KR100987004B1 - Recombinant mammalian cell for screening a substance preventing and treating AIDS and screening method using the same - Google Patents

Abstract

The present invention relates to recombinant mammalian cells for screening AIDS prophylactic and therapeutic substances and a screening method using the same. More specifically, the HIV NC protein expression cassette and HIV Psi (Ψ) sequence expressing HIV NC protein And a recombinant mammalian cell transformed with a reporter gene expression cassette expressing a reporter gene and a screening method using the same. Recombinant mammalian cells and screening methods of the present invention have the effect of providing a system that can search for substances that inhibit the interaction of HIV NC protein and HIV Psi sequence using eukaryotic cells. Thus, the present invention not only provides a new means to search for new substances that inhibit the interaction of HIV NC proteins and HIV Psi sequences involved in the packaging of HIV, but also to search for substances having AIDS prophylactic and therapeutic effects. This has the effect of providing a new screening method.

HIV NC protein, HIV Psi sequence, AIDS, screening

Description

Recombinant mammalian cell for screening a substance preventing and treating AIDS and screening method using the same}

The present invention relates to recombinant mammalian cells for screening AIDS prophylactic and therapeutic substances and a screening method using the same. More specifically, the HIV NC protein expression cassette and HIV Psi (Ψ) sequence expressing HIV NC protein And a recombinant mammalian cell transformed with a reporter gene expression cassette expressing a reporter gene and a screening method using the same.

Acquired immune deficiency syndrome (AIDS) is one of the world's most important diseases since it was first discovered in the early 1980s. The therapeutic agents for AIDS developed to date are mainly protease inhibitors and reverse transcriptase inhibitors, which are reverse transcriptase inhibitors such as AZT, ddI, ddC, d4T, 3TC, and nevirapine, or sakinavir, indinavir And protease inhibitors such as ritonavir. These treatments are not effective when used alone, but the combination of two reverse transcriptase inhibitors, such as AZT and 3TC and one protease inhibitor, is known to show a high level of therapeutic effect.

However, not all patients who receive multiple prescriptions improve their condition, the price is high, there are serious side effects such as vomiting and high fever, and there are problems such as the appearance of a variant virus having resistance to these drugs.

Therefore, there is a need for the development of a new line of therapeutic agents with much stronger and less toxic drugs for better treatment.

AIDS is caused by the infection of human immunodeficiency virus (HIV). After HIV infection, people suffer from cold soreness for 1 to 2 weeks after 3-6 weeks, and then have a symptom-free incubation period of 10 years. do. During the long incubation period, the virus continues to multiply, destroying the immune cells of the infected person, so that the patient's immune function is gradually impaired and symptoms of AIDS develop at the end of the incubation period.

The gene for HIV1 has nine ORFs, three of which are Gag, Pol, and Env, and the other six are responsible for regulatory functions. In particular, Gag and Env are structural components, Gag expresses four proteins of MA (matrix), CA (capsid), NC (nucleocapsid) and p6, and Env is SU (surface or gp120) and TM two proteins of transmembrane or gp41 are expressed. Pol also expresses three proteins, PR (protease), reverse transcriptase (RT), and IN (integrase), which show enzymatic activity.

Nucleocapsid (NC) among HIV proteins is a basic protein composed of 55 amino acids and has a molecular weight of about 6 kDa, and includes two zinc finger domains, as well as a structural role for viral individualization. It also plays a functionally important role in the viral life cycle. Looking at the major functions of HIV NC protein, first, NC protein is involved in the genetic encapsidation of the virus. This function is derived from two zincfinger domains consisting of the unique Cys-X2-Cys-X4-His-X4-Cys motif (CCHC motif), which exhibits high conservedness in all retroviruses, and HIV It is known to be essential for RNA packaging and infectious virus production. Second, NC proteins are known to promote tRNA primer annealing and strand transfer during virus reverse transcription (RT), suggesting that NC proteins play an important role in viral replication. It can be seen that. Third, NC protein has a nucleic acid chaperone activity required for the viral life cycle, and recently, NC protein has been reported to play a role even when viral DNA is inserted into a host cell chromosome.

Thus, studies have been undertaken to inhibit the function of these NC proteins to neutralize HIV-1 (Lener, D. et al., FEBS Letters., 361: 85-88, 1995; Dexter, TK et al. , J. Virol., 70: 6607-6616, 1996; Tanchou, V. et al., J. Virol., 72: 4442-4447, 1998; Rong, L. et al., J. Virol., 72: 9353-9358, 1998; Berthoux, L. et al., J. Virol., 71: 6973-6981, 1997; Berthoux, L. et al., J. Virol., 73: 10000-10009, 1999; Clever, JL et al., J. Virol., 74: 541-546, 2000; Cimarelli, A. et al., J. Virol., 74: 3046-3057, 2000). For example, Korean Patent Application No. 01-52594 discloses an RNA capable of binding to an NC protein, but RNA has a disadvantage in that it is difficult to work, and thus practically cannot be used for the treatment of HIV-1.

The genetic envelope of HIV virus by NC protein involves the interaction between NC protein and HIV Psi sequence. The HIV Psi sequence is a sequence consisting of 125 bases located at the 5 'end of the HIV genomic RNA. The HIV Psi sequence specifically binds to the NC protein to perform genome package of HIV.

Accordingly, the present inventors have found that the inhibitory activity of the translation process occurs in mammalian cells through the interaction of HIV NC protein and HIV Psi sequence while studying the physiological activity of HIV NC protein, and the recombinant mammalian cell using the same. The present invention has been completed by developing a method for screening a prophylactic and therapeutic material for AIDS using cells.

Accordingly, it is an object of the present invention to provide recombinant mammalian cells for screening AIDS prophylactic and therapeutic substances and screening methods using the same.

In order to achieve the above object, the present invention provides a recombinant mammalian cell transformed with a polynucleotide expressing an HIV NC protein and a polynucleotide expressing an HIV Psi (Ψ) sequence and a reporter gene.

In order to achieve another object of the present invention, the present invention provides a method for screening AIDS prophylactic and therapeutic substances using the cells to search for substances affecting the interaction of HIV NC protein and HIV Psi (Ψ) sequence. .

Hereinafter, the present invention will be described in detail.

Cells of the invention are HIV NC expression cassettes and promoters having a polynucleotide encoding a polypeptide comprising a promoter and an HIV NC (nucleocapsid) protein operably linked thereto, and an HIV Psi (Ψ) sequence and reporter gene operably linked thereto. It is a recombinant mammalian cell transformed with a reporter gene expression cassette.

The inventors have found that the interaction of HIV NC proteins with HIV Psi sequences in mammalian cells inhibits the transcription of genes underlying the HIV Psi sequence, which was first discovered by the present inventors. The present inventors prepared expression vectors having a reporter gene capable of confirming gene expression in the lower part of the HIV Psi sequence in mammalian cells in Examples 1 and 2 and an expression vector capable of expressing HIV NC protein, respectively. In Example 3, the same mammalian cells were transformed to confirm the expression of the reporter gene due to the interaction of the HIV NC protein and the HIV Psi sequence.

As a result, it was confirmed that the expression of the reporter gene in the lower part of the HIV Psi sequence was reduced due to the interaction of the HIV Psi sequence and the HIV NC protein, and the vector using the HIV Psi sequence does not exist to compare the results. In the case it was confirmed that the expression of the reporter gene is well. The result is that the interaction of the HIV NC protein with the HIV Psi sequence is inhibited by the translation of the genes underlying the HIV Psi sequence.

It has been known by the present inventors that the expression of the reporter gene present in the lower part of the HIV Psi sequence decreases due to the interaction of the HIV Psi sequence and the HIV NC protein in E. coli, which is a prokaryote (Korean Patent No. 360,275). However, the present invention first confirmed this phenomenon in human T-Rex293 cells (a kind of 293 cells), which is a eukaryotes, which is obvious to those skilled in the art in view of the fact that translation processes of prokaryotes and eukaryotes are different from each other. It is not one.

The prokaryotic and eukaryotic translations differ in their mechanisms and the factors involved. In the prokaryotic translation process, IF (initialtion factor) 1, IF2-GTP, and IF3 bind to the ribosomal 30S subunit, which combines mRNA induced by IF3 and fMet-tRNA induced by IF2. In the eukaryotic translation process, eIF3 and eIF1A bind to the ribosome 40S subunit, and then eIF2-GTP-Met-tRNAi after the 30S initiation complex is formed and the ribosomal 50S subunit is combined to form the 70S initiation complex. The complexes combine to form the 43S complex, and with the help of eIF4, the mRNA binds to form the 48S complex. The 48S complex consumes ATP and scans the mRNA to search for the initiation codon site. The translation process occurs by binding to the 48S complex and forming an initiation complex with the help of eIF5. As described above, the translation process in prokaryotes and the translation process in eukaryotes differ in the process of searching for the start codon, including the process of forming the related factors and the start complex. Thus, the mechanism of translation inhibition applied in prokaryotes does not apply equally to eukaryotes.

Furthermore, in the present invention, the interaction between the HIV NC protein and the HIV Psi sequence inhibits the scanning process of the 48S complex, which is a mechanism that does not exist in the prokaryotic translation process. Activity is not apparent to those skilled in the art.

The "NC protein of HIV" refers to a nucleocapsid protein of human immunodeficiency virus (HIV), a pathogen causing AIDS (Acquired Immune Deficiency Syndrome), and the protein strongly binds to viral genomic RNA To form a ribonucleoprotein core complex.

Preferably the HIV NC protein may have an amino acid sequence represented by SEQ ID NO: 1, Genbank Accession No. P03349, P03366, P04585, P03367, P12497, P03369, P04587, P04584, P35963, P24740, P05961, P04591, Q73368, P20892, P20875, P12498, P05888, P12493, Q9QBZ5, Q9QBY, Q89, Q54, 750 Q9QBZ1, O89290, Q9QBZ6, Q9QBY4, P12499, P05959, P18802, P04588, P04589, P05960, Q70622, P20889, P12494, P03347, Q9QSR3, Q9Q720, Q9IDV9, Q9WC62, Q9WC800, Q9, Q157, Q12, P04592, P20873, P05887, P03348, P04593, Q89928, Q79666, Q77373, O41798, O93215, O91080, P05962, Q9QBZ2, Q9QC00, O89291, P05891, P15833, P17757, P18096, Q9QSR4, Q9IDV O89,05001 P04594, P12495, Q76634, P20876, P18042, P0C1K7, Q79665, Q77372, O93182, O91079, P05889, P12451, P24107, Q76633, P12450, P18041, P15832, P24106, P17756, Q69383, Q74120, Q74119, P20033636 NC proteins described in Q0R5R2, Q1A268, Q1A250, Q1A267, P03353, Q0R5R3, Q1A249 (eg, the 380-434 amino acid sequence for P03349).

In addition, in addition to the HIV NC protein itself of the present invention, the polypeptide containing the HIV NC protein also exhibited transcriptional inhibitory activity due to the HIV NC and HIV Psi sequence interactions of the present invention (see Example 3). The screening method of can also be preferably performed with a polypeptide comprising an HIV NC protein. The polypeptide may be HIV GAG or HIV GAG + POL, but is not limited to such.

The HIV Psi (Ψ) sequence is a sequence consisting of 125 bases located at the 5 'end of HIV genomic RNA, which specifically binds to the HIV NC protein and participates in the genome package of HIV. Preferably the HIV Psi sequence may have a nucleotide sequence represented by SEQ ID NO: 2.

The reporter gene may use a conventional reporter gene that can detect its expression. Examples of the reporter gene include, but are not limited to, enhanced green fluorescent protein (EGFP), green fluorescent protein (GFP), and luciferase ( luciferase), gaussia luciferase (gaussia luciferase), β-galactosidase, and alkaline phosphatase. However, since the expression level of the gene can be measured by a known immunochemical analysis method or the like when the appropriate antibody is retained, the reporter gene can be used without limitation.

The “expression cassette” refers to a nucleic acid structure capable of expressing a structural gene of interest, and may include an appropriate promoter and structural genes operably linked thereto according to a cell. The expression cassette may comprise one or more coding nucleotides and may comprise other elements (e.g., polyadenylation sequences, membrane-insertion signals or sequences encoding secretion lines, ribosomal invasion sequences, transcriptional regulatory elements (e.g. enhancers, silencers, Etc. In addition, the expression cassette preferably constitutes a vector together with an origin of replication, a selection marker and an expression control element such as an operator, an initiation codon, a termination codon, a polyadenylation signal, an enhancer, and the like, In the present invention, the HIV NC protein expression cassette and the reporter gene expression cassette may preferably form separate expression vectors, but as separate expression cassettes incorporated into one expression vector. May exist

Preferably, the HIV NC protein expression cassette may be pLP1, pLP1 / GAG (ΔPOL) or pLP1 / optiNC, and the reporter gene expression cassette is preferably pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra). , pcDNA4TO-R-U5-Psi (Ψ)-(-ATG) EGFP (-extra), pcDNA4TO-Psi (Ψ)-(-ATG) -Fluc (-extra) or pcDNA4TO-Psi (Ψ)-(-ATG ) -Gaussia (-extra). In this case, pLP1 / GAG (ΔPOL) or pLP1 / optiNC is a vector prepared based on a commercial vector, pLP1 vector (invitrogen, USA), and pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (- extra), pcDNA4TO-R-U5-Psi (Ψ)-(-ATG) EGFP (-extra), pcDNA4TO-Psi (Ψ)-(-ATG) -Fluc (-extra) or pcDNA4TO-Psi (Ψ)-( -ATG) -Gaussia (-extra) is a vector prepared on the basis of a commercial vector pcDNA4TO vector (invitrogen, USA), each preparation method is shown in detail in Examples 1 and 2.

The term 'promoter' refers to a DNA sequence that regulates the expression of a nucleic acid sequence operably linked in a particular host cell. 'Operably linked' means that one nucleic acid fragment is combined with another nucleic acid fragment. Its function or expression is affected by other nucleic acid fragments. In addition, it may further comprise any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. The promoter may be a promoter (constitutive promoter) to induce the expression of the gene of interest at all times at all times or a promoter (inducible promoter) to induce the expression of the gene of interest at a specific position, time, for example, SV40 promoter , CMV promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108: 193-199, 1991; Monahan et al., Gene Therapy , 7: 24-30, 2000 ) , CaMV 35S promoter (Odell et al ., Nature 313: 810-812, 1985), Rsyn7 promoter (US patent application Ser. No. 08 / 991,601), rice actin promoter (McElroy et. al ., Plant Cell 2: 163-171, 1990), ubiquitin promoter (Christensen et al ., Plant Mol . Biol . 12: 619-632, 1989) and ALS promoters (US Patent Application No. 08 / 409,297). In addition, U.S. Patents 5,608,149; The promoters disclosed in 5,608,144 5,604,121 5,569,597 5,466,785, 5,399,680 5,268,463, 5,608,142, and the like can all be used.

Meanwhile, standard recombinant DNA and molecular cloning techniques used in the present invention are well known in the art and described in the following literature (Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual) , 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989); by Silhavy, TJ, Bennan, ML and Enquist, LW, Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1984) and by Ausubel, FM et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987)).

Meanwhile, the present invention provides a method for screening a prophylactic and therapeutic substance for AIDS using the transformed recombinant mammalian cell of the present invention.

The screening method of the present invention is a method for detecting a substance that affects the interaction of HIV NC protein and HIV Psi (Ψ) sequence. Therefore, since the interaction between the HIV NC protein and the HIV Psi sequence is a necessary phenomenon for packaging during HIV propagation, the HIV NC protein may be used by using the recombinant mammalian cell of the present invention to determine whether these interactions are inhibited. It can be used for the screening of substances affecting the interaction between the HIV Psi sequence and the AIDS preventive and therapeutic substances can be screened.

Specifically, the screening method of the present invention

(a) treating and culturing the candidate substance in the transformed recombinant mammalian cell of the present invention; And

(b) measuring the expression level of the reporter gene of the cultured cells.

The 'expression level' of the reporter gene refers to the expression amount of the reporter gene, which can be measured directly or indirectly by various methods known to those skilled in the art according to the type of reporter gene. For example, but not limited to, the amount of fluorescence generated when using enhanced green fluorescent protein (EGFP) or green fluorescent protein (GFP) as a reporter gene can be measured, and luciferase as a reporter gene. Or when using β-galactosidase (galactosidase) can be measured according to known luciferase or β-galactosidase activity assay method, co-immunoprecipitation, enzyme immunoassay (enzyme) The expression level of reporter genes can also be measured by -linked immunosorbentassay, radioimmunoassay (RIA), immunohistochemistry, Western blotting and flow cytometry (FACS).

In addition, the screening method that targets the interaction of the HIV NC protein and HIV Psi sequence of the present invention can be applied to high throughput screening (HTS). HTS is a method of testing multiple candidates in parallel and screening simultaneously or nearly simultaneously for the biological activity of the multiple candidates. In certain embodiments, cell lines can be cultured in 96-well microtiter plates or 192-well microtiter plates, treated with a number of candidates therein, and then measured for expression of HIV NC protein by immunochemical methods. In this format, 96 independent tests can be performed simultaneously on a single 8 cm x 12 cm plastic plate containing 96 reaction wells. The wells typically require assay volumes ranging from 50 μl to 500 μl. In addition to plates, a number of instruments, instruments, pipettes, robots, plate washers and plate readers are commercially available to suit 96-well formats for a wide range of homogeneous and heterogeneous assays.

In one embodiment of the present invention, the pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector containing the HIV Psi sequence, pcDNA4TO-R-U5-Psi (Ψ)-(-ATG) EGFP (- extra), pcDNA4TO-Psi (Ψ)-(-ATG) -Fluc (-extra) vector, and pcDNA4TO-Psi (Ψ)-(-ATG) -Gaussia (-extra) vector with no HIV Psi sequence pcDNA4TO-ΔPsi (Ψ) -EGFP (-extra) vector, pcDNA4TO-R-U5-Psi (Ψ) -EGFP (-extra) vector, pcDNA4TO-Psi (Ψ) -Fluc (-extra) vector and pcDNA4TO-Psi ( Ψ) -Gaussia (-extra) was produced.

In another embodiment of the present invention, a pLP1 / GAG (POL) vector and a pLP1 / optiNC vector, each expressing a polypeptide comprising an HIV NC protein, were constructed.

In another embodiment of the present invention, the combination of the above vectors was used to confirm the expression of the reporter gene upon interaction of the HIV NC protein and the HIV Psi sequence. As a result, the reporter gene is not expressed when there is an interaction between the HIV NC protein and the HIV Psi sequence, and when the reporter gene is expressed when there is no interaction, the interaction between the HIV NC protein and the HIV Psi sequence is translated. It was found that there is an inhibitory activity (see Example 3, FIGS. 1 to 3 and 6).

In another embodiment of the present invention using a substance that inhibits the interaction of HIV NC protein and HIV Psi sequence was examined the effect on the translation inhibitory activity possessed by the interaction. As a result, it was confirmed that the reporter gene was re-expressed to decrease translation inhibitory activity, and it was found that whether or not the reporter gene was re-expressed can be used for screening of AIDS inhibitory and preventive substances (see Example 4 and FIG. 4). .

Thus, recombinant mammalian cells and screening methods of the present invention have the effect of providing a system that can search for substances that inhibit the interaction of HIV NC proteins with HIV Psi sequences using eukaryotic cells. Thus, the present invention not only provides a new means to search for new substances that inhibit the interaction of HIV NC proteins and HIV Psi sequences involved in the packaging of HIV, but also to search for substances having AIDS prophylactic and therapeutic effects. This has the effect of providing a new screening method.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1>

Preparation of Reporter Gene Expression Vector

<1-1> pcDNA4TO - Psi (Ψ)-(- ATG ) EGFP (- extra ) Preparation of Vector

pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-) based on the pcDNA4TO vector (Invitroren, USA) and comprising an enhanced green fluorescent protein (EGFP) with a Psi (Ψ) sequence and ATG removed extra) was prepared by the following procedure.

In order to remove sites that interfere with secondary structure formation of the HIV Psi sequence in the pcDNA4TO vector, the sites of cleavage with the restriction enzymes NdeI (483) and HindIII (978) are directed to the forward primers of SEQ ID NO: 3 (483-NdeI: 5'-GTATCATATGCCAAGTACGCCCCCTCTATT). -3 ') and the reverse primer of SEQ ID NO: 4 (859- Hind III: 5'-GCGGATCCAAGCTTTCTCTATCACTGATAGGGAG-3') and amplified by PCR using pcDNA4TO vector (Invitroren, USA) as a template and then amplified product (376bp) Was inserted into the NdeI and HindIII restriction sites (this is called intermediate vector 1). In this case, the insertion into the restriction enzyme site is treated with the restriction enzyme and then linked to each other complementary cohesive end (cohesive end) is used in the same meaning as follows.

Psi (Ψ) sequences are HIV ARV-2 / SF2 (SEQ ID NO: 5; CTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACAGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAATTTTTGACTAGCGGAGGCTAGAAGGAGAGAGAGATGGGTGCGAGAGCGTCGGTATTA) a as a template, the forward primer of SEQ ID NO: 6 (Hind III: 5'-CCAAGCTTACGCAGGACTCGGCTTGCTG -3 ') and reverse primer of SEQ ID NO: 7 ( After amplification by PCR using Bam HI: 5'-CCGGATCCTAATACCGACGCTCTCGCAC-3 '), the amplified PCR products were inserted into HindIII and BamHI restriction sites of the intermediate vector 1 (this is called intermediate vector 2).

The EGFP (Enhanced green fluorescence protein) sequence is based on the pEGFP-C1 vector (BD Science, USA), and has a forward primer of SEQ ID NO: 8 ( Bam HI: 5'-CCGGATCCGTGAGCAAGGGCGAGGA-3 ') and a reverse primer of SEQ ID NO: 9 Xho I: 5'-TACTTCTCGAGCTCTGTACATGTCCGCGG-3 ') and amplified by PCR, and then the amplified PCR product was inserted into the BamHI and XhoI restriction enzyme sites of the intermediate vector 2 (this is called intermediate vector 3) pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector was prepared.

At this time, in order to remove ATG, which is an initiation sequence, in EGFP, a primer for PCR amplification using EGFP as a template is designed to amplify a site where ATG is removed from EGFP.

<1-2> pcDNA4TO -Δ Psi (Ψ)- EGFP (- extra ) Preparation of Vector

In the pcDNA4TO-ΔPsi (Ψ) -EGFP (-extra) vector used as a control, i.e., the pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector, no Psi (Ψ) sequence was inserted. The vector without the initiation sequence removed except for inserting the Psi (Ψ) sequence in the method of preparing the pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector and EGFP instead of the (-ATG) EGFP fragment. The fragment was amplified by using a forward primer of SEQ ID NO: 10 (5'-CCGGATCCATGGTGAGCAAGGGCGAGGA-3 ') and a reverse primer of SEQ ID NO: 9 so that the fragment was amplified by PCR in the same manner as in Example <1-1>. Was manufactured.

<1-3> pcDNA4TO -R- U5 - Psi (Ψ)-(- ATG ) EGFP (- extra ) Preparation of Vector

In order to prepare a vector in which the Psi (Ψ) sequence was replaced with the R-U5-Psi (Ψ) sequence in the pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector of Example <1-1>. It was performed as follows.

R-U5-Psi (Ψ) sequence uses a forward primer of SEQ ID NO: 11 (HindIII: 5'-CCAAGCTTGGGTCTCTCTGGTTAGACCA-3 ') and a reverse primer of SEQ ID NO: 12 (BamHI: 5'-CCGGATCCTAATACCGACGGTCTCGCAC-3'), pNL4 Obtained by amplification by PCR with -3 vector as a template. In this case, the R-U5-Psi (Ψ) sequence is a region corresponding to 454 to 813 bp of the pNL4-3 vector, and the pNL4-3 vector has all except that half of the Nef gene is replaced with the EGFP reporter gene. As a vector containing a gene of HIV-1 and capable of producing a recombinant HIV virus, Lee et al., 1997, Biochem. Biophy. Res. Comm., 233: 288-292, which are described in detail. Vector.

The fragment obtained by PCR and the pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector were treated with HindIII and BamHI, respectively, and the pcDNA4TO was inserted by inserting the R-U5-Psi (Ψ) sequence instead of the Psi (Ψ) sequence. -R-U5-Psi (Ψ)-(-ATG) EGFP (-extra) vector was prepared.

<1-4> pcDNA4TO -R- U5 - Psi (Ψ)- EGFP (- extra ) Preparation of Vector

Forward primer (R-U5-F; 5′-CCAAGCTTGGGTCTCTCTGGTTAGACCA-3) of SEQ ID NO: 13 to insert an R-U5 fragment into the pcDNA4TO-ΔPsi (Ψ) -EGFP (-extra) vector of Example <1-2> ′) And reverse primers of SEQ ID NO: 14 (R-U5-R; 5′-CCGGATCCCGAGAGATCTCCTCTGGCTT-3 ′) to amplify R-U5 fragments, which were treated with HindIII and BamHI and pcDNA4TO-ΔPsi (Ψ) -EGFP The pcDNA4TO-R-U5-Psi (Ψ) -EGFP (-extra) vector was prepared by insertion into the (-extra) vector.

<1-5> pcDNA4TO - Psi (Ψ)-(- ATG ) - Fluc (- extra ) Preparation of Vector

Instead of inserting EGFP in Example <1-1> to prepare pcDNA4TO-Psi (Ψ)-(-ATG) -Fluc (-extra) vector using luciferase instead of EGFP as reporter gene, Luciferase was inserted as follows.

Luciferase is based on pGL3 (Promega, USA) and consists of (ATG) luc-F primer of SEQ ID NO: 15 (5'-CCGGATCCGAAGACGCCAAAAACATAAA-3 ') and luc-R primer of SEQ ID NO: 16 (5'-TACTCGAGTTACACGGCGATCTTTCCGC-3 A) was used to amplify by PCR. The amplified PCR product was inserted at the BamHI and XhoI restriction enzyme sites.

<1-6> pcDNA4TO - Psi (Ψ)- Fluc (- extra ) Preparation of Vector

The method of Example <1-2> to prepare a pcDNA4TO-Psi (Ψ) -Fluc (-extra) vector using luciferase instead of EGFP as a reporter gene in the vector of Example <1-2> According to the luciferase fragment obtained in Example <1-5> was inserted to prepare a pcDNA4TO-Psi (Ψ) -Fluc (-extra) vector.

<1-7> pcDNA4TO - Psi (Ψ)- Gaussia (- extra ) Preparation of Vector

PcDNA4TO-Psi (Ψ)-(-ATG) -Gaussia (-extra) vector using Gaussia luciferase as reporter gene (shown as pcDNA4 / TO / atg.Psi / -Gau (-ex) in the figure) Insert the Psi (Ψ) sequence into the pcDNA4TO-Psi (Ψ) -Fluc (-extra) vector (shown as pcDNA4 / TO / del.psi / F-luc (-Extra) in the drawing), and F A Gaussian luciferase fragment was substituted for the -luc gene to prepare it as follows.

First, pcDNA4TO-Psi (Ψ) -Fluc (-extra) was treated with HindIII and XhoI restriction enzymes to prepare a fragment (Fragment I) from which the F-luc gene was removed.

The Psi (Ψ) sequence is based on the pcDNA4 / TO vector (Invitrogen, USA) and consists of SEQ ID NO: 18 (Psi HindIII-F, 5'-CCAAGCTTACGCAGGACTCGGCTTGCTG-3 ') and SEQ ID NO: 19 (Psi BamHI-R, 5'-CCGGATCCTAATACCGACGGTCTCGCAC PCR was performed using primer pairs of -3 '), which were treated with HindIII and BamHI restriction enzymes and then combined with fragment I (fragment II). The Gaussian luciferase fragment was then templated on the pBasicGau vector (Targeting system Inc.), SEQ ID NO: 20 (Gau BamHI-F, 5'- CCGGATCCGGAGTCAAAGTTCTGTTTGC-3 ') and SEQ ID NO: 21 (Gau XbaI-R, 5' PCR was carried out using primer pairs of the sequence of -AATCTAGATGCATGCTCGAGCGGCCGCT-3 '), which was treated with BamHI and XhoI restriction enzymes and then combined with the fragment II of the present invention, pcDNA4TO-Psi (Ψ)-(-ATG ) -Gaussia (-extra) vector was prepared.

<1-8> pcDNA4TO - Psi (Ψ)- Gaussia (- extra ) Preparation of Vector

A pcDNA4TO-Psi (Ψ) -Gaussia (-extra) vector using Gaussia luciferase as the reporter gene and the Psi (Ψ) sequence was removed (pcDNA4 / TO / del.psi / gaussia in the figure) to remove the luciferase fragment (Fluc) between the BamHI and XbaI restriction enzyme sites of pcDNA4TO-Psi (Ψ) -Fluc (-extra) prepared in Example 1-1 above). A pcDNA4TO-Psi (Ψ) -Gaussia (-extra) vector was prepared by inserting a Gaussian luciferase fragment into the. The inserted Gaussian luciferase fragment was then subjected to PCR as in Example <1-7> and then treated with BamHI and XbaI restriction enzymes.

All the above vectors were prepared and then verified by normal sequencing to verify that they were normally produced (results not shown).

< Example  2>

HIV NC  Preparation of Protein Expression Vectors

<2-1> pLP1 Of GAG ( POL ) Preparation of Vector

The pLP1 vector (Invitrogen, USA) was treated with restriction enzymes BclI (2994) and BspEI (5672) to remove the POL sequence, which was then treated with Klenow enzyme and self-ligation. The vector thus prepared was referred to as pLP1 / GAG (POL).

<2-2> pLP1 Of optiNC  Manufacture of vector

pLP1 / optiNC vector was prepared as follows: SEQ ID NO: 17 codon optimized HIV NC gene (OptiNC DNA) the EcoR a restriction enzyme treatment with EcoR I / Hind III-based then prepared to the restriction enzyme-treated fragment, first the It was cloned into pUC57 vector (Genescript, USA) treated with I / Hind III and named pUC57 / OptiNC. The pUC57 / OptiNC and pcDNA4 / TO (Invitrogen, USA) were cut with Hind III and EcoR I and then ligated to produce pcDNA4 / TO / OpicNC. The pcDNA4 / TO / OptiNC was treated with Hind III and Not I, and then the DNA fragment containing the cleaved HIV NC gene was polymerized with Klenow to make a blunt end. The pCMV (-HA) vector (Clontech Laboratories, Inc., USA) was also treated with EcoR I and Not I, and then polymerized with Klenow on the DNA fragment of the vector to make a blunt end. Two fragments treated with the Klenow fragment were ligated and named pCMV (-HA) / OptiNC. The pLP1 vector (Invitrogen) was treated with Pml I / Avr II / Bsp EI to cut the GAG-POL gene, and OptiNC polynucleotides were obtained by Xma I / EcoR I treatment in pCMV (-HA) / OptiNC vector. Both the pLP1 vector and the OptiNC polynucleotide obtained were polymerized with Klenow to make blunt ends, blunt end ligation and named pLP1 / optiNC vectors.

< Example  3>

HIV NC  Protein and HIV Psi  Confirmation of sequence interaction

<3-1> HIV NC  Protein and HIV Psi  Confirmation of sequence interaction

PcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector prepared in Example <1-1> and pcDNA4TO-ΔPsi (Ψ) -EGFP (-extra) prepared in Example <1-2> Co-transfection of the vector with pLP1, pLP1 / GAG (POL), and pLP1 / optiNC prepared in Example 2 confirmed co-transfection of the HIV NC protein and the HIV Psi sequence to confirm the expression of EGFP.

T-Rex293 cells (Invitrogen, USA) were transformed into DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% (v / v) fetal bovine serum (FBS) and 1% streptomycin / penicillin for transformation. Incubated at 37 ° C, 5% CO ₂ conditions. The cells were cultured until they had a density of about 60% to 70%, and then mixed with a jetPEI preparation (Polyplus, France) using a vector to be transformed, and transformed according to the manufacturer's instructions. At this time, the combination of the vector to be transformed was the restriction enzymes PmlI (1321) and BspEI (5672) in the pcDNA4TO-ΔPsi (Ψ) -EGFP (-extra) vector (1 μg) and the control vectors (control, pLP / con, and pLP1 vectors, respectively). ) To remove the GAG-POL sequence and then to the smooth ends, and then to different amounts (0.5 μg) of pLP1, pLP1 / GAG (POL), and pLP1 / optiNC vectors. , 1 μg, 2 μg) and combination pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector (1 μg) and control vectors (control, pLP / con), pLP1, pLP1 / GAG (POL), pLP1, respectively / optiNC vectors were used in combinations of varying amounts (0.5 μg, 1 μg, 2 μg). Transformed cells were treated with tetracycline at a concentration of 1 μg / ml after 16-18 hours of incubation and incubated overnight.

EGFP in cultured cells was detected using a fluorescence microscope (Axiovert 200M, Zeiss, Germany).

As a result, as shown in Figure 1, in the T-REx293 cells (A) transformed with the pcDNA4TO-ΔPsi (Ψ) -EGFP (-extra) vector containing no Psi sequence, the expression of EGFP is not significantly affected and fluorescence In contrast to this, in T-REx293 cells (B) transformed with a pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector containing a Psi sequence, a portion containing an NC protein or NC protein The GAG + POL, GAG protein and Psi sequences interacted with each other, indicating that the expression of EGFP was inhibited in a concentration-dependent manner.

<3-2> HIV NC  Protein and HIV Psi  Confirmation of sequence interaction

The interaction of the HIV NC protein and the HIV Psi sequence was determined by the pcDNA4TO-R-U5-Psi (Ψ)-(of Example <1-3> above instead of the pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector. -ATG) EGFP (-extra) vector, and instead of pcDNA4TO-ΔPsi (Ψ) -EGFP (-extra) vector, pcDNA4TO-R-U5-Psi (Ψ) -EGFP (- extra) was performed in the same manner as in Example <3-1>, except that the vector and the amount of the HIV NC expression vector were 0.5 μg, 0.75 μg and 1.0 μg, respectively.

As a result, as shown in Figure 2, the expression of EGFP is significantly affected in T-REx293 cells (A) transformed with the pcDNA4TO-R-U5-Psi (Ψ) -EGFP (-extra) vector does not contain a Psi sequence In contrast to T-REx293 cells (B) transformed with a pcDNA4TO-R-U5-Psi (Ψ)-(-ATG) EGFP (-extra) vector containing a Psi sequence, The GAG + POL, which contains the protein or NC protein, and the GAG protein and the Psi sequence interact with each other, indicating that the expression of EGFP is inhibited in a concentration-dependent manner, and the HIV Psi sequence further including R-U5. Also it can be seen that similar to the results in Example <3-2>.

<3-3> Luciferase  Used HIV NC  Protein and HIV Psi  Confirmation of sequence interaction

The interaction of the HIV NC protein and the HIV Psi sequence was determined by the pcDNA4TO-Psi (Ψ)-(-ATG)-of Example 1-5 above instead of the pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector. The Fluc (− extra) vector was used and the pcDNA4TO-Psi (Ψ) -Fluc (-extra) vector of Example 1-1 was used instead of the pcDNA4TO-ΔPsi (Ψ) -EGFP (-extra) vector. It carried out according to the method of Example <3-1>.

At this time, the amount of each vector used for transformation was as follows: 500ng of pcDNA4TO-Psi (Ψ)-(-ATG) -Fluc (-extra) vector; 200ng of pcDNA4TO-Psi (Ψ) -Fluc (-extra) vector; Control vector 2 μg, pLP1 2 μg, pLP1 / GAG (POL) 2 μg, pLP1 / optiNC 2 μg.

Luciferase activity in transformed cells was measured according to the manufacturer's (Promega, USA) instructions as follows: Transformed T-Rex293 cells were washed with PBS (Phosphate buffered saline) and PBS completely removed, then PLB (passive lysis buffer) The medium containing the cells was shaken at room temperature for 15 minutes with a reagent. The supernatant was centrifuged at 12000 rpm for 30 seconds at 4 ° C. and the supernatant was placed in a test tube for a luciferase dual-luciferase assay. 20 μl of the cell supernatant was transferred to a test tube containing luciferase assay reagent II (LAR II) and mixed. Luminescent luciferase activity was measured using a luminometer (TD-20 / 20, Turner designs, USA). Then 100 μl of Stop & Glo agent was added to the test tube to neutralize transfection efficiency and renilla luciferase activity was measured. Luciferase activity was eventually determined by the ratio of Renilla luciferase to luminescent luciferase.

As a result, as shown in Figure 3, when the HIV Psi sequence does not exist, even if the expression of the HIV NC protein or GAG, GAG + POL protein containing the same did not decrease the luciferase ratio much compared to the control, but the HIV Psi sequence is present In this case, the HIV NC protein or GAG, GAG + POL protein containing it and the HIV Psi sequence interacted with the luciferase ratio was significantly reduced compared to the control group. On the other hand, it was found that the interaction of HIV NC protein and HIV Psi sequence can be measured by luciferase activity instead of EGFP.

<3-4> Gausia Luciferase  Utilized HIV NC  Protein and HIV Psi  Confirmation of sequence interaction

The interaction of the HIV NC protein and the HIV Psi sequence was determined by pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector vs. pcDNA4TO-Psi (Ψ)-(-ATG)-of Example 1-1 above. Using a Gaussia (-extra) vector and using the pcDNA4TO-Psi (Ψ) -Gaussia (-extra) vector of Example <1-8> above instead of the pcDNA4TO-ΔPsi (Ψ) -EGFP (-extra) vector, Gaussian luciferase analysis was performed as follows.

In this case, 1 μg of the pcDNA4TO-Psi (Ψ)-(-ATG) -Gaussia (-extra) vector and the pcDNA4TO-Psi (Ψ) -Gaussia (-extra) vector were used, respectively, and the control vectors (pLP / Con) and pLP / OptiNC vectors were used in varying amounts (500 ng, 1 μg, 1.5 μg, 2 μg).

T-Rex293 cells (Invitrogen, USA) were transformed into DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% (v / v) fetal bovine serum (FBS) and 1% streptomycin / penicillin for transformation. Incubated at 37 ° C, 5% CO ₂ conditions. The cells were cultured until they had a density of about 60% to 70%, and then mixed with a jetPEI preparation (Polyplus, France) using a vector to be transformed, and transformed according to the manufacturer's instructions. The transformed cells were treated with tetracycline at 2 μg / ml concentration after 16-18 hours of incubation and cultured overnight, and then luciferase activity was measured in the cultured cells.

As a result, as shown in Fig. 6, when the HIV Psi sequence does not exist (Fig. 6A), even if the HIV NC protein is expressed, the Gaussian luciferase activity does not decrease much compared to the control group, but when the HIV Psi sequence is present (Fig. 6A). 6B), the interaction of HIV NC protein and HIV Psi sequence significantly reduced the Gaussian luciferase activity compared to the control. On the other hand, this experiment also shows that the interaction of HIV NC protein and HIV Psi sequence can be measured by Gaussian luciferase activity.

< Example  4>

HIV NC  Protein and HIV Psi  Screening for Interaction Inhibitors in Sequences

To determine whether the cells transformed simultaneously with the expression vector expressing the HIV NC protein of the present invention and the expression vector comprising the HIV Psi sequence can be used to search for substances that inhibit the interaction of the HIV NC protein and the HIV Psi sequence. In order to treat the zinc chelator of Formula 1, which is an HIV NC protein inhibitor (William G. Rice et al., Science, 270: 1194, 1995), the expression of the reporter gene was confirmed as follows.

<Formula 1>

As in Example 3, 250ng of pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector to T-Rex293 cells and 1 μg of the control vector (control) in Example <3-1> were used. After transformation, the cells were cultured and examined for expression of EGFP by fluorescence microscopy.

In addition, as in Example 3, T-Rex293 cells were transformed with 250ng of pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector and 1μg of pLP1 / optiNC, followed by culturing to express EGFP. I looked under a microscope.

To investigate the effect of the zinc chelator, different amounts of zinc chelator were added to T-Rex293 cells transformed with 250ng of the pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector and 1μg of pLP1 / optiNC. (0.1 μM and 1 μM) were cultured in the same manner as in Example <3-1>. At this time, the addition of the zinc chelator was added together in the tetracycline treatment.

As a result, as shown in Figure 4, EGFP fluorescence was well observed in the control group that did not express the HIV NC protein (A), but when the HIV NC protein is expressed by the interaction between the HIV NC protein and HIV Psi sequence It was found that it is not expressed (B). At this time, when the zinc chelator, an inhibitor of HIV NC protein, was added, it was found that fluorescence due to expression of EGFP was again observed in a concentration-dependent manner (C). Therefore, when using the system of the present invention, it is possible to screen for substances that inhibit the interaction of HIV NC protein and HIV Psi sequence.

As described above, the recombinant mammalian cell and the screening method of the present invention have the effect of providing a system that can search for substances that inhibit the interaction of HIV NC protein and HIV Psi sequence using eukaryotic cells. Thus, the present invention not only provides a new means to search for new substances that inhibit the interaction of HIV NC proteins and HIV Psi sequences involved in the packaging of HIV, but also to search for substances having AIDS prophylactic and therapeutic effects. This has the effect of providing a new screening method.

1 shows the HIV NC protein using the pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra) vector (A) and pcDNA4TO-ΔPsi (Ψ) -EGFP (-extra) vector (B) of the present invention. This is the result showing translation inhibitory effect due to interaction of HIV Psi sequence.

Figure 2 shows the pcDNA4TO-R-U5-Psi (Ψ)-(-ATG) EGFP (-extra) vector (A) and pcDNA4TO-R-U5-Psi (Ψ) -EGFP (-extra) vector (B) of the present invention. ) Shows the effect of translation inhibition due to the interaction of HIV NC protein and HIV Psi sequence.

Figure 3 shows the HIV NC protein using pcDNA4TO-Psi (Ψ)-(-ATG) -Fluc (-extra) vector (A) and pcDNA4TO-Psi (Ψ) -Fluc (-extra) vector (B) of the present invention. This is the result of translation suppression effect due to interaction between HIV and Psi sequence.

Figure 4 shows that the translation is made upon inhibition of the interaction of the HIV NC protein and HIV Psi sequence in the screening system using a transformed cell of the present invention.

5 is a schematic diagram showing the manufacturing process of the pcDNA4TO-Psi (Ψ)-(-ATG) -Gaussia (-extra) vector (A) and the pcDNA4TO-Psi (Ψ) -Gaussia (-extra) vector (B) of the present invention. It is shown as.

FIG. 6 shows HIV NC protein using pcDNA4TO-Psi (Ψ)-(-ATG) -Gaussia (-extra) vector (A) and pcDNA4TO-Psi (Ψ) -Gaussia (-extra) vector (B) of the present invention. This is the result of translation suppression effect due to interaction between HIV and Psi sequence.

<110> AVEXGEN Inc.          YOU, Ji Chang <120> Recombinant mammalian cell for screening a substance preventing          and treating AIDS and screening method using the same <130> NP08-0003 <160> 21 <170> KopatentIn 1.71 <210> 1 <211> 55 <212> PRT <213> Artificial Sequence <220> HIV optiNC <400> 1 Met Gln Arg Gly Asn Phe Arg Asn Gln Arg Lys Thr Val Lys Cys Phe   1 5 10 15 Asn Cys Gly Lys Glu Gly His Ile Ala Lys Asn Cys Arg Ala Pro Arg              20 25 30 Lys Lys Gly Cys Trp Arg Cys Gly Arg Glu Gly His Gln Met Lys Asp          35 40 45 Cys Thr Glu Arg Gln Ala Asn      50 55 <210> 2 <211> 131 <212> DNA <213> Human immunodeficiency virus <400> 2 ctctcgacgc aggactcggc ttgctgaagc gcgcacagca agaggcgagg ggcggcgact 60 ggtgagtacg ccaatttttg actagcggag gctagaagga gagagagatg ggtgcgagag 120 cgtcggtatt a 131 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 3 gtatcatatg ccaagtacgc cccctatt 28 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 gcggatccaa gctttctcta tcactgatag ggag 34 <210> 5 <211> 131 <212> DNA <213> Artificial Sequence <220> <223> HIV ARV-2 / SF2 <400> 5 ctctcgacgc aggactcggc ttgctgaagc gcgcacagca agaggcgagg ggcggcgact 60 ggtgagtacg ccaatttttg actagcggag gctagaagga gagagagatg ggtgcgagag 120 cgtcggtatt a 131 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> forward primer for psi <400> 6 ccaagcttac gcaggactcg gcttgctg 28 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for psi <400> 7 ccggatccta ataccgacgc tctcgcac 28 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer for (-ATG) EGFP <400> 8 ccggatccgt gagcaagggc gagga 25 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for EGFP <400> 9 tacttctcga gctctgtaca tgtccgcgg 29 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> forward primer for EGFP <400> 10 ccggatccat ggtgagcaag ggcgagga 28 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> forward primer for R-5U-psi <400> 11 ccaagcttgg gtctctctgg ttagacca 28 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for R-U5-psi <400> 12 ccggatccta ataccgacgg tctcgcac 28 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> forward primer for R-U5 <400> 13 ccaagcttgg gtctctctgg ttagacca 28 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for R-U5 <400> 14 ccggatcccg agagatctcc tctggctt 28 <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <220> 223 luc-F primer <400> 15 ccggatccga agacgccaaa aacataaa 28 <210> 16 <211> 28 <212> DNA <213> Artificial Sequence <220> 223 luc-R primer <400> 16 tactcgagtt acacggcgat ctttccgc 28 <210> 17 <211> 165 <212> DNA <213> Artificial Sequence <220> HIV optiNC <400> 17 atgcagcggg gaaacttcag gaaccagcga aaaactgtga agtgcttcaa ttgcggaaag 60 gagggccaca tcgctaagaa ctgccgggcc cccagaaaga aaggctgctg gagatgcggc 120 agagagggcc accagatgaa ggactgcact gagcggcagg caaac 165 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Psi HindIII-F <400> 18 ccaagcttac gcaggactcg gcttgctg 28 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Psi BamHI-R <400> 19 ccggatccta ataccgacgg tctcgcac 28 <210> 20 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Gau BamHI-F <400> 20 ccggatccgg agtcaaagtt ctgtttgc 28 <210> 21 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Gau XbaI-R <400> 21 aatctagatg catgctcgag cggccgct 28  

Claims (9)

(a) pLP1 / optiNC having a polynucleotide encoding a polypeptide comprising a promoter and an HIV NC (nucleocapsid) protein operably linked thereto; And (b) a recombinant mammalian cell transformed with a reporter gene expression cassette comprising a promoter and an HIV psi (Ψ) sequence and reporter gene operably linked thereto. The cell of claim 1, wherein the transformed cell is a T-Rex293 cell. The cell of claim 1, wherein the HIV NC protein has an amino acid sequence represented by SEQ ID NO: 1. delete The cell according to claim 1, wherein the HIV psi (Ψ) has a nucleotide sequence represented by SEQ ID NO: 2. The method of claim 1, wherein the reporter gene is an enhanced green fluorescent protein (EGFP), green fluorescent protein (GFP), luciferase, gaussia luciferase (gaussia luciferase, gaussian luciferase), β-galactosidase ( galactosidase), alkaline phosphatase (alkaline phosphatase), characterized in that the cell selected from the group consisting of. The method of claim 1, wherein the reporter gene expression cassette is pcDNA4TO-Psi (Ψ)-(-ATG) EGFP (-extra), pcDNA4TO-R-U5-Psi (Ψ)-(-ATG) EGFP (-extra), cell, characterized in that it is selected from the group consisting of pcDNA4TO-Psi (Ψ)-(-ATG) -Fluc (-extra) and pcDNA4TO-Psi (Ψ)-(-ATG) -Gaussia (-extra). (a) treating the cells of claim 1 with a candidate material and culturing; And (b) measuring the expression level of the reporter gene of the cultured cells, the method of screening a prophylactic and therapeutic material of AIDS. The method of claim 8, wherein the expression level is measured by fluorescence detection, luciferase activity measurement, β-galactosidase activity measurement, alkaline phosphatase activity measurement, co-immunoprecipitation, enzyme immunoassay (enzyme). -Linked immunosorbentassay, radioimmunoassay (RIA), immunohistochemistry, Western blotting (Western Blotting) and flow cytometry (FACS).

Images