KR100965480B1 - Recombinant fusion protein, Biosensor using the same, and Immuno-detecting method for target material with the same - Google Patents

Abstract

The present invention relates to a recombinant fusion protein, a biosensor using the same, and an immunodetection method. The present invention relates to a microorganism transformed with a recombinant vector containing a gene encoding a gold-binding protein and a gene encoding protein A (G). Recombinant fusion protein expressed by, and a method for producing an immunobio sensor characterized in that the immobilized on the gold-solid, and a method for detecting a target substance of the immunobio sensor produced by the above method.

According to the present invention, not only the immobilization of all kinds of antibodies on the chip surface but also the appropriate orientation of the immobilized antibodies (improvement) improve productivity and economics, and increase sensitivity and selectivity when producing an immunobio sensor. You can expect.

Gold-binding protein (GBP), protein A, protein G, fusion protein, immune biosensor

Description

Recombinant fusion protein, Biosensor using the same, and Immuno-detecting method for target material with the same}

The present invention relates to a recombinant fusion protein encoded by the nucleotide sequence of SEQ ID NO: 10 or a recombinant fusion protein encoded by the nucleotide sequence of SEQ ID NO: 11, a biosensor for immunodetection using the same, and an immunodetection method.

Antibody-based immunoassays are one of the most important techniques for analyzing biomaterials due to their high selectivity and affinity for target antigens (Fung et al., Curr. Opin. Biotechnol., 12:65, 2001; Zhu and Snyder , Curr. Opin. Chem. Biol., 5:40, 2001). In this field of immunoassay, the effective immobilization of antibodies to gold-containing solid phases such as gold colloidal particles, nano-gold particles, gold-coated particles, or gold coated substrates is a vital step for biosensors.

In general, antibodies and other proteins do not readily adsorb to gold while retaining their biological activity. It is important to immobilize the antibody on the gold surface because most of the current methods of physically adsorbing the antibody to gold are unstable because they can fall out of solution during the experiment and thus do not obtain continuous experimental results. In addition, the antibody may be adsorbed on the gold surface arbitrarily, so that the activation site to which the antigen binds may not maintain the proper orientation in the direction of the solution in which the antigen is present, and may cause denaturation of the antibody. These results can reduce the usefulness of this method by reducing sensitivity and reproducibility in the application of antibody-gold responses. Thus, methods have been tried to immobilize antibodies on gold chips with more robust covalent bonds. Techniques for protein-protein, DNA-RNA, carbohydrate-protein interactions can be described by chemical methods on affinity tags (Ni-NTA, Streptavidin, GST, etc.) or on the surface of gold chips, such as amines, ligand thiols ( Methods of formulating ligand thiols, aldehydes, or immobilizing target proteins by forming self-assembly monolayers of ligands with functional groups have been studied (Hentz et al., Anal. Chem). , 68: 3939, 1996; Kukar et al., Anal.Biochem., 306: 50, 2002; Hall, Anal.Biochem., 288: 109, 2001; Canziani et al., Methods, 19: 253, 1999; Brockman et al., J. Am. Chem. Soc., 121: 8044, 1999; Nelson et al., Anal.Chem., 73: 1, 2001; Jordan et al., Anal.Chem., 69: 4939, 1997; Goodrich et al., J. Am. Chem. Soc., 126: 4086, 2004). However, these methods also do not give the proper orientation of the antibody, which leads to the loss of biological activity, complex and time-consuming, and that the alkanethiol monolayer contains proteins with cysteine. A chemical treatment method was used where the sulfur-gold bond itself could become unstable when the mixture containing sulfur was included.

Thus, the properties of protein A or protein G that specifically binds to the Fc region of antibodies (Boyle and Reis, Biotech. 5: 697, 1987; Hoffman and O'Shannessay, J. Immunol. Methods, 112: 113, 1988 Although attempts have been made to increase the orientation of antibodies using the same method, complex and time-consuming chemical methods for binding protein A or protein G to gold have been used. There is an urgent need for a method of selectively and stably immobilizing antibodies on gold.

As a result, there was an urgent need for a linker that can be immobilized in a gold-containing solid phase simply and economically while maintaining the proper orientation of the Fab site of the antibody as the antigen-binding site.

SUMMARY OF THE INVENTION In order to solve the above problems, an object of the present invention is to provide a biological connector capable of immobilizing an antibody on a gold-containing solid, simply and economically, while maintaining an appropriate orientation of the antibody Fab region toward the assay solution.

Still another object of the present invention is to provide a biosensor that can be easily used in an immunoassay using the linker.

Still another object of the present invention is to provide an immunoassay method capable of simply detecting a specific substance using a bioconnector or a biosensor according to the present invention.

In order to achieve the object of the present invention, the present invention

Provided is a recombinant fusion protein encoded by the nucleotide sequence of SEQ ID NO: 10.

According to an embodiment of the present invention,

A recombinant fusion protein encoded by the nucleotide sequence of SEQ ID NO: 11 is provided.

Another object of the present invention provides a polynucleotide having a nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence of SEQ ID NO: 11.

Another object of the present invention provides an expression vector comprising a polynucleotide having a nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence of SEQ ID NO: 11.

For another object of the present invention provides a transformant transformed with the expression vector according to the present invention.

Another object of the present invention is to provide a recombinant fusion protein in which a peptide having an amino acid sequence of SEQ ID NO: 1 and a peptide encoded by a nucleotide sequence of SEQ ID NO: 8 are recombined.

According to one embodiment of the invention, the peptide having the amino acid sequence of SEQ ID NO: 1 may be bonded to the N terminal or C terminal of the peptide encoded by the nucleotide sequence of SEQ ID NO: 8.

For still another object of the present invention, there is provided a recombinant fusion protein in which a peptide having an amino acid sequence of SEQ ID NO: 1 and a peptide encoded with a nucleotide sequence of SEQ ID NO: 9 are recombined.

According to one embodiment of the invention, the peptide having the amino acid sequence of SEQ ID NO: 1 may be bonded to the N terminal or C terminal of the peptide encoded by the nucleotide sequence of SEQ ID NO: 9.

For another object of the present invention, there is provided a biosensor consisting of a recombinant fusion protein and a gold-containing solid phase according to the present invention.

According to one embodiment of the invention, the gold-containing solid phase may be selected from the group consisting of gold colloidal particles, nano-gold particles, gold-coated particles and gold coated substrate.

 Another object of the present invention provides a method of manufacturing a biosensor comprising the following steps:

(a) A recombinant vector comprising a gene encoding a gold binding protein (GBP) and a gene of SEQ ID NO: 10 or 11 encoding protein A or protein G and configured to be expressed in a fused form of the two genes Preparing a transforming microorganism by inserting into a host cell selected from the group;

(b) culturing the transformed microorganism to express the recombinant fusion protein encoded by the nucleotide sequence of SEQ ID NO: 10 or 11;

(c) recovering the microorganism in which the fusion protein is expressed and then crushed to obtain a fraction containing the fusion protein; And

(d) specifically immobilizing the fraction containing the fusion protein on a gold-containing solid phase.

In order to achieve another object of the present invention, an immunodetection method using a biosensor according to the present invention is provided.

According to one embodiment of the invention, the immunodetection method comprises the steps of specifically binding the antibody to the recombinant fusion protein of the biosensor; And

And treating the antigen specific for the antibody to detect specific binding of the antigen-antibody.

According to one embodiment of the invention, the antibody may be any one, and may be, for example, an antibody such as anti-AFB1 (anti aflatoxin B1).

According to an embodiment of the present invention, the concentration of the anti-AFB1 antibody may be 100 µg / ml.

According to one embodiment of the present invention, immunodetection may be performed through a visually, optically or electrochemically method.

According to one embodiment of the present invention, the optical detection method may use a surface plasmon resonance (SPR) method.

Hereinafter, the content of the present invention will be described in more detail.

The present invention provides a fusion protein encoded by base sequence 10 or 11.

The fusion protein can be used as a linker connecting the gold solid phase and the antibody.

The recombinant fusion protein can be expressed using a conventionally known recombinant technique using a gene encoded by the nucleotide sequence of SEQ ID NO: 10 or 11. First, the DNA sequence of SEQ ID NO: 10 or 11 is prepared according to a conventional method. DNA sequences can be prepared by amplifying the PCR using appropriate primers. Alternatively, DNA sequences may be synthesized by standard methods known in the art, such as using automated DNA synthesizers (commercially available from Biosearch or Applied Biosystems). The constructed DNA sequence is inserted into a vector comprising one or more expression control sequences (e.g., a promoter, an enhancer, etc.) operably linked to and regulate the expression of the DNA sequence and formed therefrom. Transform host cells with recombinant expression vectors. The resulting transformants are incubated under appropriate media and conditions so that the DNA sequences are expressed to recover the "substantially pure fusion protein" encoded by the DNA sequences from the culture. The recovery can be recovered using methods known in the art (eg chromatography, etc.). As used herein, “substantially pure fusion protein” means that the fusion protein according to the invention is substantially free of any other proteins derived from the host. Recombinant techniques for protein expression of the present invention may be referred to (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, USA, 1989).

According to an embodiment of the present invention, the present invention includes a DNA fragment of SEQ ID NO: 10 or 11, an expression vector comprising the DNA gene, and a transformant transformed with the expression vector.

Expression vectors refer to plasmids, viral vectors or mediators known in the art capable of expressing a nucleic acid inserted into a host cell, wherein the DNA encoding the fusion protein of the present invention in a conventional expression vector known in the art It may be operatively connected. The expression vector may generally comprise a DNA of the present invention operably linked with a replication origin capable of proliferating in a host cell, one or more expression control sequences that regulate expression, a selection marker and an expression control sequence. The transformant may be transformed by the expression vector. Preferably, the transformant is a method known in the art, such as, but not limited to, transient expression of the expression vector comprising the DNA of the present invention (transient), micro-injection, transduction, cells Fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE Dextran-mediated transfection, polybrene-mediated transfection, electrophoresis It can be obtained by introducing into a host cell by a known method such as electroporation.

According to an embodiment of the present invention, there is provided a biosensor comprising the recombinant fusion protein according to the present invention for use in an immunoassay.

The fusion protein according to the present invention is a combination of a gold binding protein (hereinafter referred to as 'GBP') and protein A or protein G, wherein the GBP according to the present invention consists of 42 amino acids and May optionally be combined.

Protein A or G of the fusion protein specifically binds to the Fc portion of the antibody, unlike other proteins (Boyle and Reis, Biotech. 5: 697, 1987).

Therefore, the GBP portion of the fusion protein according to the present invention selectively binds to the gold-solid, and the protein A or protein G portion specifically binds to the antibody Fc portion, and when used, selectively binds to the gold-solid, It is possible to provide a biosensor that can specifically bind to antibody Fc.

As a result, the biosensor is capable of maintaining the proper orientation of the fusion protein on the gold-solid phase and the Fab portion, which is an activating portion to which the antigen binds by binding to the Fc of the antibody, in the direction of the solution. It can be usefully used in the field of immunoassay to apply the response.

In other words, the biosensor is coupled to the specificity of GBP in the fusion protein itself, rather than using a chemical treatment method, such as gold solids, and is not subjected to complex and time-consuming self-assembled monolayers (SAMs) process, While the process is simple, the antibody can be immobilized selectively and stably in gold in a short time without affecting other biological activities.

The gold-solid may be any solid including a gold component, such as gold colloidal particles, nano-gold particles, gold-coated particles, or gold-containing solids such as gold coated substrates.

In addition, according to the biosensor according to the present invention, all kinds of antibodies can be immobilized if they have proper orientation without chemical or physical pretreatment. This is because the protein A or protein G portion of the fusion protein specifically binds to the Fc portion of the antibody, thereby allowing the Fab portion of the antibody to react more freely with the target detection material.

According to an embodiment of the present invention, a peptide having an amino acid sequence of SEQ ID NO: 1 and a peptide encoded by a nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 9 are provided. The peptide having the amino acid sequence of SEQ ID NO: 1 may be inserted into the N terminus or the C terminus of the peptide of SEQ ID NO: 8 or SEQ ID NO: 9 through gene aggregation.

According to an embodiment of the present invention provides an immunoassay method using the biosensor of the present invention. Immunodetection, characterized by identifying the specific binding of the antigen-antibody, can be performed by visually, optically, or electrochemically, in particular, surface plasmon resonance as an example of the optical method. (SPR) technology.

SPR technology is a technology that can sensitively analyze the change in the refractive index (reflective index) of the surface of the chip using a chip coated with a thin gold thin film on the glass chip using a CCD camera. As a common analytical method in biosensor systems, it is currently commercialized and used to test protein-protein, protein-DNA, and DNA-DNA interactions.

According to one embodiment of the present invention, an immunobiosensor for SPR detection was prepared by specifically fixing the fusion protein encoded by the nucleotide sequence of SEQ ID NO: 10 or 11 expressed from E. coli on the gold surface. As a result of using the SPR sensor, the specific interaction between the anti-AFB1 antibody and the AFB1 antigen could be easily retrieved without a label.

In the present invention, the expressed fusion proteins are immobilized on the surface of the gold chip without losing their activity even under various pH conditions, so that the present method may be applied to fix proteins in various external environments.

According to one embodiment of the invention, with reference to Figure 1 looks at the SPR biosensor analysis using a biosensor immobilized fusion protein.

In other words, Figure 1 is first immobilized the recombinant fusion protein (A or G) to the SPR gold-solid, and the antibody (immunoglobulin G) is specifically bound to the fusion protein (A or G), the anti-AFB1 antibody is first fused protein ( A or G) is a schematic diagram that specifically binds to and detects the antigen AFB1. In SPR analysis, the polarized light changes the angle of reflection according to the change of the refractive index of the solution on the gold surface, and the degree is proportional to the concentration of the target detection material. do.

According to the present invention, not only the immobilization of all kinds of antibodies on the chip surface but also the appropriate orientation of the immobilized antibodies (improvement) improve productivity and economics, and increase sensitivity and selectivity when producing an immunobio sensor. You can expect.

Hereinafter, the present invention will be described in more detail with reference to the following examples and test examples. In conclusion, these examples are only for illustrating the present invention in more detail, it is to those skilled in the art that the scope of the present invention is not limited by these examples and test examples according to the gist of the present invention. Will be self-evident.

In particular, the following examples describe only the use of a biosensor immobilized with a recombinant fusion protein according to the invention on a gold substrate to detect specific binding of anti-AFB1 antibody and AFB1 antigen, but other gold-containing solid phase materials. The introduction of is not particularly limited, and it will be apparent to those skilled in the art that the present invention can be applied to detection of interaction between all antigens and antibodies.

In addition, in the following examples, only the fusion protein of GBP-protein A was used to immobilize the anti-AFB1 antibody while maintaining the proper orientation on the gold substrate, but protein G was specific for the antibody Fc as protein A. It is obvious to those skilled in the art that the same result can be obtained even by using the fusion protein of GBP-protein G because the present invention has such a property of binding to each other.

In the following examples, only E. coli is used as the host microorganism, but the present invention is not limited thereto. It will be apparent to those skilled in the art.

In addition, in the following examples, although the GBP protein is bound to the N-terminus of protein A (or protein G), the same result is obtained even when the GBP protein is bound to the C-terminus of the present invention. Acquisition will be apparent to those of ordinary knowledge in this field.

Example  One: Fusion protein  Expression system construction

Construction of recombinant fusion protein expression system encoded by the nucleotide sequence of SEQ ID NO: 10

As shown in Figure 2, to prepare a fusion protein, the gene was secured using the overlap PCR method (SEQ ID NO: 10). On the other hand, the amplified gene was cloned into pET-22b (+) (Novagen, San Diego, CA, USA) and produced by 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) induction in Escherichia coli and the N of each fusion protein. At the end, 6-histidine can be purified using a Ni-NTA column. The base sequence of the PCR primer used is as shown below.

SEQ ID NO 2:

5'-ACCAAGA CATATG CATCACCATCACCATCACCATGGTAAGACGCAAGCCACGAG-3 '(Primer 1)

SEQ ID NO 3:

5'-T GAATTC GCTTTGGATCGTGCCAGAGGTGGCCTGCGTCTTGCCATGCATGCTTT -3 '(Primer 2)

SEQ ID NO 4:

5'-G GAATTC GCGCAACACGATGAAGCTCAA-3 '(Primer 3)

SEQ ID NO 5:

5'-AG GGATCC TTATAGTTCGCGACGACGTCC-3 ' ( primer 4)

SEQ ID NO 6:

5'-G GAATTC TTGAAAGGCGAAACAACTACTGAAGCTGTTGATGCTGCTACTG-3 '(Primer 5)

SEQ ID NO 7:

5'-GA GGATCC TTATTCAGTTACCGTAAAG-3 ' ( primer 6)

Plasmid pTGE (Park et al., Anal. Chem., 78: 7197, 2006) was used as a template, PCR was performed using the primers of SEQ ID NOS: 2 and 3, and then, separately from Staphylococcus maureus. (Staphylococcus aureus) Mu50 (ATCC 700699D, American Type Culture Collection, Manassas, VA, USA) gene encoding the genomic DNA (SEQ ID NO: 8) as a template, PCR using the primers of SEQ ID NOS: 4 and 5 Was performed. The amplified PCR product was used as template DNA, and finally PCR was performed using primers of SEQ ID NOs: 2 and 5 to finally obtain a gene of a fusion protein in which 6His-GBP and protein A were fused.

The first denaturation was performed once at 94 ° C for 5 minutes, followed by a second denaturation at 94 ° C for 1 minute, annealing at 56 ° C for 1 minute and 20 seconds, and extension at 72 ° C. 1 minute 20 seconds was performed and this was repeated 30 times. Then, the last extension was performed once more for 5 minutes at 72 ° C.

DNA obtained by the PCR was subjected to agarose gel electrophoresis to separate DNA fragments of about 1.4 kb, which were digested with two restriction enzymes NdeI and BamHI, and then the DNA fragments were digested with the same restriction enzyme. Recombinant plasmid pET-6HGBP-spa (Mu50) was prepared by cloning into plasmid pET-22b (+) (FIG. 3).

Encoded by the nucleotide sequence of SEQ ID NO: 11 Fusion protein  Expression system construction

The protein G gene of Streptococcus G148 (Goward et al., Biochem. J., 1990, SEQ ID NO: 9) was artificially synthesized (Blue Heron Biotechnology, Bothell, WA, USA) and used as template DNA. PCR was performed using the primers of 7 to finally obtain a 6His-GBP and a protein G-fused product. The first denaturation was performed once at 94 ° C for 5 minutes under the PCR conditions, after which the second denaturation was at 94 ° C for 1 minute, the annealing at 56 ° C for 1 minute and 30 seconds, and the extension at 72 ° C. One minute was performed and this was repeated 30 times. Then, the last extension was performed once more at 72 ° C. for 5 minutes.

DNA obtained by PCR was subjected to agarose gel electrophoresis to separate DNA fragments of about 700 bp, which were digested with two restriction enzymes NdeI and BamHI, and then the DNA fragments were digested with the same restriction enzyme. Cloning into plasmid pET-22b (+) produced recombinant plasmid pET-6HGBP-spg (FIG. 4).

Since protein A and protein G, which are derived from microorganisms, have very similar properties of specifically binding to immunoglobulin G (IgG), an antibody in vertebrates, it is not clear that GBP-protein A and GBP-protein G will produce the same results. It is self-evident for those of ordinary knowledge.

Preparation of Recombinant E. Coli with Recombinant Plasmid

The produced pET-6HGBP-spa (Mu50) and pET-6HGBP-spg, respectively, by using a heat shock method, Escherichia coli BL21 (DE3) (F-ompT hsdSB (rB-mB-) gal dcm (DE3), Introduced in Novagen, San Diego, CA, USA, LB flat medium (yeast extract, 5 g / l) with ampicillin (100 mg / l) and bacto-agar (15 g / l) Recombinant Escherichia coli BL21 (DE3) / pET-6HGBP-spa (Mu50) and BL21 (DE3) / pET-6HGBP-spg were prepared by selection in tryptone, 10 g / l; NaCl, 10 g / l), respectively.

Expression of Recombinant Protein

GBP-protein A and GBP-protein G fusion proteins were expressed in Escherichia coli BL21 (DE3) transformed with recombinant plasmids pET-6HGBP-spa (Mu50) and pET-6HGBP-spg with potent and inducible T7 promoters, respectively. It was. T7 promoter is induced by IPTG (isopropyl-β-thiogalactoside) gene expression and in the case of Escherichia coli BL21 (DE3) transformed with pET-6HGBP-spa (Mu50) and pET-6HGBP-spg as follows GBP-protein A And a fusion protein of GBP-protein G was prepared. The transformed recombinant E. coli was inoculated into a 500 ml flask containing 200 ml of LB liquid medium and incubated at 37 ° C. Gene expression induction by IPTG was performed by adding 1 mM IPTG when the optical density (OD) measured at a wavelength of 600 nm with a spectrophotometer is 0.4. After 4 hours after induction, the whole culture was centrifuged at 6,000 rpm for 5 minutes at 4 ° C, and then the supernatant was discarded and washed once with 100 ml TE buffer (Tris-HCl 10 mM; EDTA 1 mM, pH 8.0). After centrifugation at 6,000 rpm for 5 minutes at 4 ° C, the solution was suspended in 100 ml of TE buffer (Tris-HCl 10 mM; EDTA 1 mM, pH 8.0) and sonicated at 4 ° C (Branson Ultrasonics Corp., Danbury). , Conn., USA) was used to disrupt the cells. The crushed solution was centrifuged at 6,000 rpm for 30 minutes at 4 ° C. to discard insoluble protein and filtered with a 0.2 μm filter. The filtered solution was purified using Ni-NTA column and fixed buffer solution (PBS, pH) after quantification using Bradford protein assay (Bradford, M. et al., Anal. Biochem. 72; 248-254, 1976). 7.4) and dilute to 1 mg / ml.

Recombination Fusion proteins  Fabrication of Fixed Biosensor

The water-soluble protein fraction containing the recombinant fusion protein of GBP-protein A obtained above was diluted with PBS buffer (pH 7.4) to a concentration of 1 mg / ml. Gold chip (Biacore Internation AB, Uppsala, Sweden) was treated with normalization solution (70% glycerol, v / v) for 6 minutes to completely remove surface organic matter and syringe pump in SPR device using microchannel between gold chip ( Syringe pump) to stabilize the surface of the gold chip while flowing the PBS buffer at a flow rate of 5 μl / min to produce a bio-gold chip that can immobilize the fusion protein.

Test Example  One: GBP -protein A Fusion protein  Binding to Gold Surfaces and Specific Reactivity with Antibodies

In order to confirm that GBP-protein A, a genetically engineered recombinant fusion protein, is successfully bound to bio-gold chip by GBP, GBP-protein A fusion protein (1 mg / ml) was added to SPR gold chip. On the other hand, protein A (1 mg / ml) without GBP was flowed into SAMs treated gold chip for 10 minutes while washing with PBS buffer.

As can be seen in Figure 5, as a result of flowing GBP-protein A gradually increased the RU value to finally increased to 1,211 RU value. The absence of a decrease in RU values after washing with the buffer after binding showed that the fusion protein was never released from the gold surface by the buffer. This indicates that the fusion protein is bound to the gold surface progressively and regularly by the GBP. The 1,211 RU value also indicates that about 1,2 ng of the fusion protein was bound per mm 2 of gold chip. In addition, the control protein A was increased by 1780 RU higher than GBP-protein A, but after buffering, the RU decreased to 757 by 58%. It shows that a significant amount has been separated off by the buffer.

The reason for this is that when protein A binds to the gold surface, the initial bonds increased steeply vertically, presumably due to electrostatic bonds between the chemicals formed by the SAMs treatment and the peptide covalent bonds of the amine groups in the protein A protein. It is believed that it contributed a part. This electrostatic bond caused irregular and rapid binding of protein A, which is considered to be weaker than GBP's ability to bind to the gold surface (Katherine et al., Anal. Chem., 67: 735, 1995; Schmitt et al. Langmuir, 15: 3256, 1999).

As a next step, the ability of the antibody (anti-AFB1) to specifically bind to the immobilized protein A was also higher than that of protein A (1843 RU increased) to the protein A portion of the fusion protein (1889 RU increased). Was a bit high.

These results suggest that the use of this new biosensor for immobilization of biomaterials on bio-gold chips allows for the binding of all types of antibodies with regular, strong binding and proper orientation in a much simpler and shorter time than conventional SAMs. It can be easily used to detect various biomaterials.

Test Example  2: anti- AFB1  Optimum Immobilization Concentration of Antibodies

In order for the immobilized anti-AFB1 antibody to have high sensitivity for detecting antigen AFB1, it is necessary to find the optimal concentration of anti-AFB1 on the GBP-protein A immobilized layer on the gold chip.

FIG. 6 shows 10 μg / g injection of anti-AFB1 at various concentrations (50, 100, 150, 200 μg / ml) on a gold chip for 10 minutes to investigate the concentration of anti-AFB1 showing the highest AFB1 detection ability. It shows an increase in RU value when 10 ml of AFB1 was added to each channel for 10 minutes. When the concentration of immobilized anti-AFB1 on the surface of GBP-protein A increased from 50 μg / ml to 100 μg / ml, the RU value for AFB1 increased proportionally from 398 to 643 and peaked at 150 μg / ml. At ml and 200 μg / ml, they tended to decrease proportionally to 528 and 430 RU values.

This result suggests that if the concentration of the immobilized antibody is too low, it does not give an opportunity to fully react with the target antigen AFB1 to be detected, while if the concentration is too high, free flow is inhibited because the space disturbance occurs between immobilized anti-AFB1 antibodies. It is thought to be an obstacle to smooth reaction with AFB1 (Ko and Grant, Biosens. Bioelectron., 21: 1283, 2006).

Therefore, the optimal concentration of anti-AFB1 antibody immobilized on the GBP-protein A layer bound to the gold surface is 100 μg / ml, and the immobilization of the antibody is dependent on the protein A portion of the GBP-protein A fusion protein. It can be seen that the combination.

Test Example  3: Sensitivity and Selectivity for Antibody Detection

Immobilized concentration of anti-AFB1 fusion protein obtained in Test Example 2 (100 μg / ml) was immobilized on each layer of GBP-protein A pre-formed on the gold chip for 10 minutes, and then 500 μg / ml of bovine serum albumin (BSA) was flowed for 7 minutes. Next, to investigate the detection limit for this AFB1 antigen, 10000, 5000, 1000, 100, 10 ng / ml of AFB1 was reacted for 10 minutes and washed with PBS buffer.

As a result, as shown in FIG. 7, the RU values were proportionally decreased to 655, 449, 228, 167, and 101, respectively. In conclusion, the detection limit of AFB1 of anti-AFB1 antibody immobilized on GBP-protein A was 10 ng / ml.

8, in order to confirm the degree of selectivity of the chip, 10 μg / ml AFB1 was flowed on another biochip immobilized with anti-AFB1 antibody on GBP-protein A fusion protein, and another fungal toxin of the same concentration was used as a control. The samples were mixed with ochratoxin A (OTA), zearalenone (ZEA) and OTA, ZEA, and AFB1 for 10 minutes, and then washed with a buffer to compare their RU values.

As expected, the RU values of 0 and 5O were very low in the OTA and ZEA alone channels. However, in the case of AFB1, the target antigen, the RU value was 571, which was much higher than that of the control group. Also, the reaction of the OTA, ZEA, and AFB1 mixed samples was not significantly different from that of the AFB1 alone with a RU value of 525.

This confirms that the immunodetection chip has a very high selectivity with respect to the target antigen as a result that it hardly reacts with other substances besides the target antigen AFB1.

Test Example  4: SPR Imaging  Antibody Detection Using Assays

As shown in Test Example 2, SPR, another analysis method of SPR by sequentially reacting 100 μg / ml of anti-AFB1 antibody again on a 1 mg / ml GBP-protein A fusion protein layer immobilized on a gold surface Imaging (SPR imaging, K-MAC, Daejeon, Korea) was performed. As shown in FIG. 9, the image intensity when the GBP-protein A fusion protein was immobilized on the gold surface was stronger than the sample No. 1 showing only the gold surface, and after the anti-AFB1 antibody was reacted again, As the image intensity was stronger, the GBP-protein A fusion protein was selectively immobilized on the circular gold surface, and the anti-AFB1 antibody was selectively bound at the position where the GBP-protein A fusion protein was immobilized on the circular gold surface. Could confirm. As shown in Fig. 9 (a), 2D and 3D images of a sample immobilized on a 50-? M circular gold pattern, and as shown in Fig. 9 (b), show the image intensity appearing in each circle by scanning the circle. It was confirmed through the graph.

The specific parts of the present invention have been described in detail above, and it should be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

1 is a schematic diagram of an SPR biosensor chip in which anti-aflatoxin B1 antibody is immobilized by GBP-protein A or protein G fusion protein and thus aflatoxin B1 is detected.

2 is a schematic diagram of a fusion protein according to the present invention. (a) GBP-protein A fusion protein, (b) GBP-protein G fusion protein.

3 is a genetic map of the recombinant plasmid pET-6HGBP-spa (Mu50) prepared according to the present invention.

4 is a genetic map of the recombinant plasmid pET-6HGBP-spg prepared according to the present invention.

FIG. 5 shows surface plasmon resonance (SPR) analysis results showing the binding force between the GBP-protein A fusion protein and the surface of the gold chip of protein A and the binding force with the antibody. The thick line represents GBP-protein A and the thin line represents protein A.

Figure 6 is a graph confirming the optimal concentration of anti-aflatoxin B1 antibody bound to the GBP-protein A fusion protein immobilized on the gold surface.

Figure 7 is a graph confirming the sensitivity (sensitivity) to the detection of AFB1 target of the anti-aflatoxin antibody bound to the GBP-protein A fusion protein immobilized on the gold surface.

FIG. 8 is a graph confirming selectivity for detection of AFB1, which is a target of anti-aflatoxin B1 antibody bound to a GBP-protein A fusion protein immobilized on a gold surface (where: a: OTA, b: ZEA, c : OTA, ZEA, AFB1, d: AFB1).

9 is a SPR imaging result graph showing the interaction between the GBP-protein A immobilized on the gold chip and the antibody. (a) 2D and 3D stereoscopic images of a sample immobilized on a gold pattern of 50-? m circles, (b) scanning the prototypes shown in the diagram in (a) to indicate the image intensity in each prototype. graph. One; Gold micropattern, 2; Gold chip-6His-GBP-Protein A fusion protein, 3; Gold Chip-6His-GBP-protein A-anti-Aflatoxin Antibody. That is, 1, 2, and 3 are experimental results after sequentially combining gold chips, 6His-GBP-protein A, and anti-Aflatoxin antibodies.

<110> Korea Food Research Institute <120> Recombinant fusion protein, Biosensor using the same, and          Immuno-detecting method for target material with the same <160> 11 <170> KopatentIn 1.71 <210> 1 <211> 42 <212> PRT <213> Artificial Sequence <220> <223> trimer of gold binding protein <400> 1 Met His Gly Lys Ala Gln Ala Thr Ser Gly Thr Ile Gln Ser Met His   1 5 10 15 Gly Lys Ala Gln Ala Thr Ser Gly Thr Ile Gln Ser Met His Gly Lys              20 25 30 Ala Gln Ala Thr Ser Gly Thr Ile Gln Ser          35 40 <210> 2 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> primer 1 <400> 2 accaagacat atgcatcacc atcaccatca ccatggtaag acgcaagcca cgag 54 <210> 3 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> primer 2 <400> 3 tgaattcgct ttggatcgtg ccagaggtgg cctgcgtctt gccatgcatg cttt 54 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer 3 <400> 4 ggaattcgcg caacacgatg aagctcaa 28 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer 4 <400> 5 agggatcctt atagttcgcg acgacgtcc 29 <210> 6 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> primer 5 <400> 6 ggaattcttg aaaggcgaaa caactactga agctgttgat gctgctactg 50 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer 6 <400> 7 gaggatcctt attcagttac cgtaaag 27 <210> 8 <211> 1245 <212> DNA <213> Artificial Sequence <220> <223> mature sequence of protein A in Staphylococcus aureus Mu50 <400> 8 gcgcaacacg atgaagctca acaaaatgct ttttatcaag tgttaaatat gcctaactta 60 aacgctgatc aacgtaatgg ttttatccaa agccttaaag atgatccaag ccaaagtgct 120 aacgttttag gtgaagctca aaaacttaat gactctcaag ctccaaaagc tgatgcgcaa 180 caaaataact tcaacaaaga tcaacaaagc gccttctatg aaatcttgaa catgcctaac 240 ttaaacgaag cgcaacgtaa cggcttcatt caaagtctta aagacgaccc aagccaaagc 300 actaatgttt taggtgaagc taaaaaatta aacgaatctc aagcaccgaa agctgataac 360 aatttcaaca aagaacaaca aaatgctttc tatgaaatct tgaatatgcc taacttaaac 420 gaagaacaac gcaatggttt catccaaagc ttaaaagatg acccaagcca aagtgctaac 480 ctattgtcag aagctaaaaa gttaaatgaa tctcaagcac cgaaagcgga taacaaattc 540 aacaaagaac aacaaaatgc tttctatgaa atcttacatt tacctaactt aaacgaagaa 600 caacgtaacg gcttcatcca aagccttaaa gacgatcctt cagtgagcaa agaaatttta 660 gcagaagcta aaaagctaaa cgatgctcaa gcaccaaaag aggaagacaa caaaaaacct 720 ggtaaagaag acggcaacaa acctggcaaa gaagacggca acaagcctgg taaagaagac 780 aacaaaaaac ctggtaaaga agacggcaac aagcctggta aagaagacaa caacaaacct 840 ggcaaagaag acggcaacaa gcctggtaaa gaagacaaca acaagcctgg taaagaagac 900 ggcaacaagc ctggtaaaga agacggcaac aaacctggta aagaagacgg caacggagta 960 catgtcgtta aacctggtga tacagtaaat gacattgcaa aagcaaacgg cactactgct 1020 gacaaaattg ctgcagataa caaattagct gataaaaaca tgatcaaacc tggtcaagaa 1080 cttgttgttg ataagaagca accagcaaac catgcagatg ctaacaaagc tcaagcatta 1140 ccagaaactg gtgaagaaaa tccattcatc ggtacaactg tatttggtgg attatcatta 1200 gccttaggtg cagcgttatt agctggacgt cgtcgcgaac tataa 1245 <210> 9 <211> 555 <212> DNA <213> Artificial Sequence <220> <223> synthetic sequence of protein G <400> 9 ttgaaaggcg aaacaactac tgaagctgtt gatgctgcta ctgcagaaaa agtcttcaaa 60 caatacgcta acgacaacgg tgttgacggt gaatggactt acgacgatgc gactaagacc 120 tttacagtta ctgaaaaacc agaagtgatc gatgcgtctg aattaacacc agccgtgaca 180 acttacaaac ttgttattaa tggtaaaaca ttgaaaggcg aaacaactac tgaagctgtt 240 gatgctgcta ctgcagaaaa agtcttcaaa caatacgcta acgacaacgg tgttgacggt 300 gaatggactt acgacgatgc gactaagacc tttacagtta ctgaaaaacc agaagtgatc 360 gatgcgtctg aattaacacc agccgtgaca acttacaaac ttgttattaa tggtaaaaca 420 ttgaaaggcg aaacaactac taaagcagta gacgcagaaa ctgcagaaaa agccttcaaa 480 caatacgcta acgacaacgg tgttgatggt gtttggactt atgatgatgc gactaagacc 540 tttacggtaa ctgaa 555 <210> 10 <211> 1395 <212> DNA <213> Artificial Sequence <220> <223> Artificial GBP-protein A fusion sequence <400> 10 atgcatcacc atcaccatca ccatggtaag acgcaagcca cgagcggcac catccagagc 60 atgcatggta aaacgcaagc cacgtctggt acgattcaaa gcatgcatgg caagacgcag 120 gccacctctg gcacgatcca aagcgaattc gcgcaacacg atgaagctca acaaaatgct 180 ttttatcaag tgttaaatat gcctaactta aacgctgatc aacgtaatgg ttttatccaa 240 agccttaaag atgatccaag ccaaagtgct aacgttttag gtgaagctca aaaacttaat 300 gactctcaag ctccaaaagc tgatgcgcaa caaaataact tcaacaaaga tcaacaaagc 360 gccttctatg aaatcttgaa catgcctaac ttaaacgaag cgcaacgtaa cggcttcatt 420 caaagtctta aagacgaccc aagccaaagc actaatgttt taggtgaagc taaaaaatta 480 aacgaatctc aagcaccgaa agctgataac aatttcaaca aagaacaaca aaatgctttc 540 tatgaaatct tgaatatgcc taacttaaac gaagaacaac gcaatggttt catccaaagc 600 ttaaaagatg acccaagcca aagtgctaac ctattgtcag aagctaaaaa gttaaatgaa 660 tctcaagcac cgaaagcgga taacaaattc aacaaagaac aacaaaatgc tttctatgaa 720 atcttacatt tacctaactt aaacgaagaa caacgtaacg gcttcatcca aagccttaaa 780 gacgatcctt cagtgagcaa agaaatttta gcagaagcta aaaagctaaa cgatgctcaa 840 gcaccaaaag aggaagacaa caaaaaacct ggtaaagaag acggcaacaa acctggcaaa 900 gaagacggca acaagcctgg taaagaagac aacaaaaaac ctggtaaaga agacggcaac 960 aagcctggta aagaagacaa caacaaacct ggcaaagaag acggcaacaa gcctggtaaa 1020 gaagacaaca acaagcctgg taaagaagac ggcaacaagc ctggtaaaga agacggcaac 1080 aaacctggta aagaagacgg caacggagta catgtcgtta aacctggtga tacagtaaat 1140 gacattgcaa aagcaaacgg cactactgct gacaaaattg ctgcagataa caaattagct 1200 gataaaaaca tgatcaaacc tggtcaagaa cttgttgttg ataagaagca accagcaaac 1260 catgcagatg ctaacaaagc tcaagcatta ccagaaactg gtgaagaaaa tccattcatc 1320 ggtacaactg tatttggtgg attatcatta gccttaggtg cagcgttatt agctggacgt 1380 cgtcgcgaac tataa 1395 <210> 11 <211> 705 <212> DNA <213> Artificial Sequence <220> <223> Artificial GBP-protein G fusion sequence <400> 11 atgcatcacc atcaccatca ccatggtaag acgcaagcca cgagcggcac catccagagc 60 atgcatggta aaacgcaagc cacgtctggt acgattcaaa gcatgcatgg caagacgcag 120 gccacctctg gcacgatcca aagcgaattc ttgaaaggcg aaacaactac tgaagctgtt 180 gatgctgcta ctgcagaaaa agtcttcaaa caatacgcta acgacaacgg tgttgacggt 240 gaatggactt acgacgatgc gactaagacc tttacagtta ctgaaaaacc agaagtgatc 300 gatgcgtctg aattaacacc agccgtgaca acttacaaac ttgttattaa tggtaaaaca 360 ttgaaaggcg aaacaactac tgaagctgtt gatgctgcta ctgcagaaaa agtcttcaaa 420 caatacgcta acgacaacgg tgttgacggt gaatggactt acgacgatgc gactaagacc 480 tttacagtta ctgaaaaacc agaagtgatc gatgcgtctg aattaacacc agccgtgaca 540 acttacaaac ttgttattaa tggtaaaaca ttgaaaggcg aaacaactac taaagcagta 600 gacgcagaaa ctgcagaaaa agccttcaaa caatacgcta acgacaacgg tgttgatggt 660 gtttggactt atgatgatgc gactaagacc tttacggtaa ctgaa 705  

Claims (19)

A first base sequence encoding the amino acid sequence of SEQ ID NO: 1 and a second base sequence encoding a protein that binds the fragment crystalline (Fc) region of the antibody to align the Fab antigen region of the antibody in the direction of the assay solution Polynucleotide comprising a. The method of claim 1, A polynucleotide, characterized in that the 5 'end of the second base sequence is directly connected to the 3' end of the first base sequence. The method of claim 1, Polynucleotide, characterized in that the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 10 or 11. The method of claim 1, Wherein said second nucleotide sequence comprises the nucleotide sequence of SEQ ID NO: 8 or 9. The method of claim 1, Polynucleotide, characterized in that the protein is protein A or protein G. Recombinant expression vector comprising a polynucleotide of any one of claims 1 to 5. The transformant, characterized in that transformed with the expression vector of claim 6. Recombinant fusion protein, characterized in that encoded by the polynucleotide of any one of claims 1 to 5. The method of claim 8, The amino acid sequence of SEQ ID 1; And an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 8 or 9. 10. The method of claim 9, Recombinant fusion protein, characterized in that the amino acid sequence of SEQ ID NO: 1 is bonded to the N terminal or C terminal of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 8 or 9. A biosensor comprising the recombinant fusion protein of claim 8 and a gold-containing solid phase. The method of claim 11, And the gold-containing solid phase is selected from the group consisting of gold colloidal particles, nano-gold particles, gold-coated particles and gold coated substrates.  Method of manufacturing a biosensor comprising the following steps: (a) preparing a transforming microorganism by inserting a recombinant vector containing a gene of SEQ ID NO: 10 or 11 and configured to express the two genes in a fused form into a host cell selected from the group consisting of bacteria; (b) culturing the transformed microorganism to express the recombinant fusion protein encoded by the nucleotide sequence of SEQ ID NO: 10 or 11; (c) recovering the microorganism expressing the fusion protein, and then crushing to obtain a fraction containing the recombinant protein; And (d) specifically immobilizing the fraction containing the fusion protein on a gold-containing solid phase. The immunodetection method using the biosensor of claim 13. The method of claim 14, The immunodetection method specifically binding the antibody to the recombinant fusion protein of the biosensor; And An immunodetection method comprising the step of detecting an antigen-specific binding of the antibody by treating the antigen specific to the antibody. The method of claim 15, Immunodetection method characterized in that the antibody is anti-AFB1 (anti aflatoxin B1). The immunodetection method of claim 16, wherein the concentration of the anti-AFB1 antibody is 100 μg / ml. The method of claim 14, The immunodetection method, characterized in that the immunodetection is performed by a visually (optically) or electrochemically (electrochemically) method. The method of claim 18, Immunodetection method characterized in that the optical detection method using the surface plasmon resonance (SPR) method.

Images