 인간 베타 디펜신 유사 펩타이드는 항균 활성 및 아토피 피부염 개선능이 있어, 아토피 피부염을 비롯한 다양한 피부 질환 개선용 화장품, 의약 외품 및 의약소재로 응용가능하다.Human beta defensin-like peptide according to the present invention has antimicrobial activity and atopic dermatitis improving ability, it is applicable to cosmetics, quasi-drugs and pharmaceutical materials for improving various skin diseases including atopic dermatitis.

베타 디펜신, 항균, 아토피 Beta defensin, antibacterial, atopy

Description

Novel human beta defensin homolog and its usage as anti-atopic dermatitis agent

본 발명은 신규한 인간 베타 디펜신 유사 항균 펩타이드 및 이의 아토피 피부염 개선 소재로서의 활용에 관한 것이다. The present invention relates to novel human beta defensin-like antimicrobial peptides and their use as atopic dermatitis improving materials.

자연계에 존재하는 많은 종류의 생물체들이 생체적 방어 시스템의 일환으로 항균 펩타이드를 체내?외로 생산한다. 이러한 항균 펩타이드들은 일반적인 단백질에 비해 비교적 짧은 아미노산 서열(10여개 내지 100여개)로 이루어져 있으며, 알짜 전하(net charge) +2에서 +9 정도를 띠고 있다. 단세포 생물체에서 인간에 이르는 거의 모든 생명체가 만들어 내는 일련의 항균 펩타이드들은 현재 전 세계 연구자들에 의하여 Magainin, Cecropin, Defensin, Buforin, Protegrin, Tachyplesin을 비롯한 300종 이상이 발견되었으며, 그람 양성균(Gram +), 그람 음성균(Gram -)과 진균류(fungi), 암세포(tumor cell)에 이르기까지 폭넓은 항균활성을 나타내는 펩타이드이다. 진핵 다세포 생물에서 발견되는 항균펩타이드들은 알파 헬릭스(alpha-helix), 베타 시트(beta-sheet) 또는 무작위 코일(random coil) 구조를 가지고 있 다. Many types of organisms in nature produce antimicrobial peptides in and out of the body as part of a biological defense system. These antimicrobial peptides are composed of relatively short amino acid sequences (about 10 to 100) compared to general proteins, and have net charges of +2 to +9. The series of antimicrobial peptides produced by almost all organisms, from single-celled organisms to humans, is currently found by researchers around the world, including more than 300 species, including Magainin, Cecropin, Defensin, Buforin, Protegrin, and Tachyplesin. It is a peptide that exhibits a wide range of antimicrobial activity, ranging from Gram-negative bacteria, fungi, and cancer cells. Antimicrobial peptides found in eukaryotic multicellular organisms have an alpha-helix, beta-sheet or random coil structure.

일반적인 항균펩타이드들의 작용 기작을 보면 이들 펩타이드가 세포막에 결합하면 세포막에 이온채널(ion channel)을 형성하여 미생물의 에너지 생성을 저해하거나, 세포막에 큰 구멍을 만들게 되어 결과적으로 세포가 죽게 된다. 이와 같이 짧은 시간 내에 비특이적이면서 효과적인 물리적 방법으로 세포막을 파괴하는 작용기작을 가지고 있어서, 미생물의 세포벽이나 세포내 고분자 합성을 저해하는 기존의 항생제들과는 달리 미생물들이 항균펩타이드에 대한 내성을 갖게 되기는 매우 어려우며, 현재까지도 항균펩타이드에 의해서는 내성이 생기지 않는 것으로 보고되어 왔다. 이러한 항균 펩타이드들의 생체 내외의 발현은 항시적인 경우도 있으며, 내재성 면역(innate immune)을 자극하는 염증유발성 싸이토카인들, 세균들, 그리고 리포폴리사카라이드(lipopolysaccharides, LPS) 같은 세균 유래 물질에 의해서 유도되기도 한다.Looking at the mechanism of action of the general antimicrobial peptides when these peptides bind to the cell membrane to form an ion channel (ion channel) in the cell membrane to inhibit the energy production of microorganisms, or to make a large hole in the cell membrane, resulting in cell death. As such, it has a mechanism of destroying cell membranes in a non-specific and effective physical method within a short time, and unlike conventional antibiotics that inhibit cell wall or intracellular polymer synthesis of microorganisms, it is very difficult for microorganisms to become resistant to antimicrobial peptides. Until now, it has been reported that the antimicrobial peptide does not produce resistance. In vivo and external expression of these antimicrobial peptides is always constant and may be caused by bacterially derived substances such as proinflammatory cytokines, bacteria, and lipopolysaccharides (LPS) that stimulate innate immune. It may be induced.

항균 펩타이드의 일종으로 피부를 포함 다양한 조직에서 발현되는 인간 베타 디펜신(beta-defensin)은 피부 및 다양한 신체 조직이 발현하는 천연의 항균 펩타이드(anti-microbial peptide)로 생체 면역 체계에 가장 중요한 선천성 면역계(innate immune system)를 구성한다. 특히 상기 베타 디펜신들은 다양한 상피세포(epithelial cells)에서 발현되며, 이러한 펩타이드들의 정상적 발현은 피부 및 상피세포에 정상적 미생물천이를 유지 및 조절하는 기능을 수행한다. 이러한 조절성 항균펩타이드들의 발현이 감소되면 비정상적인 미생물 천이가 유발되고, 이는 다양한 피부질환 및 접촉성 피부염의 고착화 혹은 만성화의 원인이 되기도 한다.Human beta-defensin, which is expressed in various tissues including skin as a kind of antibacterial peptide, is a natural anti-microbial peptide expressed by skin and various body tissues and is the most important innate immune system. (innate immune system) In particular, the beta defensins are expressed in various epithelial cells, and the normal expression of these peptides functions to maintain and regulate the normal microbial transition to skin and epithelial cells. Decreased expression of these regulatory antimicrobial peptides leads to abnormal microbial transitions, which may also cause the fixation or chronicization of various skin diseases and contact dermatitis.

이러한 베타 디펜신은 분자 내부에 세 개의 시스테인 간 결합(S-S 결합, 이황화 결합)을 가지고 있으며, 알파와 베타 디펜신 간에 결합 양상에 차이가 있을 뿐 같은 그룹 안에서는 그 결합 양상 또한 일정하다. 그리고, 1-5, 2-4, 3-6 사이에 세 개의 시스테인 간 결합(S-S 결합, 이황화 결합) 존재하며, 좀 더 긴 40여개에서 50여개의 아미노산 잔기들로 구성되어 있다. 기본적으로 세 개의 베타 시트와 하나의 알파 헬릭스 구조를 유지하지만, 시스테인 사이의 아미노산 숫자 등이 어느 정도 다양하여 3차구조의 양상 및 활성도가 좀 더 다양한 것으로 알려져 있다.These beta defensins have three cysteine bonds (S-S bonds, disulfide bonds) inside the molecule, and the binding patterns between alpha and beta defensins are different, and the binding patterns are also constant in the same group. In addition, three cysteine bonds (S-S bonds, disulfide bonds) exist between 1-5, 2-4, and 3-6, and are composed of more than 40 to 50 amino acid residues. Basically, three beta sheets and one alpha helix structure are maintained, but the amino acid number between cysteines is somewhat varied, and thus the tertiary structure and activity are known to be more diverse.

아직까지 베타 디펜신을 포함한 다양한 항균 펩타이드들은 내성에 관한 보고가 없어, 심각한 문제로 대두되고 있는 기존 항생제에 대한 내성 문제를 해결할 대안으로서의 차세대 항생제로서 항균펩타이드가 부각되고 있다. Various antimicrobial peptides, including beta defensin, have not been reported yet, and antimicrobial peptides have emerged as next-generation antibiotics as an alternative to solve the problem of resistance to existing antibiotics, which is emerging as a serious problem.

따라서, 본 발명의 목적은, 인간 각질형성세포 유래 인간 베타 디펜신 유사 항균 펩타이드 및 이를 포함하는 화장료 조성물을 제공하는 데 있다. Accordingly, an object of the present invention is to provide a human beta defensin-like antibacterial peptide derived from human keratinocytes and a cosmetic composition comprising the same.

상기 목적을 달성하기 위하여, 본 발명은 서열번호 1의 아미노산 서열로 기재되는 아토피 치료능을 가진 항균 펩타이드를 제공한다. In order to achieve the above object, the present invention provides an antimicrobial peptide having therapeutic ability to atopy described by the amino acid sequence of SEQ ID NO: 1.

다른 측면에서, 본 발명은 상기 펩타이드를 코딩하는 유전자를 제공한다. In another aspect, the present invention provides a gene encoding the peptide.

본 발명의 일 구체예에 있어서, 상기 펩타이드는 서열번호 2의 염기서열을 가질 수 있다. In one embodiment of the invention, the peptide may have a nucleotide sequence of SEQ ID NO: 2.

본 발명은 또한, 상기 유전자를 포함하는 재조합 벡터를 제공한다.The present invention also provides a recombinant vector comprising the gene.

본 발명의 일 구체예에 있어서, 상기 유전자는 인간 각질형성세포로부터 유래되는 것일 수 있다.In one embodiment of the invention, the gene may be derived from human keratinocytes.

본 발명은 또 다른 측면에서, 상기 항균 펩타이드를 포함하는 화장료 조성물을 제공할 수 있고, 일 구체예로써, 상기 화장료 조성물은 아토피 피부 개선용인 화장료 조성물일 수 있다.In another aspect, the present invention may provide a cosmetic composition comprising the antimicrobial peptide, and in one embodiment, the cosmetic composition may be a cosmetic composition for improving atopic skin.

본 발명은 또 다른 측면에서, 상기 항균 펩타이드를 포함하는 아토피 피부염 치료용 약학적 조성물을 제공할 수 있다. In another aspect, the present invention may provide a pharmaceutical composition for treating atopic dermatitis comprising the antimicrobial peptide.

본 발명에 따른 인간 베타 디펜신 유사 펩타이드는 항균 활성이 있고, 아토 피 피부염 개선능이 있어, 아토피 피부염을 비롯한 다양한 피부 개선용 화장품, 의약외품 및 의약소재로 응용가능하다. Human beta defensin-like peptide according to the present invention has antimicrobial activity and atopic dermatitis improving ability, it can be applied to various skin improvement cosmetics, quasi-drugs and medicinal materials, including atopic dermatitis.

이하, 본 발명에 따른 인간 베타 디펜신 유사 항균 펩타이드 및 이를 포함하는 화장료 조성물에 대하여 상세히 설명한다. Hereinafter, the human beta defensin-like antimicrobial peptide and the cosmetic composition comprising the same according to the present invention will be described in detail.

베타 디펜신(beta-defensin), 일 예인, 인간 베타 디펜신-1(HBD-1)이 1995년도에 인간의 혈청에서 처음 분리 동정된 이후 지금까지 11개가 생화학적으로 동정되었다. 인간 베타 디펜신들의 유전체는 인간 염색체 8번에 위치해 있으며, 인간 유전체 프로젝트의 완성 후, schutte 등이 HMMER (a Computational search tool based on hidden Markov models)라는 프로그램을 BLAST와 병렬 연결하여 조사한 결과, 이 8번 염색체에 28개의 인간 베타 디펜신 유전자들이 추가적으로 존재할 수 있음을 확인하였다.Since beta-defensin, an example, human beta defensin-1 (HBD-1) was first isolated from human serum in 1995, eleven have been biochemically identified. The genome of human beta defensins is located on human chromosome 8, and after completion of the human genome project, schutte et al. Investigated a program called a Computational search tool based on hidden Markov models (HMMER) in parallel with BLAST. It was confirmed that 28 human beta defensin genes may additionally exist on the chromosome.

특히 그중 인간 베타 디펜신-25에서 -29(HBD25-29)는 전립선 등에만 유전자가 존재하는 등 매우 조직 특이적인 발현 양상을 보이고 있다. 인간 베타 디펜신-1(HBD-1)은 신장, 여성 생식기, 호흡기, 췌장, 잇몸, 혀, 중이 등의 상피세포에서 발현되며, 인간 베타 디펜신-2(HBD-2)는 1997년 건선(psoriasis) 환자의 상처부위에서 처음 발견된 후, 피부, 폐, 기도, 잇몸, 중이에서 발현되는 것으로 보고되었고 특이하게도 신장, 방광 등의 비뇨기관이나 침샘 등에는 전혀 존재하지 않는 것으로 알려져 있다. 인간 베타 디펜신-3(HBD-3)은 생화학적 동정과 유전체 분석으로부터 피부 등에 발현됨이 알려졌으며, 인간 베타 디펜신-4(HBD-4)는 BLAST 조사결 과 유전자 서열이 먼저 알려진 후, 인간 베타 디펜신-1에서 -3(HBD1-3)과는 달리 남성의 생식기 및 위장에서 발현되는 양상을 보인다. 인간 베타 디펜신-1과 -3 는 유도성이 아니고 항상 발현되는데 비해, 인간 베타 디펜신-2(HBD-2) 등 대부분 베타 디펜신은 감염 등 특정한 조건에서만 유도 발현되는 것으로 알려져 있다. 이후 유전체적으로 발견된 많은 베타 디펜신이 유도성인 것으로 알려져 있다. 이들은 피부, 잇몸, 호흡기, 생식기, 신장, 소장, 중이, 내이에 이르기까지 특히 외부에 노출이 가능한 부위의 최전선에서 각 기관을 보호하고 있을 것으로 예측된다. 유전체 안에서의 베타 디펜신의 위치는 8p23-p22, 6p12, 20p13, 20q11에 모여 있으며, 대개 두개의 엑손과 하나의 인트론으로 구성되어 있는 것으로 미루어, 몇 개의 유전자로부터 효과적 방어기전을 위해 다양한 형태로 중복 배열된 것으로 생각되고 있다.In particular, -29 (HBD25-29) in human beta defensin-25 shows a very tissue-specific expression pattern, such that the gene is present only in the prostate. Human beta defensin-1 (HBD-1) is expressed in epithelial cells of the kidneys, female genitalia, respiratory system, pancreas, gums, tongue and middle ear, and human beta defensin-2 (HBD-2) was developed in 1997 in psoriasis ( psoriasis) It has been reported to be found in the skin, lungs, airways, gums, and middle ear after its initial discovery, and it is not known to be present in the urinary organs such as kidneys, bladder, or salivary glands. Human beta defensin-3 (HBD-3) is known to be expressed in the skin, etc. from biochemical identification and genomic analysis, and human beta defensin-4 (HBD-4) is known BLAST results and gene sequence first, Unlike -3 (HBD1-3) in human beta defensin-1, it is expressed in the male genitalia and stomach. While human beta defensin-1 and -3 are not inducible and are always expressed, it is known that most beta defensins such as human beta defensin-2 (HBD-2) are induced and expressed only under certain conditions such as infection. Many genomically discovered beta defensins are known to be inducible. They are expected to protect each organ at the forefront of the skin, gums, respiratory organs, genitals, kidneys, small intestine, middle ear and inner ear, particularly in areas exposed to the outside. Beta defensins in the genome are located at 8p23-p22, 6p12, 20p13, and 20q11 and are usually composed of two exons and one intron, resulting in multiple arrangements of multiple genes for effective defense against several genes. It is thought to have been.

이와같은 인간 베타 디펜신 펩타이드의 경우, 단백질에 비하여 크기가 작아서 화학 합성이나 펩타이드 합성 및 재조합 단백질로의 합성 등의 방법에 의하여 아미노산 서열에 여러 가지 변이를 쉽게 줄 수 있기 때문에, 원래의 펩타이드보다 우수한 다양한 활성을 가진 펩타이드의 탐색이 가능하므로, 항생제, 기존 항생제의 활성을 촉진시켜 주는 보조제, 항암제, 항바이러스제, 식품첨가제, 농약 등에 이르기까지 다양하게 개발될 수 있는 가능성을 지니고 있다. 특히 대장균(Escherichia coli)을 이용한 재조합 단백질로의 생산은 대장균의 빠른 증식, 높은 발현 수율 그리고 잘 연구된 단백질 생산 시스템이라는 이유로 많이 이용되고 있으나, 목적 단백질이 항균 펩타이드인 경우 1) 축적된 단백질 산물이 생산 숙주에도 독성을 보일 가능성이 높다는 점, 2) 발현 산물의 독성을 피하기 위해 생산 숙주는 수용액상(soluble) 단백질을 생산하는 대신 변성된 봉입체(inclusion body) 단백질로 생산할 가능성 이 높다는 점, 그리고 3) 발현 산물의 독성을 피하기 위해 생산 숙주는 증대된 단백질 가수분해활성(hydrolysis activity)으로 목적 단백질을 분해할 가능성이 높다는 점 등의 한계가 존재한다. 이러한 한계를 극복하기 위해, 대장균에서 잘 발생되지 않는 코돈(codon)을 대장균에서 흔히 발생되는 코돈으로 대체하거나, 수용액상 발현을 증대시킬 수 있는 다른 단백질과 융합 단백질(fusion protein) 형태로 생산하거나, 혹은 목적 단백질을 여러 개 연결적으로 반복시켜(tendem repeat) 발현 정도를 증가시키기도 한다.Such human beta defensin peptides are smaller than proteins, and thus can be easily modified in various amino acid sequences by chemical synthesis, peptide synthesis, and synthesis into recombinant proteins. Since it is possible to search for a peptide having a variety of activities, it has the potential to be variously developed, such as antibiotics, auxiliaries that promote the activity of existing antibiotics, anticancer agents, antiviral agents, food additives, pesticides, and the like. In particular, the production of recombinant protein using Escherichia coli is widely used because of its rapid growth, high expression yield, and well-researched protein production system. However, when the target protein is an antibacterial peptide, 1) the accumulated protein product is To be toxic to the production host, 2) to avoid toxicity of the expression product, the production host is more likely to produce denatured inclusion body proteins instead of producing soluble proteins, and 3 In order to avoid toxicity of the expression product, there are limitations such as that the production host is more likely to decompose the target protein with enhanced hydrolysis activity. To overcome these limitations, codons that are less common in Escherichia coli can be replaced with codons commonly found in E. coli, or produced in the form of fusion proteins with other proteins that can increase aqueous phase expression. Or it may be possible to increase the expression level by tendem repeat of the target protein.

본 발명은 인간 베타 디펜신-1, -2, -3, 그리고 -4와 동일한 항균활성 구조(세개의 시스테인 간 결합 구조)를 갖고 특히 인간 베타 디펜신-3과 높은 상동성을 보이나 아미노산 서열의 구조가 상이한 새로운 인간 베타 디펜신 유사체(Novel Human Beta-Defensin Homolog) 유전자를 새롭게 동정한 것이다. The present invention has the same antimicrobial activity structure (three cysteine binding structures) as human beta defensin-1, -2, -3, and -4, and especially shows high homology with human beta defensin-3, Newly identified novel Novel Human Beta-Defensin Homolog genes with different structures.

구체적으로, 본 발명에 따른 인간 베타 디펜신 유사 펩타이드는 인간 피부세포, 좋게는, 인간각질형성세포, 일 예로 HaCaT 세포주로부터 분리한 RNA 로부터 합성된 cDNA를 이용하여 RT-PCR을 수행하여 아미노산 서열을 결정하고, 상기 인간 베타 디펜신 유사 펩타이드의 발현을 확인하기 위해, 재조합 벡터를 및 융합단백질을 제작하여 발현을 확인한다. Specifically, the human beta defensin-like peptide according to the present invention is subjected to RT-PCR using cDNA synthesized from human skin cells, preferably human keratinocytes, for example, RNA isolated from HaCaT cell lines to perform amino acid sequence To determine and confirm expression of the human beta defensin-like peptide, recombinant vectors and fusion proteins are constructed to confirm expression.

상기와 같이 제조되어 정제된 본 발명에 따른 인간 베타 디펜신 유사 펩타이드는 서열번호 1의 아미노산 서열로 구성되고, 좋게는 서열번호 2의 염기서열로부 터 코딩된다. 기존에 알려진 인간 베타 디펜신-1, -2, -3, 그리고 -4와 상동성 분석결과 15 내지 62%의 폭넓은 상동성을 가지고 있다. Human beta defensin-like peptide according to the present invention prepared and purified as described above is composed of the amino acid sequence of SEQ ID NO: 1, preferably encoded from the nucleotide sequence of SEQ ID NO: 2. The homology analysis of the known human beta defensin-1, -2, -3, and -4 has a broad homology of 15 to 62%.

또한, 본 발명은 상기 인간 베타 디펜신 유사 펩타이드를 코딩하는 유전자를 포함하는 재조합 벡터를 제공한다. The present invention also provides a recombinant vector comprising a gene encoding the human beta defensin-like peptide.

일반적으로 가장 많이 이용되는 벡터들은 플라스미드, E.coli 파아지 λ와 virus이고, 이들 DNA는 아래와 같은 성질을 모두 갖고 있다. 즉 벡터는 복제기점을 갖고 있고, 단순한 도말이나 생화학적 검사로 확인할 수 있는 유전자를 갖고 있으며 DNA는 CaCl2 형질전환기술을 변형한 방법을 통해서 특정 세포로 침투될 수 있다. In general, the most commonly used vectors are plasmids, E. coli phage λ and virus, and these DNAs have all of the following properties: In other words, the vector has a replication origin, a gene that can be identified by simple smear or biochemical test, and DNA can be penetrated into specific cells through a modification of CaCl2 transformation technology.

1) 특정 세포에서 잘 분열할 수 있어야 한다.1) Must be able to divide well in specific cells.

2) 형질도입 방법이 확립되어 있어야 한다.2) Transduction method should be established.

3) 특정제한효소의 작용부위가 1∼2개 이상 있어서 외래유전자를 끼워 넣을 수 있어야 한다.3) There should be more than one or two sites of action of specific restriction enzymes so that foreign genes can be inserted.

4) 유전자 자체의 존재를 알 수 있는 표식이 있거나 표식인자가 있어야 한다.4) There must be a marker or marker for the existence of the gene itself.

5) 외래유전자의 표현형으로 사용할 목적이 있는 경우에는 유전자운반체가 주세포에서 안정성을 유지하면서 되도록 많은 수자로 존재하여 하고, 강력한 프로모터를 가지고, 삽입 뒤 유전자의 발현을 조절할 수 있어야 한다.5) If the gene is intended to be used as a phenotype of a foreign gene, the gene carrier must be present in as many numbers as possible while maintaining stability in the main cell, have a strong promoter, and can control the expression of the gene after insertion.

"발현 벡터"는 적당한 숙주 세포에서 mRNA 또는 단백질을 발현할 수 있는 벡터로서, 단백질의 발현을 조절할 수 있는 조절 서열 (control sequences)에 작동 가능하도록 연결된 DNA 서열 및 기타 유전자 조작을 용이하게 하거나 단백질의 발현을 최적화하거나 또는 벡터의 복제에 필요한 서열들을 함유하는 DNA 구조물 (DNA construct)을 말한다. 상기 조절 서열에는 전사를 조절하기 위한 프로모터 (promoter), 전사를 조절하기 위해 선택적으로 부가된 오페레이터(operator), 적절한 mRNA 리보좀 결합 부위 및 전사/번역의 종료를 조절하는 서열들이 포함된다. An "expression vector" is a vector capable of expressing an mRNA or a protein in a suitable host cell, which facilitates DNA sequences and other genetic manipulations linked to or operably in control sequences capable of controlling the expression of the protein, DNA constructs containing sequences necessary for optimizing expression or replicating a vector. Such regulatory sequences include promoters for regulating transcription, operators optionally added to modulate transcription, appropriate mRNA ribosomal binding sites, and sequences regulating termination of transcription / translation.

아울러, 본 발명에 따른 유전자는 그 유래가 제한되지 않으나, 특히, 인간각질형성세포로부터 얻을 수 있다. In addition, the gene of the present invention is not limited in its origin, in particular, can be obtained from human keratinocytes.

본 발명에 따른 조성물 중 상기 인간 베타 디펜신 유사 펩타이드를 포함하는 화장료 조성물은 바람직하게는, 상기 펩타이드를 10% ~ 0.01중량% 함유하며, 10중량%를 초과하여 함유할 경우 피부 고유의 미생물을 저해할 가능성이 높고, 0.01중량% 미만을 함유하는 경우, 충분한 항균활성을 얻기에 부족할 수 있다. 또한, 다양한 형태로 제조될 수 있는데, 예컨대, 에멀젼, 로션, 크림(수중유적형, 유중수적형, 다중상), 용액, 현탁액(무수 및 수계), 무수 생성물(오일 및 글리콜계), 젤, 마스크, 팩, 분말 등의 제형으로 제조될 수 있다. The cosmetic composition comprising the human beta defensin-like peptide in the composition according to the present invention preferably contains 10% to 0.01% by weight of the peptide, and inhibits microorganisms inherent in the skin when it contains more than 10% by weight. If it is highly likely to contain and contains less than 0.01% by weight, it may be insufficient to obtain sufficient antibacterial activity. It can also be prepared in a variety of forms, for example emulsions, lotions, creams (oil-in-water, oil-in-water, multiphase), solutions, suspensions (anhydrous and aqueous), anhydrous products (oil and glycols), gels, It may be prepared in the form of a mask, a pack, a powder or the like.

또한, 본 발명의 화장료 조성물은 본 발명에 따른 인간 베타 디펜신 유사 펩타이드 이외에 화장료 조성물에 있어서 수용가능한 담체를 포함할 수 있다. 여기서, "화장료 조성물에 있어서 수용가능한 담체"란 일반적으로 화장품 제제에 포함될 수 있는 이미 공지되어 사용되고 있는 화합물 또는 조성물이거나 앞으로 개발될 화합물 또는 조성물로서 피부와의 접촉시 인체가 적응 가능한 이상의 독성, 불안정성 또는 자극성이 없는 것을 말한다.In addition, the cosmetic composition of the present invention may include an acceptable carrier in the cosmetic composition in addition to the human beta defensin-like peptide according to the present invention. Herein, "acceptable carriers in cosmetic compositions" are generally known or used compounds or compositions that can be included in cosmetic preparations or compounds or compositions that will be developed in the future, such that toxicity, instability or instability of the human body is acceptable when contacted with skin. Say something irritating.

상기 담체는 본 발명의 화장료 조성물에 그것의 전체 중량에 대하여 약 1 중량 % 내지 약 99.99 중량 %, 바람직하게는 조성물의 중량의 약 90 중량% 내지 약 99.99 중량 %로 포함될 수 있다. 그러나 상기 비율은 본 발명의 화장료 조성물이 제조되는 전술한 바의 제형에 따라, 또 그것의 구체적인 적용 부위(얼굴, 목 등)나 그것의 바람직한 적용량 등에 따라 달라지는 것이기 때문에, 상기 비율은 어떠한 측면으로든 본 발명의 범위를 제한하는 것으로 이해되어서는 안 된다.The carrier may be included in the cosmetic composition of the present invention in an amount from about 1% to about 99.99% by weight, preferably from about 90% to about 99.99% by weight of the composition. However, since the ratio varies depending on the formulation as described above in which the cosmetic composition of the present invention is prepared and its specific application site (face, neck, etc.) or its preferred application amount, the ratio may be viewed in any aspect. It should not be understood as limiting the scope of the invention.

한편, 상기 담체로서는 알코올, 오일, 계면활성제, 지방산, 실리콘 오일, 습윤제, 보습제, 점성 변형제, 유제, 안정제, 자외선 차단제, 발색제, 향료 등이 예시될 수 있다. 상기 알코올, 오일, 계면활성제, 지방산, 실리콘 오일, 습윤제, 보습제, 점성 변형제, 유제, 안정제, 자외선 차단제, 발색제, 향료로 사용될 수 있는 화합물/조성물 등은 이미 당업계에 공지되어 있기 때문에 당업자라면 적절한 해당 물질/조성물을 선택하여 사용할 수 있다.Meanwhile, examples of the carrier include alcohols, oils, surfactants, fatty acids, silicone oils, wetting agents, moisturizers, viscosity modifiers, emulsions, stabilizers, sunscreen agents, colorants, fragrances, and the like. The alcohols, oils, surfactants, fatty acids, silicone oils, wetting agents, moisturizers, viscosity modifiers, emulsions, stabilizers, sunscreens, colorants, compounds / compositions that can be used as fragrances and the like are already known in the art, Appropriate materials / compositions may be selected and used.

본 발명의 일 구현예로써, 본 발명에 따른 화장료 조성물은 상기 항균 펩타이드 이외에 글리세린, 부틸렌글리콜, 프로필렌글키롤, 폴리옥시에틸렌 경화피마자유, 에탄올, 트리에탄올아민 등을 포함할 수 있으며, 방부제, 항료, 색소, 정제수 등을 필요에 따라 미량 포함할 수 있다.As an embodiment of the present invention, the cosmetic composition according to the present invention may include glycerin, butylene glycol, propyleneglycol, polyoxyethylene hardened castor oil, ethanol, triethanolamine, etc., in addition to the antimicrobial peptide, preservatives, pharmaceuticals , Pigments, purified water, and the like may be included in trace amounts as necessary.

이에 제한되어 해석되지 않으나, 상기 화장료 조성물의 일 예로써, 글리세린 10 ~ 20%, 부틸렌글리콜 1 ~ 5%, 프로필렌글키롤 1 ~ 5%, 폴리옥시에틸렌 경화피마자유 1 ~ 5%, 에탄올 5 ~ 15%, 트리에탄올아민 1 ~ 5% 등을 포함할 수 있으며, 방부제, 항료, 색소 등은 0.001 ~ 1%의 미량, 정제수로 100%에 필요한 잔량을 첨가하 여 제조할 수 있다. Although not limited to and interpreted, as an example of the cosmetic composition, glycerin 10 to 20%, butylene glycol 1 to 5%, propylene glycolyrol 1 to 5%, polyoxyethylene hydrogenated castor oil 1 to 5%, ethanol 5 ~ 15%, triethanolamine may include 1 to 5%, and the like, preservatives, paints, pigments, etc. may be prepared by adding the required amount of 0.001 ~ 1% trace amount, 100% with purified water.

특히, 상기 화장료 조성물은 일반적인 유화 제형 및 가용화 제형의 형태로 제조될 수 있다. 유화 제형의 화장료 조성물로는 영양화장수, 크림, 에센스 등이 있으며, 가용화 제형의 화장료 조성물로는 유연화장수가 있다. 또한, 본 발명의 펩타이드를 포함하는 화장품 이외에도 피부과학적으로 허용가능한 매질 또는 기제를 함유함으로써 피부과학 분야에서 통상적으로 사용되는 국소적용 또는 전신적용할 수 있는 보조제 형태로 제조될 수 있다. In particular, the cosmetic composition may be prepared in the form of a general emulsion formulation and solubilized formulation. Cosmetic compositions of the emulsified formulations include nutrient cosmetics, creams, essences, etc., and cosmetic compositions of the solubilized formulations are soft cosmetics. In addition to cosmetics containing the peptide of the present invention, by containing a dermatologically acceptable medium or base may be prepared in the form of a topical or systemic application commonly used in the field of dermatology.

또한, 적합한 화장료 조성물의 제형으로는, 예를 들면 상기 펩타이드를 첨가한 용액, 겔, 고체 또는 반죽 무수 생성물, 수상에 유상을 분산시켜 얻은 에멀젼, 현탁액, 마이크로에멀젼, 마이크로캡슐, 미세과립구 또는 이온형(리포좀), 비이온형의 소낭 분산제의 형태, 크림, 스킨, 로션, 파우더, 연고, 스프레이 또는 콘실스틱의 형태로 제공될 수 있다. 또한, 포말(foam)의 형태 또는 압축된 추진제를 더 함유한 에어로졸 조성물의 형태로도 제조될 수 있다. In addition, formulations of suitable cosmetic compositions include, for example, emulsions, suspensions, microemulsions, microcapsules, microgranules or ionics obtained by dispersing an oil phase in a solution, gel, solid or pasty anhydrous product, aqueous phase, to which the peptide is added. (Liposomes), in the form of nonionic vesicle dispersants, in the form of creams, skins, lotions, powders, ointments, sprays or concealed sticks. It may also be prepared in the form of a foam or in the form of an aerosol composition further containing a compressed propellant.

또한, 본 발명의 화장료 조성물은 펩타이드를 포함하는 조성물에 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일,염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭 또는 화장품에 통상적으로 사용되는 임의의 다른 성분과 같은 화장품학 또는 피부과학 분야에서 통상적으로 사용되는 보조제를 추가적으로 함유할 수 있다. 그리고, 상기의 성 분들은 피부과학 분야에서 일반적으로 사용되는 양으로 도입될 수 있다.In addition, the cosmetic composition of the present invention, in addition to the composition comprising the peptide, fatty substances, organic solvents, solubilizers, thickening and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, interfaces Common to active agents, water, ionic or nonionic emulsifiers, fillers, metal ion sequestrants and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or cosmetics It may additionally contain auxiliaries commonly used in the cosmetic or dermatological field, such as any other ingredients used as. In addition, the above components may be introduced in an amount generally used in the dermatology field.

한편, 본 발명에 따른 인간 베타 디펜신 유사 펩타이드를 포함하는 약학적 조성물의 경우, 바람직하게는, 상기 펩타이드를 10% ~ 0.01중량% 함유하며, 10중량%를 초과하여 함유할 경우 피부 고유의 미생물을 저해할 가능성이 높고, 0.01중량% 미만을 함유하는 경우, 충분한 항균활성 및 약리 효과를 얻기에 부족할 수 있다. 그 약리 효과는 일 예로써, 아토피 피부염 개선 효과로 파악될 수 있다. On the other hand, in the case of the pharmaceutical composition comprising a human beta defensin-like peptide according to the present invention, preferably containing 10% to 0.01% by weight of the peptide, containing more than 10% by weight of the microorganisms inherent in the skin If it is highly likely to inhibit and contains less than 0.01% by weight, it may be insufficient to obtain sufficient antimicrobial activity and pharmacological effect. The pharmacological effect may be understood as an atopic dermatitis improvement effect, for example.

또한, 본 발명의 약학적 조성물은 유효 성분으로서 본 발명에 따른 인간 베타 디펜신 유사 펩타이드 이외에 약제학적으로 허용되는 담체를 포함할 수 있는데, 이러한 약제학적으로 허용되는 담체는 약품 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트,프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약학적 조성물은 또한 첨가제로서 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. In addition, the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier in addition to the human beta defensin-like peptide according to the present invention as an active ingredient, such a pharmaceutically acceptable carrier is commonly used in pharmaceutical preparations. Lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose , Methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but are not limited thereto. The pharmaceutical compositions of the present invention may also further comprise lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives and the like as additives.

상기 담체는 본 발명의 약학적 조성물에 그것의 전체 중량에 대하여 약 1 중량 % 내지 약 99.99 중량 %, 바람직하게는 약 90 중량% 내지 약 99.99 중량 %로 포함될 수 있으며, 상기 첨가제는 약 0.1 중량 % 내지 약 20 중량 %로 포함될 수 있다. The carrier may be included in the pharmaceutical composition of the present invention in an amount of about 1 wt% to about 99.99 wt%, preferably about 90 wt% to about 99.99 wt%, based on its total weight, and the additive is about 0.1 wt% To about 20% by weight.

한편, 본 발명의 약학적 조성물은 경구 또는 비경구로 투여될 수 있고, 가장 바람직하게는 국소 투여 방식으로 피부에 직접 투여될 수 있다.On the other hand, the pharmaceutical composition of the present invention can be administered orally or parenterally, most preferably can be administered directly to the skin in a topical mode of administration.

본 발명의 약학적 조성물은 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 용액, 현탁액 또는 유화액 형태이거나 엘렉시르제, 엑스제, 분말제, 과립제, 정제, 경고, 도고제, 로션, 연고 등을 포함할 수 있다.The pharmaceutical compositions of the present invention may be prepared in unit dose form or formulated into pharmaceutically acceptable carriers and / or excipients or incorporated into multi-dose containers. In this case, the formulation may be in the form of a solution, a suspension or an emulsion, or may include an exercire, an excipient, a powder, a granule, a tablet, a warning, a coughing agent, a lotion, an ointment, and the like.

본 발명의 약학적 조성물은 그 1일 투여량이 통상 0.001 ~ 150 mg/kg 체중 범위이고, 1회 또는 수회로 나누어 투여할 수 있다. 그러나, 본 발명의 약제학적 조성물의 투여량은 투여 경로, 환자의 연령, 성별, 체중, 환자의 중증도 등의 여러 관련 인자에 비추어 결정되는 것이므로 상기 투여량은 어떠한 측면으로든 본 발명의 범위를 제한하는 것으로 이해되어서는 아니된다.The daily dosage of the pharmaceutical composition of the present invention is usually 0.001 ~ 150 mg / kg body weight range, it can be administered once or divided into several times. However, since the dosage of the pharmaceutical composition of the present invention is determined in view of various related factors such as the route of administration, the age, sex, weight of the patient, and the severity of the patient, the dosage may limit the scope of the present invention in any aspect. It should not be understood as.

"아토피 피부염"도 그 발생의 직·간접적인 원인을 불문하고 당업계에서 아토피 피부염으로 분류되는 모든 질환을 포함하는 것으로 정의된다. 통상 아토피 피부염은 그 발병 시기 또는 그 발명 대상에 따라 유아형 아토피 피부염, 소아형 아토피 피부염, 성인형 아토피 피부염 그리고 임산부 아토피 피부염으로 분류되는데, 본 명세서에서 아토피 피부염은 이러한 모든 유형의 아토피 피부염을 포함하는 것으로서 정의된다. 본 발명의 아토피 피부염 개선용 조성물이 상기 모든 유형의 아토피 피부염을 개선시키는 효과가 있을 것임은 본 발명의 하기 실시예 및 실험예에서 확인되는 바이다. "개선"이란 치료, 예방 및 증상의 경감을 의미한다."Atopic dermatitis" is also defined to include any disease classified as atopic dermatitis in the art, regardless of the direct or indirect cause of its occurrence. Atopic dermatitis is generally classified into infantile atopic dermatitis, pediatric atopic dermatitis, adult atopic dermatitis and maternal atopic dermatitis, according to the time of its onset or subject of the invention, where atopic dermatitis includes all these types of atopic dermatitis. It is defined as. Atopic dermatitis improvement composition of the present invention will be confirmed in the following Examples and Experimental Examples of the present invention will have the effect of improving all types of atopic dermatitis. "Improvement" means treatment, prevention and alleviation of symptoms.

한편, 본 발명의 아토피 피부염 개선용 조성물에 있어서, 그 유효성분인 인 간 베타 디펜신 유사 펩타이드는 아토피 피부염 증상의 정도에 따라 그것이 인체에의 독성을 미치지 않는 범위 내에서 임의의 양으로 포함될 수 있는데, 구체적으로 조성물 전체 중량을 기준으로 할 때 0.001 중량 % 내지 99.99 중량 %로 포함될 수 있으며, 바람직하게는 0.01 중량 % 내지 10중량 %로 포함될 수 있다.On the other hand, in the composition for improving atopic dermatitis of the present invention, human beta defensin-like peptide as an active ingredient may be included in any amount within a range that does not have toxicity to the human body depending on the degree of atopic dermatitis symptoms Specifically, the composition may be included in an amount of 0.001% by weight to 99.99% by weight based on the total weight of the composition, and preferably, 0.01% by weight to 10% by weight.

본 발명에 따른 조성물은 그 유효성분인 인간 베타 디펜신 유사 펩타이드 이외에, 아토피 피부염 개선 효과를 상승 또는 보강시킬 수 있도록 아토피 피부염 개선 효과가 있다고 이미 알려진 화합물이나 식물 추출물을 포함할 수 있는데, 예컨대 비타민 A, 피탄다이올아민(WO 2003/037845), 벤조퓨란 유도체(미국 특허 제4,775,663), 아이소플라본(한국 특허 제439147호), 테트라사이클린계 화합물, 벤조일퍼옥사이드, 트리클로산, 살리실산, 레티닐 팔미테이트, 옥트옥시글리세롤, 로즈마리 추출물, 세이지 추출물, 항히스티민제(Hydroxyzine, Acrivastine 등) 등을 들 수 있으나, 이에 한정되는 것은 아니다.The composition according to the present invention may include, in addition to the human beta defensin-like peptide as an active ingredient, a compound or a plant extract that is known to have an effect of improving atopic dermatitis so that the effect of improving atopic dermatitis can be enhanced or enhanced. Phytandiolamine (WO 2003/037845), benzofuran derivatives (US Pat. No. 4,775,663), isoflavones (Korean Patent No. 439147), tetracycline compounds, benzoyl peroxide, triclosan, salicylic acid, retinyl palmitate, Octoxyglycerol, rosemary extract, sage extract, antihistamine (Hydroxyzine, Acrivastine, etc.) and the like, but are not limited thereto.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

실시예 1: 본 발명에 따른 항균 펩타이드의 동정 및 서열 분석Example 1 Identification and Sequence Analysis of Antimicrobial Peptides According to the Invention

(1) HaCaT 세포로부터의 전체 RNA 추출과 cDNA 합성(1) Total RNA Extraction and cDNA Synthesis from HaCaT Cells

인간 피부세포의 일종인 각질형성세포 세포주인 HaCaT 세포를 Dulbecco's Modified Eagle's Medium(DMEM), 10% fetal bovine serum(FBS), penicillin-streptomycin 100 IU-100 ㎍/㎕(GIBCO, Carlsbad, CA)과 함께 75 Cm² flask에서 37℃, 5% CO₂의 조건으로 배양하였다. HaCaT cells, a type of human skin cells, are combined with Dulbecco's Modified Eagle's Medium (DMEM), 10% fetal bovine serum (FBS) and penicillin-streptomycin 100 IU-100 μg / μl (GIBCO, Carlsbad, CA). Incubated in a 75 C ² flask at 37 ℃, 5% CO ₂ conditions.

상기 HaCaT 세포를 75 Cm² 플라스크(flask)에서 증식정도(confluence) 85%에서 90%까지 증식시키고, 트리졸 시약(TRIzol reagent, Invitrogen)을 10 Cm² 당 1 ml씩 약 7.5 ml 가한다. 상온에서 가볍게 흔들면서 세포를 완전히 용해시켰다. 사용된 트리졸 시약 1 ml 당 0.2 ml의 클로로포름(chloroform)을 가하여 15초간 강하게 손으로 흔든 다음 상온에서 3분간 정치 반응시켰다. 이후 12,000 xg의 속도로 15분간 원심분리를 수행하고 상등액에 일정 비율의 이소프로파놀(isopropanol)을 가하였고, 강한 교반(vortexing)으로 충분히 섞은 후 실온에서 3분간 반응시켰다. The HaCaT cells are grown from 75% to 90% confluence in a 75 Cm ² flask and about 7.5 ml of 1 ml per 10 Cm ^{2 of} Trizol reagent (Invitrogen) is added. The cells were completely lysed by shaking gently at room temperature. 0.2 ml of chloroform was added per 1 ml of the used trizol reagent, and the mixture was shaken vigorously for 15 seconds and allowed to stand for 3 minutes at room temperature. Thereafter, centrifugation was performed for 15 minutes at a rate of 12,000 xg, and a ratio of isopropanol was added to the supernatant. The mixture was sufficiently mixed with strong vortexing and reacted at room temperature for 3 minutes.

전체 RNA의 침전을 위해 4℃에서 12,000 xg의 속도로 15분간 원심분리하고, 75% 에탄올 용액으로 튜브의 내부를 씻어준 후 4℃에서 12,000 xg의 속도로 15분간 원심분리 하였다. 상등액을 완전히 제거한 후 상온에서 5분간 건조하고 0.05ml의 물을 사용하여 녹였다. 정제된 전체 RNA 30 ㎕에 0.3 ㎍/㎕ random hexamer(GIOCO) 2.5 ㎕와 10 mM dNTP mixture(Invitrogen) 2.5 ㎕를 잘 섞어주어, 65℃에서 5분간 반응 시켰다. 반응 직 후 바로 얼음으로 옮겨 1분간 방치하고 spin down하여 반응 산물을 모은 다음, 5X first-stand buffer(Invitrogen) 10 ㎕와 100 mM DTT 2.5 ㎕ 그리고 reverse transcriptase(superscript III, Invitrogen) 2.5 ㎕를 섞어주고, 상온에서 5분간 반응시킨 후 50℃에서 1시간 추가로 반응시켰다. 연속적으로 70℃에서 15분간 반응하여 cDNA를 합성하였으며, 하기 RT-PCR의 주형으로 사용하였다.For the precipitation of the total RNA was centrifuged for 15 minutes at a rate of 12,000 xg at 4 ℃, washed the inside of the tube with 75% ethanol solution and then centrifuged for 15 minutes at a rate of 12,000 xg at 4 ℃. After completely removing the supernatant, it was dried at room temperature for 5 minutes and dissolved using 0.05 ml of water. 30 μl of purified total RNA was mixed well with 2.5 μl of 0.3 μg / μl random hexamer (GIOCO) and 2.5 μl of 10 mM dNTP mixture (Invitrogen), followed by reaction at 65 ° C. for 5 minutes. Immediately after the reaction, transfer to ice for 1 minute, spin down to collect the reaction product, mix 10 μl of 5X first-stand buffer (Invitrogen) with 2.5 μl of 100 mM DTT, and 2.5 μl of reverse transcriptase (superscript III, Invitrogen). After reacting for 5 minutes at room temperature, the mixture was further reacted at 50 ° C for 1 hour. After continuously reacting at 70 ° C. for 15 minutes, cDNA was synthesized and used as a template for RT-PCR.

(2) 역전사중합효소반응(RT-PCR)(2) reverse transcriptase (RT-PCR)

상기와 같이 합성된 HaCaT cDNA 2 ㎕, 10 pmole 농도의 센스 프라이머 2 ㎕, 10 pmole 농도의 안티센스 프라이머 2 ㎕, 10X Taq 폴리머라제 버퍼 2 ㎕, 10 mM dNTP mixture 2 ㎕, Taq 폴리머라제 2 ㎕, D.W 9 ㎕을 잘 섞은 후, 1) 94℃에서 5분간 초기 변성, 2) 94℃에서 30초간 변성 과정, 3) 58℃에서 1분 간 어닐링 과정, 4) 72℃에서 1분 30초간 신장 과정, 5) 72℃에서 5분간 최종 신장 과정으로 하여 2)단계에서 4)단계를 35회 반복하였다. 사용된 센스프라이머(서열번호 3)와 안티센스프라이머(서열번호 4)들은 아래와 같다. 2 μl of HaCaT cDNA synthesized as described above, 2 μl of sense primer at 10 pmole concentration, 2 μl of antisense primer at 10 pmole concentration, 2 μl of 10X Taq polymerase buffer, 2 μl of 10 mM dNTP mixture, 2 μl of Taq polymerase, DW After mixing 9 μl well, 1) initial denaturation at 94 ° C. for 5 minutes, 2) denaturation at 94 ° C. for 30 seconds, 3) annealing at 58 ° C. for 1 minute, 4) stretching at 72 ° C. for 1 minute and 30 seconds, 5) Steps 2) to 4) were repeated 35 times as a final stretching process at 72 ° C. for 5 minutes. The sense primers used (SEQ ID NO: 3) and antisense primers (SEQ ID NO: 4) are as follows.

서열번호 3: ATGAGGATCC ATTATCTTCT GTTTGSEQ ID NO: 3: ATGAGGATCC ATTATCTTCT GTTTG

서열번호 4: AACACTCTCGTCATGTTTCAGGGTTTSEQ ID NO: 4: AACACTCTCGTCATGTTTCAGGGTTT

획득된 PCR 증폭 산물의 가시화는 1% agarose 젤 전기영동을 통해 수행하였고, 그 결과, 반복적으로 생성되는 약 1.2 kb의 PCR 산물을 확보하였다. Visualization of the obtained PCR amplification product was performed by 1% agarose gel electrophoresis, as a result, to obtain a repeatedly generated PCR product of about 1.2 kb.

도 1에 나타난 바와 같이, 특히 인간 각질형성세포에서 발현되는 다종의 베타 디펜신들(예: 베타 디펜신-1, 베타 디펜신-2, 베타 디펜신-3, 베타 디펜신-4 그리고 베타 디펜신-5) 및 인터루킨-8의 RT-PCR을 수행한 결과, 반복적으로 생성되는 약 1.2 kb의 본 발명에 따른 PCR 산물을 확보하게 되었다(도 1).As shown in FIG. 1, in particular, various beta defensins expressed in human keratinocytes (eg, beta defensin-1, beta defensin-2, beta defensin-3, beta defensin-4 and beta defensin). -5) and RT-PCR of interleukin-8 resulted in a PCR product according to the invention of about 1.2 kb which was repeatedly produced (FIG. 1).

(3) TOPO 클로닝, 서열분석 및 발현벡터 클로닝(3) TOPO cloning, sequencing and expression vector cloning

역전사중합효소연쇄반응(RT-PCR)을 통해 획득된 새로운 인간 베타 디펜신 유사체(Novel Human Beta-Defensin Homolog)를 함유하는 유전자 산물을 아가로스 젤 전기영동을 통해 정제한 후, TA 클로닝 벡터(pTA-READY)에 클로닝하였다. 형질전환(transformation) 시킨 후 암피실린 100 ㎍/mL 첨가된 LB agar plate에 도말하한 다음 37℃에서 배양하였다. 잘 자란 콜로니들을 골라 동일한 농도의 암피실린이 함유된 LB 액체 배지 10 ml에 접종한 후 37℃에서 하룻밤 배양하였다. The gene product containing the new Novel Human Beta-Defensin Homolog obtained through reverse transcriptase chain reaction (RT-PCR) was purified through agarose gel electrophoresis, followed by TA cloning vector (pTA). -READY). After transformation, the cells were plated on LB agar plate to which 100 μg / mL of ampicillin was added, and then cultured at 37 ° C. Well grown colonies were picked and inoculated in 10 ml of LB liquid medium containing the same concentrations of ampicillin and incubated overnight at 37 ° C.

배양액에서 플라스미드를 정제하고, 정제된 플라스미드를 주형으로 하여 다시 센스 프라이머(서열번호 5:ATGAGGATCC ATTATCTTCT GTTTG)와 안티센스 프라이머(서열번호 6: AACACTCTCGTCATGTTTCAGGGTTT)를 사용한 PCR에서 약 1.2 kb의 PCR 산물을 보이는 콜로니를 선별하였다. The plasmid was purified from the culture medium, and the purified plasmid was used as a template, and the colonies showing the PCR product of about 1.2 kb were detected by PCR using a sense primer (SEQ ID NO: 5: AGAGGATCC ATTATCTTCT GTTTG) and an antisense primer (SEQ ID NO: 6: AACACTCTCGTCATGTTTCAGGGTTT). Screened.

새로운 인간 베타 디펜신 유사 펩타이드의 유전자 서열을 확인하기 위하여 TA 클로닝 벡터에 내재하는 정방향 프라이머 (서열번호 7: 5'-GTAAAACGACGGCCAG-3')와 역방향 프라이머 (서열번호 8: 5'-CAGGAAACAGCTATGAC-3')를 이용하여 염기서열분석(sequencing)을 수행하였다.Forward primer (SEQ ID NO: 7: 5'-GTAAAACGACGGCCAG-3 ') and reverse primer (SEQ ID NO: 8: 5'-CAGGAAACAGCTATGAC-3') inherent in the TA cloning vector to identify the gene sequence of the new human beta defensin-like peptide. ) Sequencing was performed.

분석된 유전자 서열이 암호화하는 폴리펩타이드(polypeptide) 번역, 기존의 인간 베타 디펜신들과의 상동성 분석, 클로닝된 새로운 인간 베타 디펜신 유사체(Novel Human Beta-Defensin Homolog)의 물리적 특성 분석 등은 유전자 분석 프 로그램 GENRUNNER, GENEDOC, 그리고 CLUSTAL X 등의 프로그램으로 수행하였다.Translation of polypeptides encoded by the analyzed gene sequences, homology with existing human beta defensins, and physical characterization of cloned new Novel Human Beta-Defensin Homologs Programs GENRUNNER, GENEDOC, and CLUSTAL X.

클로닝된 새로운 인간 베타 디펜신 유사 펩타이드를 재조합 단백질로 발현하기 위한 발현벡터로의 클로닝은 다음과 같이 수행하였다.Cloning into an expression vector for expressing the cloned new human beta defensin-like peptide as a recombinant protein was performed as follows.

상기에서 확인된 인간 베타 디펜신 유사 펩타이드의 cDNA 서열을 바탕으로 센스와 안티센스의 각각 말단에 BamH I과 Nde I 제한효소 인식서열을 함유하는 프라이머를 디자인하고, 상기의 정제된 TA 클로닝 플라스미드를 주형으로 하여 PCR을 수행하였다. PCR 증폭 산물을 아가로스 젤에서 정제한 후, BamHI과 NdeI 제한효소들로 동시 절단하였다. Based on the cDNA sequence of the human beta defensin-like peptide identified above, a primer containing BamH I and Nde I restriction enzyme recognition sequences at the respective ends of sense and antisense was designed, and the purified TA cloning plasmid was used as a template. PCR was performed. PCR amplification products were purified on agarose gel and co-cut with BamHI and NdeI restriction enzymes.

새로운 인간 베타 디펜신 유사체(Novel Human Beta-Defensin Homolog)를 글루타티온 에스-트랜스퍼라아제(Glutathione S-Transferase, GST) 융합단백질로 클로닝하기 위하여 pGST-READEY 벡터를 역시 BamHI과 NdeI 제한효소들로 동시 절단하였다. 이 제한효소 처리 산물을 아가로스 젤 전기영동 후 제한효소 절단이 확인된 벡터들만을 gel extraction으로 분리 정제하였다. 상기에서 제한 효소 동시 처리 후 준비된 인간 베타 디펜신 유사 펩타이드의 유전자와 GST-융합단백질 발현용 벡터를 1:1 몰비로 라이게이션하여 형질전환 하였다. Simultaneous cleavage of the pGST-READEY vector with BamHI and NdeI restriction enzymes to clone the novel Human Beta-Defensin Homolog into a glutathione S-Transferase (GST) fusion protein It was. The restriction enzyme treatment product was separated and purified by gel extraction only after agarose gel electrophoresis. After co-treatment with restriction enzymes, the genes of the human beta defensin-like peptide prepared and the GST-fusion protein expression vector were ligated in a 1: 1 molar ratio for transformation.

형질전환 시킨 후 암피실린이 100 ㎍/ml 농도로 첨가된 LB 아가 플레이트에 도말하한 다음 37℃에서 배양하였다. 잘 자란 콜로니들을 골라 동일 농도의 암피실린이 함유된 LB배지 10 ml에 접종한 후 37℃에서 하룻밤 배양하였다. 배양액에서 플라스미드를 정제하고, 정제된 플라스미드를 주형으로 하여 다시 센스 프라이머 (서열번호 9: AATGGATTCATGAGTTATTTGAGGAATTC)와 안티센스 프라이머(서열번호 10: AATCATATGTTATTTCTTTCTTCGGCAGC)를 사용한 PCR에서 약 240 bp의 PCR 산물을 보이는 콜로니를 선별하였다. After transformation, the cells were plated on LB agar plates containing ampicillin at a concentration of 100 μg / ml, and then cultured at 37 ° C. Well grown colonies were picked and inoculated in 10 ml of LB medium containing the same concentration of ampicillin and then incubated overnight at 37 ° C. The plasmid was purified from the culture, and the purified plasmid was used as a template to select colonies showing PCR products of about 240 bp by PCR using a sense primer (SEQ ID NO: 9: AATGGATTCATGAGTTATTTGAGGAATTC) and an antisense primer (SEQ ID NO: 10: AATCATATGTTATTTCTTTCTTCGGCAGC). .

분석된 유전자서열 1213 bp은 기존에 알려진 서열로부터 계산되어 예측되는 230bp보다 훨씬 큰 서열이였으며, 다양한 PCR 조건에서 일관되게 생산되었다. 상기 서열을 유전자 분석 프로그램인 GENRUNNER를 사용하여 암호화된 폴리펩타이드들을 분석한 결과, 하기 표 1에서와 같이 아미노산 서열 총 12개의 암호화 폴리펩타이드가 확인되었다(표 1).The analyzed gene sequence 1213 bp was much larger than 230 bp calculated and predicted from known sequences, and was consistently produced under various PCR conditions. As a result of analyzing the encoded polypeptides by using the gene analysis program GENRUNNER, the sequence encoded 12 encoded polypeptides as shown in Table 1 below (Table 1).

[표 1]TABLE 1

그 중 가장 큰 폴리펩타이드를 암호화하는 서열은 234 bp로 77개의 아미노산 서열을 암호화하였다(도 2A, 밑줄). 새롭게 확인된 cDNA 서열과 폴리펩타이드 서열을 각각 유전자 데이터베이스(http://blast.ncbi.nlm.nih.gov/Blast.cgi)와 단백질 데이터베이스(http://blast.ncbi.nlm.nih.gov/Blast.cgi)에서 비교 분석한 결과, 기존에 알려지지 않은 새로운 단백질을 암호화하는 유전자 서열로써 다양한 인간 베타 디펜신 단백질들과 유사한 항균활성 펩타이드로 확인되었다.Among them, the sequence encoding the largest polypeptide encoded 77 amino acid sequences at 234 bp (FIG. 2A, underlined). The newly identified cDNA sequence and polypeptide sequence were obtained from a genetic database (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and a protein database (http://blast.ncbi.nlm.nih.gov/ In Blast.cgi), the gene sequence encoding a new protein, which is not known, was identified as an antimicrobial peptide similar to various human beta defensin proteins.

실시예Example 2: 본 발명에 따른 항균 2: antibacterial according to the present invention 펩타이드의Peptide 상동성Homology 및 물리적 특성 분석 And physical characterization

(1) 본 발명에 따른 항균 펩타이드의 상동성 분석(1) Analysis of homology of antimicrobial peptides according to the present invention

상기 실시예 1에 따른 인간 베타 디펜신 유사 항균 펩타이드를 지금까지 인간 피부세포에서 보고된 인간 베타 디펜신-1, 베타 디펜신-2, 베타 디펜신-3, 베타 디펜신-4와 비교 분석을 수행하였다. Comparative analysis of human beta defensin-like antimicrobial peptides according to Example 1 with human beta defensin-1, beta defensin-2, beta defensin-3, and beta defensin-4 reported in human skin cells so far Was performed.

유전자 및 단백질 서열 분석 프로그램 GENEDOC의 통계분석법을 사용하여 분석한 결과, 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 아미노산 구성은 베타 디펜신-1과 22% 동일 아미노산 구성, 베타 디펜신-2와 26% 동일 아미노산 구성, 베타 디펜신-3와 68% 동일 아미노산 구성 그리고 베타 디펜신-4와 18% 동일 아미노산 구성을 보여, 비교된 모든 인간 베타 디펜신들과 18%에서 68%까지 비교적 다양한 정도의 아미노산 상동성을 보였다. Analysis of the gene and protein sequencing program GENEDOC using the statistical analysis shows that the amino acid composition of the human beta defensin-like peptide according to the present invention is 22% identical amino acid composition to beta defensin-1, beta defensin-2 and 26 % Identical amino acid composition, 68% identical amino acid composition to beta defensin-3 and 18% identical amino acid composition to beta defensin-4, relatively varying degrees of amino acid from 18% to 68% with all human beta defensins compared Homology was shown.

그러나, 이러한 넓은 상동성에도 불구하고, 인간 베타 디펜신이 항균활성을 나타내는데 필수적이라고 알려진 6개의 시스테인의 존재와 이들간의 이황화 결합 구조는 모든 인간 베타 디펜신들과 정확하게 일치하였다(도 3). 이를 통해, 본 발명에 따른 실시예 1의 인간 베타 디펜신 유사 펩타이드는 지금까지 밝혀지지 않은 새로운 베타 디펜신의 유사체이며, 본 유사체도 다양한 병원성 및 비병원성 미생물과 박테리아들에 항균활성을 갖음을 확인할 수 있었다.However, despite this broad homology, the presence of six cysteines known to be essential for their antibacterial activity and the disulfide bond structure therebetween were exactly identical to all human beta defensins (FIG. 3). Through this, the human beta defensin-like peptide of Example 1 according to the present invention is a novel beta defensin analog which has not been identified so far, and it was confirmed that the analog also has antimicrobial activity against various pathogenic and non-pathogenic microorganisms and bacteria. .

(2) 본 발명에 따른 항균 펩타이드의 등전점 분석(2) Isoelectric Point Analysis of Antimicrobial Peptides According to the Present Invention

본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 물리적 특성을 좀더 이해하기 위하여, GENRUNNER로 등전점과 소수성 정도를 파악하는 Kyte-Doolittle Hydropathy plot을 분석하였다(도 4). 상기 인간 베타 디펜신 유사 펩타이드의 등전점은 분석결과는 10.27로, 기존의 잘 알려진 다른 베타 디펜신들처럼 강한 양전하 단백질로 확인되었다. 또한 인간 베타 디펜신-3의 등전점인 10.14보다도 높았다(도 4, A 및 B). 소수성을 분석한 결과 친수적 부분과 소수적 부분이 반복되는 구조로 잘 알려진 베타 디펜신들의 전형적인 베타 시트와 알파 헬릭스의 복합 구조로 예측되었으며, 베타 디펜신-3와 비교 분석 결과 항균활성에 중요한 시스테인 간 결합 등의 부위는 매우 유사하나 그 외 부위에서는 비교적 큰 차이를 보였다(도 4, C 및 D).In order to further understand the physical properties of the human beta defensin-like peptide according to the present invention, the Kyte-Doolittle Hydropathy plot was analyzed using GENRUNNER to determine the isoelectric point and the degree of hydrophobicity (FIG. 4). The isoelectric point of the human beta defensin-like peptide was 10.27, and it was confirmed to be a positively positive protein as well as other well-known beta defensins. It was also higher than 10.14, the isoelectric point of human beta defensin-3 (FIGS. 4, A and B). As a result of hydrophobicity analysis, a beta sheet and alpha helix typical of beta defensins, which are well known for repeating hydrophilic and hydrophobic parts, were predicted to be a complex structure of beta defensin-3. Sites such as liver binding are very similar but showed a relatively large difference in other sites (Fig. 4, C and D).

실시예 3: 재조합 단백질로써 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 발현과 정제Example 3: Expression and Purification of Human Beta Defensine-Like Peptides According to the Invention as Recombinant Proteins

GST와 융합된 본 발명에 따른 인간 베타 디펜신 유사 펩타이드를 함유하는 발현벡터를 갖는 BL21(DE3)를 100 ㎍/ml 농도의 ampicillin을 함유하는 LB 액체 배지 10ml에 접종한 후 37℃에서 하룻밤 배양하였다(전배양 하였다). 다음날 아침 동일한 농도의 암피실린을 함유하는 LB배지 1L에 배양된 배양액 10 ml을 접종하 여(1/100 접종) 37℃에서 200 rpm으로 흔들면서 배양하였다. 660 nm에서 흡광도가 1.2에 도달하였을 때 최종 농도 1 mM에 해당하는 IPTG를 첨가하여 30도에서 4시간 추가로 배양하였다. 배양이 끝난 후, 6,000 rpm, 4℃에서 20분간 원심분리하여 균체를 회수하였다. 침전된 균체는 얼음으로 냉장한 PBS 50 ml에 현탁하여 얼음에서 10분간 방치하였다. Probe 타입 대장균 균체파쇄용 소니케이터(sonicator)를 이용하여 균체를 파쇄하고 12,000 rpm, 4℃에서 30분간 원심분리하여 비파쇄 균체외 불용성 분획을 제거하여 수용성 재조합 단백질 분획을 얻었다. BL21 (DE3) having an expression vector containing a human beta defensin-like peptide according to the present invention fused with GST was inoculated in 10 ml of LB liquid medium containing 100 μg / ml of ampicillin and incubated overnight at 37 ° C. (Precultured). The next morning, 10 ml of the culture solution was inoculated (1/100 inoculation) in 1 L LB medium containing the same concentration of ampicillin and incubated at 37 ° C. at 200 rpm. When the absorbance reached 1.2 at 660 nm, IPTG corresponding to a final concentration of 1 mM was added and incubated for 4 hours at 30 degrees. After incubation, the cells were recovered by centrifugation at 6,000 rpm for 20 minutes at 4 ° C. The precipitated cells were suspended in 50 ml of ice-cold PBS and left for 10 minutes on ice. Cells were crushed using a probe-type E. coli cell disrupting sonicator and centrifuged at 12,000 rpm and 4 ° C. for 30 minutes to remove non-fractionated extracellular insoluble fraction to obtain a water-soluble recombinant protein fraction.

글루타티온(glutathione)-비드가 충진된 크로마토그래피 컬럼에 로드하여 GST와 융합된 형태의 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 융합단백질을 결합시키고, 0.05% triton X-100이 첨가된 PBS 200ml로 세척하여 불순물을 제거하였다. 10 mM 농도의 환원된 GST 용액을 컬럼에 가하여 GST와 융합된 본 발명에 따른 인간 베타 디펜신 유사체 단백질을 비드에서 분리시키고 융합단백질을 획득하였다. 획득된 융합단백질 수용액은 1,000 Da의 cutting-value를 갖는 멤브레인을 사용하여 ultrifiltration system으로 최종 부피 ~ 10ml로 농축하였다. 농축된 융합단백질 용액에 트롬빈을 처리하여 GST로부터 새로운 인간 베타 디펜신 유사 펩타이드를 분리하고, 이를 세파덱스(Sephadex) G-25가 충진된 크로마토그래피에 로드하여 사이즈 추출(size extraction) 방법을 통해 본 발명에 따른 새로운 인간 베타 디펜신 유사 펩타이드를 순수 분리하였다. A glutathione-bead loaded chromatography column was loaded to bind the fusion protein of the human beta defensin-like peptide of the present invention in a fused form with GST, and 200 ml of PBS to which 0.05% triton X-100 was added. Washing removes impurities. A reduced GST solution at a concentration of 10 mM was added to the column to separate the human beta defensin analogue protein according to the invention fused with GST in beads and to obtain a fusion protein. The obtained aqueous solution of fusion protein was concentrated to a final volume of ~ 10ml by ultrifiltration system using a membrane having a cutting value of 1,000 Da. Treatment of thrombin in a concentrated fusion protein solution to isolate a new human beta defensin-like peptide from GST, loading it onto a chromatography packed with Sephadex G-25, was performed by size extraction method. New human beta defensin-like peptides according to the invention were isolated purely.

획득된 본 발명에 따른 인간 베타 디펜신 유사 펩타이드는 1,000 Da의 cutting-value를 갖는 멤브레인을 사용하여 ultrifiltration system으로 최종 부피 가 ~ 1ml 되도로 농축하였다. 안정적인 보관을 위해 동결건조하여 -20℃에 보관하였다.Obtained human beta defensin-like peptide according to the present invention was concentrated to a final volume ~ ~ 1ml by the ultrifiltration system using a membrane having a cutting-value of 1,000 Da. Freeze-dried and stored at -20 ℃ for stable storage.

실험예 1: 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 항균활성 시험Experimental Example 1: Antibacterial activity test of human beta defensin-like peptide according to the present invention

상기 실시예 3에서 정제된 새로운 인간 베타 디펜신 유사 펩타이드의 항균활성은 페이퍼 디스크 확산법을 통해 수행되었다. The antimicrobial activity of the new human beta defensin-like peptide purified in Example 3 was performed through a paper disk diffusion method.

대수증식기까지 증식시킨 1×10⁹cells/ml 농도의 엔테로코쿠스 페슘(Enterococcus faecium), 대장균( Escherichia coli), 스트렙토코쿠스 아가라테아(Streptococcus agalateae), 스타필로코쿠스 아우레우스(Staphylococcus aureus), 그리고 스프로테우스 미라빌리스(Proteus mirabilis)들의 배양액 0.1 ml씩을 적절한 배양용 아가배지에 분주 및 도말하였다. 약 12시간동안 30℃에서 건조 후, PBS, 100 ㎍/ml 농도의 소혈청알부민(bovine serum albumin, BSA) 용액, 1% 농도의 1,3-Butylene Glycol(1,3-BG) 용액, 10 ㎍/ml농도의 정제된 실시예 3의 본 발명에 따른 인간 베타 디펜신 유사 펩타이드 용액을 각각 0.05ml 함유하는 페이퍼 디스크를 위치시켰다. 적정 배양온도에서 48시간 배양 후 처리된 페이퍼 디스크 주변의 살균영역의 크기를 이용해 항균활성을 평가하였다.Number was 1 × 10 ⁹ cells / ml concentration of Enterococcus nose kusu pesyum proliferation to growth phase (Enterococcus faecium), E. coli (Escherichia coli), streptococcus Niagara Te (Streptococcus agalateae), Staphylococcus aureus (Staphylococcus aureus), and Proteus's Mira Billy's was dispensed and spread on agar medium appropriate for the culture ssikeul 0.1 ml of culture medium (Proteus mirabilis). After drying at 30 ° C. for about 12 hours, PBS, bovine serum albumin (BSA) solution at 100 μg / ml concentration, 1,3-Butylene Glycol (1,3-BG) solution at 1% concentration, 10 A paper disk containing 0.05 ml each of the human beta defensin-like peptide solution according to the invention of purified Example 3 at a μg / ml concentration was placed. The antimicrobial activity was evaluated using the size of the sterilization zone around the treated paper disk after 48 hours of incubation at the appropriate culture temperature.

하기 표 2 및 도 7에 나타난 바와 같이, 단백질 대조군으로 사용된 BSA와 가장 보편적으로 사용하는 화장품류의 보존제인 1.3-butylene glycol이 시험된 5개 균종 모두에서 아무런 효과를 보이지 않는 반면, 정제된 본 발명에 따른 인간 베타 디펜신 유사 펩타이드는 높은 항균활성을 보였다. 또한, 아토피 피부염에서 급격한 천이로 인해 아토피를 고착화 만성화하는 것으로 알려진 스타필로코쿠스 아우레우스(Staphylococcus aureus)에서도 높은 항균 활성을 보임으로써 본 발명에 따른 인간 베타 디펜신 유사 펩타이드가 기존의 베타 디펜신 계열의 항균펩타이드로써 향후 다양한 아토피 피부염 등의 피부질환 개선 및 치료 소재로 사용될 수 있음을 확인하였다(도 7, 표 2).As shown in Table 2 and FIG. 7, while the BSA used as a protein control and 1.3-butylene glycol, a preservative of the most commonly used cosmetics, showed no effect in all five species tested, Human beta defensin-like peptide according to the invention showed a high antimicrobial activity. In addition, human beta defensin-like peptide according to the present invention exhibits high antibacterial activity in Staphylococcus aureus , which is known to chronically fix atopy due to rapid transition in atopic dermatitis. As a series of antimicrobial peptides it was confirmed that it can be used as a material for improving and treating various skin diseases such as atopic dermatitis in the future (Fig. 7, Table 2).

[표 2]TABLE 2

실험예Experimental Example 2: 본 발명에 따른 인간 베타 2: human beta according to the invention 디펜신Defensin 유사 Similarity 펩타이드를Peptides 함유하는 화장료 조성물의 아토피 피부염 개선 활성 Atopic Dermatitis Improvement Activity of Containing Cosmetic Compositions

본 발명에 따른 인간 베타 디펜신 유사 펩타이드가 외용 형태로 피부에 적용 시 아토피 피부염의 개선효과가 있는지 시험하였다. The human beta defensin-like peptide according to the present invention was tested for improvement of atopic dermatitis when applied to the skin in external form.

실시예 3의 정제된 본 발명에 따른 인간 베타 디펜신 유사 펩타이드가 0.01%(100 ㎍/ 1 g)가 함유된 기본 로션형 조성물(조성물 성분구성(단위; 중량%): 글리세린 3.0, 부틸렌글리콜 2.0, 프로필렌글리콜 2.0, 폴리옥시에틸렌 경화피마자유 1.0, 에탄올 10.0, 트리에탄올아민 0.1, 방부제 미량, 향료 미량, 색소 미량, 정제수 잔부)을 6명의 아토피 피부염이 있는 지원자의 환부에 하루 2회씩 2주간 도포하여 그 효과를 측정하였다. Basic lotion type composition (composition composition (unit; wt%)) containing 0.01% (100 µg / g) of human beta defensin-like peptide according to Example 3 of the purified invention of the present invention: glycerin 3.0, butylene glycol 2.0, propylene glycol 2.0, polyoxyethylene hydrogenated castor oil 1.0, ethanol 10.0, triethanolamine 0.1, preservative trace amount, fragrance trace amount, trace amount of pigment, balance of purified water) twice a day twice a week to the affected areas of six atopic dermatitis The effect was measured.

그 개선효과를 비교하기 위해 4명의 아토피 피부염 환자에게는 재조합 단백질 대조군으로 동일한 농도의 소혈청알부민(BSA)가 함유된 조성물을 사용하였다.To compare the improvement effect, four atopic dermatitis patients used a composition containing the same concentration of bovine serum albumin (BSA) as a recombinant protein control.

구체적으로, 시험에서, 개선 효과를 지원자가 느끼는 완화정도를 기준으로 5단계로 구분하였다(0단계 = 아무런 효과 없음, 1단계 = 호전되는 것처럼 느껴지나 특별한 육안변화 없음, 2단계 = 간지러움과 짖무름 등이 개선되나 그 효과가 크지는 않음, 3단계 = 간지러움과 짖무름 등 증상의 개선이 두드러짐, 4단계 = 간지러움과 짖무름 등 증상의 개선이 두드러지며 환부가 감소되고 치유 효과가 있음). Specifically, in the test, the improvement effect was divided into five levels based on the degree of relaxation felt by the applicant (step 0 = no effect, step 1 = feels better but no special visual change, step 2 = tickling and barking) Improves back, but does not have much effect, Stage 3 = improvement of symptoms such as tickling and barking, Stage 4 = improvement of symptoms such as tickling and barking, reduced lesions and healing effect).

[표 3][Table 3]

상기 표 3에 나타난 바와 같이, 본 발명에 따른 인간 베타 디펜신 유사 펩타이드를 함유하는 조성물의 아토피 피부염에 대한 호전 효과가 대조군의 호전 정도(6.25%)에 비해 54.2%로 유의적인 개선효과가 있는 것으로 나타났다.As shown in Table 3, the improvement effect on atopic dermatitis of the composition containing the human beta defensin-like peptide according to the present invention is a significant improvement effect of 54.2% compared to the degree of improvement of the control group (6.25%) appear.

도 1은 본 발명에 따른 인간 베타 디펜신 유사 펩타이드((Novel Human Beta-Defensin Homolog)를 함유하는 PCR 증폭결과를 나타낸 것이다:Figure 1 shows the PCR amplification results containing a human beta defensin-like peptide (Novel Human Beta-Defensin Homolog) according to the present invention:

Lane M: PCR 산물의 크기 비교를 위한 표준 유전자(100 bp DNA ladder), Lane 1: 인간 베타 디펜신-1의 RT-PCR 유전자 산물, Lane 2: 인간 베타 디펜신-2의 RT-PCR 유전자 산물, Lane 3: 본 발명에 따른 새로운 인간 베타 디펜신 유사 펩타이드의 유전자, Lane 4: 인간 베타 디펜신-4의 RT-PCR 유전자 산물, Lane 5: 인간 베타 디펜신-5의 RT-PCR 유전자 산물, 및 Lane 6: 인간 인터루킨-8의 RT-PCR 유전자 산물.Lane M: Standard gene (100 bp DNA ladder) for size comparison of PCR products, Lane 1: RT-PCR gene product of human beta defensin-1, Lane 2: RT-PCR gene product of human beta defensin-2 Lane 3: Gene of the new human beta defensin-like peptide according to the present invention, Lane 4: RT-PCR gene product of human beta defensin-4, Lane 5: RT-PCR gene product of human beta defensin-5, And Lane 6: RT-PCR gene product of human interleukin-8.

도 2는 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 유전자를 함유하는 RT-PCR 산물의 TOPO 클로닝, 유전자 서열 분석(sequencing), 및 폴리펩타이드 서열 번역 분석결과를 나타낸 것이다:Figure 2 shows the results of TOPO cloning, gene sequencing, and polypeptide sequence translation analysis of RT-PCR products containing genes of human beta defensin like peptides according to the present invention:

A: 분석결과 확인된 1213 bp의 유전자 서열과 77개의 아미노산으로 구성된 본 발명에 따른 인간 베타 디펜신 유사체의 cDNA 부분(밑줄), 및 B: 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 77개 아미노산 서열.A: cDNA portion (underlined) of the human beta defensin analogue according to the invention consisting of 1213 bp gene sequence and 77 amino acids identified in the analysis, and B: 77 amino acids of the human beta defensin-like peptide according to the invention order.

도 3은 본 발명에 따른 인간 베타 디펜신 유사 펩타이드와 인간 베타 디펜신-1, -2, -3, 그리고 -4 간의 상동성 분석과 3개의 시스테인간 결합 구조를 나타낸 것이다: Figure 3 shows the homology between human beta defensin-like peptide and human beta defensin-1, -2, -3, and -4 and three cysteine binding structures according to the present invention:

A: 아미노산 서열의 상동성 분석 결과 본 발명에 따른 인간 베타 디펜신 유사 펩타이드는 인간 베타 디펜신들과 폭넓은 상동성을 보이며, 항균활성에 필수적 인 3개의 시스테인 간 결합은 완벽하게 일치함, 및 B: 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 3개 시스테인 간 결합 구조.A: The homology analysis of the amino acid sequence shows that the human beta defensin-like peptide according to the present invention has a wide homology with human beta defensins, and the binding between the three cysteines essential for antimicrobial activity is perfectly consistent, and B : Three cysteine liver binding structure of human beta defensin-like peptide according to the present invention.

도 4는 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 등전점과 소수성을 분석한 결과이다:Figure 4 shows the results of analyzing the isoelectric point and hydrophobicity of the human beta defensin-like peptide according to the present invention:

A: 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 등전점, B: 인간 베타 디펜신-3의 등전점, C: 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 소수성, 및 D: 인간 베타 디펜신-3의 소수성.A: isoelectric point of human beta defensin-like peptide according to the present invention, B: isoelectric point of human beta defensin-3, C: hydrophobicity of human beta defensin-like peptide according to the present invention, and D: human beta defensin-3 Hydrophobicity.

도 5는 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 재조합 단백질 생산을 위한 TA 클로닝 벡터와 GST 융합단백질 발현 벡터로의 클로닝 개략도이다.5 is a schematic diagram of cloning a TA cloning vector and a GST fusion protein expression vector for recombinant protein production of a human beta defensin-like peptide according to the present invention.

도 6은 재조합 단백질로 발현, 정제된 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 SDS-PAGE 결과를 나타낸 것이다: Lane 1: 정제된 본 발명에 따른 인간 베타 디펜신 유사 펩타이드(화살표).Figure 6 shows the SDS-PAGE results of the human beta defensin-like peptide according to the present invention expressed and purified by recombinant protein: Lane 1: Purified human beta defensin-like peptide (arrow) according to the present invention.

도 7은 재조합 단백질로 발현, 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 항균 활성을 나타낸 것이다:Figure 7 shows the antimicrobial activity of the human beta defensin-like peptide according to the invention, expressed as a recombinant protein:

A: 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 Enterococcus faecium에 대한 항균활성, B: 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 Escherichia coli에 대한 항균활성, C: 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 Streptococcus agalateae에 대한 항균활성, D: 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 Staphylococcus aureus에 대한 항균활성, 및 E: 본 발명에 따른 인간 베타 디펜신 유사 펩타이드의 Proteus mirabilis에 대한 항균활성. A: Enterococcus of human beta defensin-like peptide according to the present invention antimicrobial activity against faecium , B: antimicrobial activity of Escherichia coli of human beta defensin-like peptide according to the present invention, C: Streptococcus of human beta defensin-like peptide according to the present invention Antibacterial activity against agalateae , D: Staphylococcus of human beta defensin-like peptide according to the present invention antimicrobial activity against aureus , and E: Proteus of human beta defensin like peptide according to the present invention Antimicrobial activity against mirabilis .

Claims

An antimicrobial peptide set forth in amino acid sequence of SEQ ID NO: 1.

Gene encoding the peptide of claim 1.

The gene according to claim 2, wherein the peptide has a nucleotide sequence of SEQ ID NO: 2.

Recombinant vector comprising the gene of claim 2.

The gene of claim 2, wherein the gene is derived from human keratinocytes.

Cosmetic composition comprising the peptide of claim 1.

The cosmetic composition of claim 6, wherein the cosmetic composition is for improving atopic skin.

A pharmaceutical composition for treating atopic dermatitis comprising the peptide of claim 1.