KR100889800B1 - Validamycin biosynthesis gene cluster and it?s primer - Google Patents

Abstract

The present invention relates to a biosynthetic gene cluster of antibiotic Validamycin and a primer capable of detecting the same, and dehydrogenase derived from Streptomyces hygroscopicus var. Limoneus KCTC1717. ) ValA, Aminotransferase ValB, Trehalose-phosphate synthase ValC, dTDP-4-keto-6-deoxyhexose reductase ValD, Ballylon Synthesis Determination of the gene sequence and amino acid sequence of the enzyme (2-epi-5-epi-valiolone synthase) ValE, Glucose-1-phosphate adenylyltransferase ValF provides an effect. In addition, physiologically active substances, including the valienamine structure, which is an intermediate of the biosynthesis of validamycin, have mainly alpha-glucosidase inhibition effect, which is why it is developed as an obesity treatment and pesticide in agriculture. As an important compound being developed, the enzymes for biosynthesizing the valenamine structure, that is, the dehydrogenase ValA, the amine transferase ValB, the ditipi keto deoxyhexose reductase (dTDP-4) The gene sequence and amino acid sequence of the -keto-6-deoxyhexose reductase) ValD, the 2-epi-5-epi-valiolone synthase ValE, are then screened for the bioactive-producing strains having a baliamine structure. In addition to the production of primers and DNA chips, it can be usefully applied for more effective production of validamycin or valenamine. Many effects can be expected.

Streptomyces hygroscopius limoneus, validamycin, baliamine

Description

Validamycin biosynthesis gene cluster and it's primer}

1 is a genetic map showing the positions of ValA-ValF in a validity cluster of valididamycin and valenamine biosynthesis of 8.6 kb,

Figure 2 is a data search for homology through the ValE of the present invention through a known database (NCBI).

The present invention relates to a validamycin biosynthetic gene cluster, and more particularly, dehydrogenase ValA, aminotransferase ValB, trehalose phosphate synthetase Trehalose-phosphate synthase ValC, dTDP-4-keto-6-deoxyhexose reductase ValD, 2-epi-5-epi-valiolone synthase ValE and Glucose-1-phosphate adenylyltransferase Glucose-1-phosphate adenylyltransferase The present invention relates to a base sequence and amino acid sequence of a gene cluster including a gene of ValF, and a primer capable of separating, detecting, and separating the same, and their industrial applicability.

Validamycin, salbostatin, acarviosin, acarbose, adiposin, trestatin, etc. In addition, the compounds are trehalase (Trehalase) and the like act as an important compound of the alpha glucosidase inhibitor (α-glucosidase inhibitor), it is widely used as an antibiotic for agriculture or obesity treatment for human health promotion, its commercial Development is being actively performed.

Therefore, isolating and securing the genetic resources that biosynthesize such Baliienamine structure is not only efficient production of Baliienamine using the above genetic information, but also applied to PCR primers or DNA chip probes, resulting in Baliienamine targeting microorganisms. Isolation of microorganisms that produce bioactive substances with structure, and can provide an opportunity to analyze and secure the structure of the compound is expected to have an important value.

Therefore, if the development of important new enzymes that are commonly involved in valenamine biosynthesis, the industrial applications are also expected to be large.

Thus, the present inventors have identified the genome and specific primers of Streptomyces hygroscopicus limonus to clone genes responsible for the biosynthesis of validamycin from Streptomyces hygroscopicus var.limoneus KCTC1717. After PCR amplification using ValC-F and ValC-R, a DNA fragment having an expected size in the PCR amplification product was produced by a probe, and a probe was detected among fragments of the Streptomyces hygroscopicus limoneus genome digested with restriction enzymes. Small-scale genetic libraries (DNAs) selected from the genome of Streptomyces hygroscopicus limoneus based on the Southern hybridization results were selected by Southern hybridization. library) PCR amplification using specific primers ValC-F and ValC-R Plasmids that are positive in bands of expected size in the PCR product are isolated, their plasmid genes are cleaved using appropriate restriction enzymes, and the fragments are then subcloned into plasmid pUC18 to obtain M13-47 and M13R primers. The nucleotide sequence was determined by using a nucleotide sequence of about 8.6 kb. As a result, it was confirmed that 6 coding regions exist, and the amino acid sequence of the gene was compared and analyzed, and ValA named in the present invention was dehydrogenase (Dehydrogenase). ), ValB is an aminotransferase, ValC is a trehalose-phosphate synthase, ValD is a dTDP-4-keto-6-deoxyhexose reductase, ValE The Valorone synthase (2-epi-5-epi-valiolone synthase), ValF the glucose phosphate adenylyl transferase (Glucose-1-phosphate adenylyltrans By demonstrating homology with the ferase, the present invention was completed.

Accordingly, an object of the present invention is to provide a ValA, amine transferase activity having a dehydrogenase activity inserted in part into a plasmid clone into which a population of valididamycin and a valenamine biosynthetic gene derived from Streptomyces hygroscopicus limoneus KCTC is inserted ValB having, ValC having activity of trehalose phosphate synthase, ValD having activity of ditipid keto deoxyhexose reductase, ValE having activity of balliolone synthase, and glucose phosphate adenyl transfer enzyme having activity It is to provide a gene cluster containing the gene of ValF.

The present invention also provides a primer that can isolate, detect, and amplify a gene of each enzyme involved in synthesis in the varidamycin biosynthetic gene cluster.

In order to achieve the above object, the present invention is to provide a validamycin biosynthetic gene cluster comprising the gene represented by SEQ ID NO: 1.

In addition, to achieve another object, the present invention provides a primer for separating, detecting and amplifying the gene represented by SEQ ID NO: 2 and 3.

Hereinafter, the present invention will be described in detail.

At this time, if there is no other definition in the technical terms and scientific terms used, it has a meaning commonly understood by those of ordinary skill in the art.

In addition, repeated description of the same technical configuration and operation as in the prior art will be omitted.

Strains used in the present invention are those that received the Streptomyces hygroscopicus limoneus KCTC1717 ( S. hygrosco- picus var . Limoneus KCTC1717) deposited at the Korea Institute of Bioscience and Biotechnology.

The cloning method of validamycin biosynthetic gene cluster according to the present invention is carried out as follows.

(1) After making a small gene library using the genome of Streptomyces hygroscopicus limoneus KCTC1717 ( S. hygrosco- picus var . Limoneus KCTC1717), it is necessary for the biosynthesis of the Baliniamine of ballidamycin. Using a specific primer (forward: 5'- GTACGTCCGCATACCCACGACCCTGAT C -3 ', reverse: 5'- CATCTCCACGCTGGGTGAGAAGGAGTG -3') to effectively amplify the existing pariolone synthase (2-epi-5-epi-valiolone synthase) PCR amplification and separating the two plasmid pB44, pH9 clones that showed positive reaction in the band of the expected size from the amplification product; (2) The isolated plasmid gene was digested with a suitable restriction enzyme and subcloned into plasmid pUC18 to describe [M13-47 and M13R primers (if the commercial name, the manufacturer and country of manufacture are described in Examples, and the deletion here). Using)) to determine the base sequence to determine the base sequence of about 8.6 kb; (3) confirming that there are six coding regions of the gene population (in the present invention, they are named Val A, B, C, D, E, and F according to the nucleotide sequence of the gene cluster, respectively). And amino acid sequences translated from sequence determination, ValA is a dehydrogenase, ValB is an amine transferase, ValC is a trehalose-phosphate synthase, and ValD is a dithipic keto deoxyhexene. Source reductase (dTDP-4-keto-6-deoxyhexose reductase), ValE is a valerianone synthase (2-epi-5-epi-valiolone synthase), ValF is a glucose phosphate adenylyl transferase (Glucose-1- phosphate adenylyltransferase).

In the sequence list of the present invention, SEQ ID NO: 1 indicates the base sequence of Validamycin and the valenamine biosynthetic gene cluster corresponding to 8.6 kb, the positions of ValA to ValF genes, and the amino acid sequence.

In this case, genes present in the forward direction, such as ValE and ValF, coincide with the nucleotide sequences shown in SEQ ID NO: 1, but in the case of genes present in the opposite direction, such as ValA, ValB, ValC, ValD, the nucleotide sequences shown in SEQ ID NO: 1 It shows complementary nucleotide sequence of.

Hereinafter, the present invention will be described in more detail with reference to specific examples. However, the present invention is not limited to the following examples, and it will be apparent to those skilled in the art that various changes or modifications can be made within the spirit and scope of the present invention.

Example 1: Preparation of a primer capable of effectively amplifying genes having activity of 2-epi-5-epi-valiolone synthase

AcbC (2-epi-5-epi-valiolone synthase) among acarbose biosynthetic genes having a valienamine structure in the compound structure, such as validamycin, for cloning the validamycin biosynthesis gene, and the above Comparative analysis with the 3-dehydroquinate synthase gene, whose genes and biochemical mechanisms are thought to be similar, were compared to primers (F: 5'-GGSGGSGTSCTSATGGACGTSGCSGG-3 ', R: 5). '-GCCATGTCSACGCASACSGCCTCSCCGTG-3'), and PCR the genome of the primers and Streptomyces hygroscopicus limoneu KCTC1717, the PCR product of the expected size pGEM-T easy vector (Promega) The base sequence was determined after cloning into pGEM-T Easy vector).

ValC-F (5'- GTACGTCCGCATACCCACGACCCTGAT C -3 ') and ValC-R (5'-GTACGTCCGCATACCCACGACCCTGAT C-3') capable of effectively amplifying genes having the activity of the vialone synthase of Streptomyces hygroscopicus limoneus KCTC1717 based on the nucleotide sequence A 5'-CATCTCCACGCTGGGTGAGAAGGAGTG-3 ') primer was developed and the PCR product of the Streptomyces hygroscopicus limonus KCTC1717 genome was used as a probe for Southern hybridization.

Example 2: Streptomyces hygroscopicus limoneus (validamycin producing strain) Streptomyces hygroscopicus var . limoneus KCTC 1717) Small Gene Library

S. hygroscopicus var .limoneus KCTC1717, a strain of the production of validamycin, was cultured in R2YE medium, and chromosomal DNA was isolated from the chromosome by Hopwood's method. DNA was digested with restriction enzymes BamH I and Hind III, and the ValC-F (5'-GTACGTCCGCATACCCACGACCCTGATC-3 '), ValC-R (5'-CATCTCCACGCTGGGTGAGAAGGAGTG-3') primers and streptomyces developed in Example 1 Southern hybridization was performed using PCR amplification products of the genome of S. hygroscopicus var . Limoneus KCTC1717 as probes.

As a result, it was confirmed that the gene having the activity of the vialone synthase was present in the fragment of about 4 kb in the fragment cut by restriction enzyme BamH I and the fragment of about 9 kb in the fragment cut by Hind III. To clone the fragment, a pUC18 vector digested with BamH I and Hind III restriction enzymes was used, respectively.

Then, Streptomyces high-gloss nose kusu remote Neuss respectively completely cutting the genome of KCTC1717 with BamH I and Hind III restriction enzymes and then was recovered for each 4 kb and 9 kb size of the DNA fragments, those respective BamH I and Hind A small gene library (DNA libray) was prepared by connecting pUC18 vector digested with III restriction enzyme with T4 DNA ligase and transforming Escherichia coli according to Meniatis method.

Example 3: Cloning of Valididamycin and Validienamine Biosynthesis Genes

Each of the 200 colonies of the Streptomyces hygroscopicus limoneus small gene library prepared in Example 2 was inoculated with a yellow tip into a 1.5 ml Eppendorf tube containing 700 ml of LBA liquid medium. After incubation in the incubator for one day, the culture was transferred to new Eppendorf tubes by 100 ul. Eventually ten samples were transferred to a single Eppendorff tube and the number of samples transferred to a new tube was reduced from the first 200 to 20. Plasmids were extracted from the collected 20 samples, and PCR reactions were performed using ValC-F and ValC-R primers developed in Example 1 with DNAs of 20 samples. As a result of the PCR reaction, PCR bands of the expected size were identified in each of the 20 samples. The plasmids were extracted from the 20 samples (600 ul) used to prepare the two samples, and each PCR was repeated one by one. The final two recombinant plasmid clones were selected.

Example 4 Gene and Amino Acid Sequencing and Similarity Detection of 8.6kb Fragments Containing 2-epi-5-epi-valiolone synthase Genes in Plasmid Fragments

In this example, since enzymes involved in biosynthesis of bioactive substances are generally present in a certain region of the genome, two plasmid clones containing validamycin biosynthesis gene populations are also inserted into fragments containing 4 kb and 9 kb, respectively. It is expected that most of the enzyme genes involved in the sequencing was requested to TaKaRa Korea Co., Ltd. (TaKaRa Korea) to determine the base sequence of the two plasmids.

In this case, the six genes whose base sequences are determined and the amino acid sequences translated from the base sequences are shown in the sequence list.

And, using the FramePlot 2.3.2 program (ishikawa, J. and Hotta, K. FEMS Microbiol. Lett. 174: 251-253, 1999), the protein coding part was searched based on the primary DNA base sequence results. . Experimental results show that there is an open reading frame encoding proteins in this region.

As a result, the protein named ValA consists of 333 amino acids starting with start codon GTG and ending with stop codon TGA, ValB consists of 430 amino acids starting with ATG and ending with stop codon TGA, and ValC is GTG Consists of 497 amino acids starting with and ending with stop codon TGA, ValD consists of 414 amino acids starting with ATG and ending with stop codon TGA, and ValE consists of 414 amino acids starting with ATG and ending with stop codon TGA. It was found that ValF consists of more than 282 amino acids starting with GTG.

In addition, amino acid homology was searched through the National Institute of Biological Information (NCBI) database (http://www.ncbi.nlm.nih.gov/BLAST/ search box).

At this time, the following e-value (e-value) is the homology between the new sequence and the existing sequence while outputting the nucleotide sequence or amino acid sequence most similar to the new sequence entered through the known base sequence or protein database in order Objectively quantified as eX (X> 0) means e- ^X, which means that the closer it is to 0, the less likely it is to be another protein (the higher the value, the closer to 0).

ValA is the dehydrogenase of Gloeobacter violaceus PCC 7421; Corresponding to the dehydrogenase in the strain genome (AN: BA000045)] and e-value (e-value) was the highest 5e-11, and second, Dehalococcoides ethenogenes 195 alcohol Measured by dehydrogenase (AN: CP000027) and 2e-10, it was shown that all proteins shown in the homology list below are dehydrogenases (not shown).

Therefore, ValA was found to have the activity of dehydrogenase.

ValB is an amine transfer enzyme of Deinococcus radiodurans R1; Corresponding to 4-aminobutyrate aminotransferase at chromosome 2 (AN: AE001862) of the strain.] And e-value (e-value) were the highest as e-59. Second, metanosarcine or maize Go1 (Methanosarcina). As measured by acetyl ornithine amine transferase (AN: AE013224) of mazei Go1) and e-53, it was shown that all proteins shown in the homology list below are amine transferases (not shown).

Therefore, ValB was found to have the activity of the amine transferase.

ValC is the trehalose-phosphate synthase of Streptomyces coelicolor A3 (2) of Streptomyces coelicolor A3 (2); AN: AL939119] and e-value of 4e-37 were the highest, and second, trehalose-6-phosphate synthase [Me: BA000030 of Metanosarsina Majei Go1 (Streptomyces avermitilis MA-4680) ) And 2e-36, all of the proteins shown in the homology list below are represented by trehalose phosphate synthase or trehalose-6-phosphate synthase (not shown).

Thus, it was found that ValC has the activity of trehalose phosphate synthase.

④ ValD is e-16 with DTypiphyto deoxyhexose reductase (AN AF170880) of Streptomyces caeruleus and 2e-16 with Streptomyces rishiriensis (AN AF235050) It can be seen that it has a degree of homology.

⑤ ValE is a vilonone synthase enzyme (2-epi-5-epi) of the mevalonate pathway gene (AN: AB113568) of Actinoplanes sp. A40644, as shown in FIG. 2. -valiolone synthase) and e-value were the highest with e-101. Second, the actinoplanes' acbC (AN: Y18523), 2e-90, and the third e-value were 9e-61. The difference between the first and second values was greater, indicating that the mevalonate pathway gene and acbC were both pariolon synthase (2-epi-5-epi-valiolone synthase).

(6) ValF indicated that the first (AN AL935252) and the second (AN AE004399) were glucose phosphate adenylyltransferases, 6e-27 and 8e-27, respectively.

Thus, ValE demonstrated that it has the activity of violinone synthase.

Fig. 1 shows the position of ValA-ValF in the gene map of the validity of validamycin and the valenamine biosynthetic gene cluster corresponding to 8.6 kb.

Typically, the process of validamycin biosynthesis involves sedoheptulose-7-phosphate derived from the pentose phosphate cycle, cyclization, epimerization, dehadration, Reduction leads to the formation of the seventh sugar, valienone and validone, and the aminotransferase acts on them to produce valienamine and validamine, respectively. It has been reported to biosynthesize validoxylamine, and then to condense a single molecule of glucose by glycosyl transferase to synthesize final validamycin (Junal of American Chemical Society. 123: 2733). -2742, 2001).

Thus, the ValA-ValF demonstrated by the present invention is judged to be a gene cluster involved in the process of validamycin biosynthesis.

Meanwhile, the biosynthetic gene of validamycin has not been reported so far, and only the acarbose biosynthetic gene, which is a diabetic therapeutic agent having an intermediate valenamine structure, has been cloned and studied. The starting material, sedoheptulos-7-phosphate, is also studied. (2-epi-5-epi-valiolone synthase; AcbC, which synthesizes valorone (2-epi-5-epi-valiolone) by cyclization from sedoheptulose-7-phosphate) It has been reported that biosynthetic genes exist in clusters around genes (Ref., Applied Microbiology and Biotechnology. 63: 613-625, 2004).

In addition, the acbC gene has not been reported in general microorganisms, but is known as a special gene related only to valenamine biosynthesis.

Therefore, if the valididacycin biosynthesis related gene cluster of the present invention is applied to industrial use, the ripple effect is expected to be very large due to the industrial value.

As described above, the present invention was isolated from the gene group for biosynthesis of validamycin derived from Streptomyces hygroscopicus var.limoneus KCTC 1717, and dehydrogenase (sequence of 8.6 kb) Dehydrogenase, Aminotransferase, Trehalose-phosphate synthase, DTDP-4-keto-6-deoxyhexose reductase, Ballylon synthase (2 We identified the base sequence of -epi-5- epi-valiolone synthase, the glucose phosphate adenylyltransferase gene, and the sequence of the induced protein. Dehydrogenase ValA among these enzymes, Aminotransferase ValB, dTDP-4-keto-6-deoxyhexose reductase ValD, Ballylon synthase (2- epi-5-epi-valiolone synthase) ValE is an important enzyme commonly involved in valenamine biosynthesis. Therefore, this genetic information is highly valuable because it can be usefully applied for the production of Valididamycin or Balienamine as well as the production of primers and DNA chips for screening bioactive substance producing strains with a Balienamine structure.

<110> DyneBio Inc. <120> Validamycin biosynthesis gene cluster and it's primer <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 8598 <212> DNA <213> Streptomyces hygroscopicus var.limoneus KCTC1717 <220> <221> gene (235) (235). (1236) <223> ValA (R) <220> <221> gene <222> (1233) .. (2525) <223> ValB (R) <220> <221> gene (222) (2531) .. (4024) <223> valC (R) <220> <221> gene (222) (4094) .. (5338) <223> valD (R) <220> <221> gene <222> (6526) .. (7770) <223> valE <220> <221> gene (222) (7748) .. (8596) <223> valF <400> 1 aagcttctcg attcttgtgt tccgagttga ttaatgtgcc gtccaggtcg aaaagtgcaa 60 ccttgtgcat caatcgaacc tcaccattac tctcgcatgg aaacgctgaa ttaggggatc 120 aattcccacc ctccatccgg ccggacggag ggtgaagaag aattgagcgt tcgtggtgcg 180 ggtcgacgcc gttcgtgccg cgacacccag gccgtcggag tcatgggcgt cgcgtcagga 240 gggttcgggg tggacaatga tcttgccggg tcccagggcg tccggggtcc gcagcagtcc 300 gagcaagcct ggcaggtcca cttcagcggc caccagggct tcggcgcgca gaggtgacgc 360 cgcgtcagtg aggtcaccga tcgcggcggc gaaatcctcc gcggtcgtgc cgtagctgcc 420 ggccacatgg agtgagtggc cctgccaggt gcaggcggcg acggtctcgg tgcgccgcac 480 ttgatcgagg tcacattcca gcccggggtg ccggtcacct ggtgcggtgc caccgtagag 540 cagcaccaga ccacctggcg cgaccaggcg tagcgcctcg tccagcacgg tgggcgtcac 600 gaagctggtg gcgaccacca ccacgtcggc cctgtctccg gccagttcac cgaagagcag 660 tgtgggtaca tcgagcaggt ccgccttgcg ggccgcgtcc atccgagcgc ggctccgatt 720 gcagaccgac acctgggcgc ccgcacgctc ggcgagcgcc gcgatgaaga gcccggcggt 780 cccggcaccg agcaccacga cttgtgcacc ccgcaggctg ccgacctgcc tcttgatggc 840 gctcagacag tgctgggcgc aggcgatcgg ctcggcgaag accaggcgac gggcggccgg 900 gccgtgcggt accggttgca gggcgtgccg cagcaggtcg tccgggcccg ccgcccacat 960 gtgatcggcg aacccggtgc cccgctccac cttcacgttc gggtccagga cgacgcgagt 1020 gccttcggcg aacgcagagg tggtggactc gcggacgaca ccgacgagtt cgtgcccgaa 1080 ctggctgggg ccgtgacggg tgccggctac ctccttgagg tcggagcggc acagcgcggc 1140 cagttcgatg ccgacgagta cggcgggatc ttcacgcggg cgcggcggcg gcgagcggtg 1200 cagacgaggc ccgccctcct ccagagtcac tctcacgcga tgccctccag cgcctcgccg 1260 aagcggtcgg cgaccatgtg ggcgtctgcg ggcgtcagga tgagaggggg gcgtagctcg 1320 atcgtgctgc cctctccgtg ctcggagacg cgcgtgagga tgccatggtc ctggagcgac 1380 cgctggtagg cgtgggcgcg ggcgacggcc ttggaaccgt cgggctccac cagttccacc 1440 ccgagcatca gcccgacccc tcggacgtcg ccgatcacgg ggttgtcctt ctggaggtct 1500 cgcagccggc cgaggagcac atcgccgctg gctcgtacgt tctccaggaa gccgggtcgc 1560 tggacgatct ccagcgtggc cagggcggcc gcggccgaca gggtgtggct gccataggtg 1620 aaactgtgca ggctacggtc ccagtcggcc atacgttctt cggtgaggat ggcggccatc 1680 ggaaggccac tgccggtgag tcccttggcg agggtcatca tgtgtggctg cacaccgaag 1740 tggtcggcag cgaacatctg tccagtgcgg cccagcccgg tctggatctc gtcgaagatg 1800 aggacgatct cgcgctcgtc gcagaaccgg cgcagctcct gaaggtaacc ggcgggtggg 1860 acgatgttac cgccggcacc gctgatcggc tcgatcacta cgcaggccac gctgccggag 1920 ctggcatagg tgatgaagtc ctcgatgcgg tcgacacaga gcatcccgca ggtctcggga 1980 gtctggcggt agaagcagcg gaagcagtaa gggcctggca cgtgaaggcc gccgggatag 2040 cggtgcggga agggtgcgcg catcttcgtg gtgccgttga ggctggccgt cgcgaggctc 2100 tgaccgaggt gggcgcggaa cggcacgatg acatcgcggc gaccggtgtg gagctgggcc 2160 atcttgatgg cgccttcgtt ggcggtggag ccaccggagc tgcgcaggtt gacccgcgtg 2220 aggttgggcg ggctgatggc ggccagttct tggatgaccc ggctggtggg ttcggtctgg 2280 aaggacgagc tggcgaagac gagccgctcg gtctgctccc gtacggcggc catcacctct 2340 gggtggttgt gtccgagcag taggttgaag gtgcccgaga cgcagtcgag aaactctcgc 2400 ccctcggcat cccaggcacg gatgccttcg ccgcgcacca gcgtgatatc gccgagctgg 2460 tactgagccg cgtcctgcgg cgcagggagg cgtttcgtcg ttgccataga gcgctccttg 2520 gtcatggcgg tcagaggtct gctcgtgtcg agactgccgg tgcggtgtcg aagcgctcag 2580 cggttgccgt gcgggcggcg tggtccgcag cgagtccgtc cagttgtgcc tgcacccagg 2640 cttcgagcgt ccaggggcgg gcagcgtcgc gacggcgggc agcggcttct gcccgctgcc 2700 gcggcccggc cgcgagcgcg gcggagatgg cctcggcctg ctcgacgagg tcgaaggggt 2760 tgacgctgcg gcagtactcg cccaggacct cggcggcacc gcaggtctcc gaaaggatga 2820 cgtcggcgtc gcgttcgttg accaggggcg cttcgaacgt gctcaggttt tgaccgtcga 2880 cagttgagtt gaagatgagc aggtcggccc ggcggaagca cgcgatggtg tggttcacgt 2940 cgttgtcgtt gtctatgcgc acggtgtcgg agcccagctc ggcgttggct tcggctacgg 3000 cggtctccac ccggtgcacg tagtcggcgt tggccggcac gtacagtcgg ttgggattca 3060 tccgcaccag catgcgggtc ttctccagcc cgccgccccg ggcggccagg acgaaggcgc 3120 gcaccgcacg ttcggcgttc ttgatcgggt cggtgcgccc gctgtgcacc accagccgat 3180 ggccgtccgc ccactcctcg atcccttcgg gcagttgcgg gttgcggccg tcgagggtga 3240 gcgggctgta gccgagcggc atggtgcgca gccgggtgcg gtggccgcgc cactcgacgg 3300 tcatcgcctc gcggtcgatc cgggcgtcgg gcaggagatc ggccacgctt tcgaggaagt 3360 tgcggcacca gcggtcggcg aagaagccga tcgtggtggc ggggagcatg ccgtggagga 3420 tgccggtgcg gatctccttg ggcaggatcc tccagtagtc ggccgacggc cacgggatgt 3480 ggacgaagag caggatcggc gcgtccggcc gctgttcgcg cagcagcgcg gggaccccga 3540 ccagctggta gtcgtggacg aggtagacag ggtctgccga ctgggccgag ctcttgagga 3600 tggcgtcggc gaagtcgcgc gtgaagcggc cgaagtccgc ccagccttcg cgggcgtcgg 3660 agccgaacga cggctgggtc cagcggtccc agccgtagtt gttcgccgcc cacatcaggt 3720 tggcggtcat gaagttctgc acgttgcgga agacagcggg gtcgtgcctg atgagccgga 3780 ccagtatctc ccggccggag tgcagttcca tggtcacgcc gtcagggttg agcgccgaag 3840 cgcgacggtc gtcctcggag tcggcactgg cgatccacga gatgttgagg acgccggcct 3900 gttcggcgac gacgttgccg gtaccgccag gagccagcca ggcgcgcggt tcgccggtgg 3960 cggggtcggt gtcgtaggtg atcgccgcgc gcttgctggc gaggaagatc tcagatccgg 4020 tcacgggtgc cccaatcttg ggttgagggc cggaagcggg ccggccggtg tgggcggact 4080 gtgcgtggtc ggttcagaaa ggtgcgagtg gtgtcaggag atgagggcat gggtggtttc 4140 gaggacgtcg gccgggcggt ggtgttgcag ttcgggcaac tgcgcggcca cctcgctgtg 4200 tagacaggcg ttgcgcggcc ggcaggcgta ggcggtgccg atacgcggcg tcggcacgat 4260 gagcatgggg tccacgccga gctgctcggc gatgtgtctg gcccaagtcg actcggccga 4320 tgcggcgcgg cccgccaagg tgcagcgttc cggtgcggcc ggaactcatc agtgtcgtcg 4380 cccacgcggc cacgtcctcg acgtgaacgg gggtgttcca gtggtcgtcg gggatccgta 4440 gctgctcctt gcgcatcagc gaacgaacca cactggtcag gaaattgggc cgcggaccgc 4500 gatcctccca gccgtagacc aggctcacac gcaggacaag agcggaggag gtgtcgagca 4560 gctcccgctc ggccgcgagc ttcgcccggc cgtaggcgtt gaccgggaag gtctgtgctg 4620 actccccgta gctctcgtcc tcgccggaga aaacgttgtc ggtcgacacc agcaggacgg 4680 ggcggccgtc cagtgcggct gcgatgttgc gggcaccgcc gtggtgggtg gcgtatgcct 4740 cctcgggatg cgactcgcac caagtgatgt cggaggggcc gtgcacggcc acgacggcat 4800 cgggctcgac ggcatccatc aaggcagcca cctgcgggcc cgaggtgaca tcgacctgct 4860 tccagcgcac acctcggctc tcggggagga ctggggcacg ccgggagctg agcactgtct 4920 cggcgccgag ccgggtgagg cgggcggcga tgtgcccggc aaggtagccg gaaccgagga 4980 tcaggatgcg gccaggcacg gcaggcgccg ccgtgcctgg ccggagtacg agtggcgacg 5040 agcgaaggtc agacatgtgt ttcctccggc tgatgtggcg ggctgacatg gcggaaacgt 5100 gtgccgatcg ggtgaacggg cgtccagtgc agtcgcacac gtgggttccc cggccggtgc 5160 cgccgttgag cgcgcctgat ggttcgtgat gccatgccac agtcacgggt gcggtactgg 5220 tgacggcgaa ggttcggcac cggctggatt cggtccgatg ctcgggcggg tcccgtgcgg 5280 cttggcgatg ccggcgaacc tttcggcgaa cgccgggttg cttcgagaat gagaccatat 5340 tgccctcgcg cccaattagg gcgatcggcc gatggccttg tccgtctccg ccgcttcttc 5400 aacagttccg tcgagccgga cgggttatgg cgtgaatccg ctactcgtgg acacgaccgc 5460 aacagcacgg tacggcgacg caggagaccc gtattttgtc gatgccgctc cactcaacgc 5520 cagtgaagcc ggcggcttat tgcggcaggg gctcacgcac ggcccgacgg gccgaaatcc 5580 tgggtacgcc tgggtgattt tatctcaagt cggcgcccga gcagcgatag tgcatgctac 5640 tgccgctctc gcgccaccct tgacggccat tgaatgcatc gatgcgggtc tggcagtgct 5700 gaggaatgtc acagaagtca gcatttccgc tccgagtggt cggcactgcg gagtgtgttc 5760 ctgtgcccag tcaaattcaa accgccacac gtacacaacc agccgggcag cagttgcgcg 5820 cttcaggcac tgcaagagca ttttcatccc cgcgttaccg tgggtgactc atgagcttac 5880 atcttgccca ttacaagcag ctggtaactc attgtcaagt acacggtttt tttggctcga 5940 tcagccctgt ggtgcttcat gtacgcgcac aacctcaatt gacatgccct ctatgacccg 6000 ttttgcaccg cgcatcgacg gccagaaacg gccttggcga cagccgtgat cgagcattcg 6060 cgcacgagac ggacatacgg gactgcatgt cccttgacaa ggtcatgtgc acggacttac 6120 atctacgatc tatagatcac tcaccagtga gtgatccgaa gccgccgagg gattgccgta 6180 ccggcagttc accgcttgac cgcttgacgc aggcgcggcg cgcgaagagc cagatcaggc 6240 agtggcgtcg cgtctgtggc tgaacgcctc catcaccgca atcgaacccc atcttccacc 6300 cgacgccgct gtgccctctc ctgtcacctg ctgtgggacg cacaacgccg ccggctcgcc 6360 accggtcgag ccgccgtcgc gccgtcacct cgtcaccacg accatcgcac gcgcccagtg 6420 cacatgcgag tgacgcaacg cgcgcgccac ggccgtaacc ggtggcntgc tccagcggct 6480 gcctcccccg tccccaccag tgctcctctt caccacgtga ggtcgatgac catgaccaag 6540 cagagttcct tatcccccgg tagccgcctg cacgactaca ccacgcagga cggcgcggcc 6600 tggcgggtga gcgcgctcaa ggaggtgagc tacgacgtca tggtgcagcc gcggctgctc 6660 gatccggcga atccggcgct cgccgacgcc ctctcgtccg ggacgacgcc tgcgcgccgg 6720 ctcatcgtga tagacgctac ggtgcgctcc ctctacggcg agcagcttgc cgcctacctg 6780 gcgggccacg acgtggagtt ccacctgtgc gtcatcgacg cacacgagtc ggcaaaggtc 6840 atggagaccg tcttcgaagt cgtggacgcg atggacgcct tcggtgtgcc acggcgccac 6900 gcaccggtgc tcgccatggg tggcggggtg ctcacggaca tcgtcggtct tgcggcgagc 6960 ctgtaccgca gggccacgcc gtacgtccgc atacccacga ccctgatcgg gatgatcgac 7020 gcgggcatcg gcgccaagac aggtgtcaac ttccgtgagc acaagaatcg gttgggcacg 7080 tatcacccct cctcgctgac cctcatcgat cccggcttcc tcgccacact cgacgcccga 7140 cacctgcgca acggtctggc ggaaatcctg aaggtggccc tggtcaagga tgccgaactg 7200 ttcgatctgc tggaggggca cggcgcgagc ctggtcgagc agcggatgca accgggcgag 7260 ggcgggacgg gcggtgcggc gctcacagtg ctgcgccggg cggtccaggg catgctggag 7320 gagctccagc ccaatctctg ggagcaccag ctgcggcgcc tggtggactt cggccactcc 7380 ttctcaccca gcgtggagat ggcggcgctg cccgagttgc tgcacggtga ggccgtctgc 7440 atcgacatgg cgctcagctc ggtgctcgcc catcaccgtg ggctactgac cgaggccgag 7500 ctcggccgtg tcctcgatgt catgcgtctg ctccacctgc ctgtgctcca cccggtgtgc 7560 acgccggacc tcatgcgcgc ggcgctcgcg gacacggtca aacaccggga cggctggcaa 7620 cacatgcccc ttccacgcgg gatcggcgac gccgtgttcg tgaacgacgt cactcaacgg 7680 gagatcgagg ccgcgcttct cacactcgcc gagcgggacc gggtgccgcg gtggcgggcg 7740 ctgcacggtg ccgtggacat gggggtgtga gcgcatggac ggagtgcgtg ccgtactgct 7800 ggcggggggc gaaggccggc gcatggggcc gctgggacgc ggcaggctca agccgctggt 7860 gccgttcggc ggcacctccc ggctcatcga tttcagcatc gccaacgttc accggtcggg 7920 cctgcgggac gtcctgctgc tgtcgcagta cgaggagcgc cgcctcatgg acgatctgca 7980 cctggtctgg aacgggcgcc accgcggctt ccggatagat ttcggcccct atgacgcggt 8040 gtaccggcgc tcaccgggca agcttcccga gcaactgccg gagcgtatct ggccgttgga 8100 acgcggcaca gccgacgcgc tgctcaccaa ggccgagtac gtcttcaggc agggtgacgc 8160 agaggcctcg gagatcctcg tgctccacgc ggaccacgtc taccgtttcg actacggcga 8220 catgatccgc gagcaccgcg cgtccaaggc cgcgctgaca gtgtcgtacc agcgcatcga 8280 gcggcggtac gtgcaccttt tcggcatggt cgagttcgac ggggacggcc tgctcacagc 8340 gttcgaggan aagcctgacg accccacgag ngacctggtg ttcgccgcct tctgcctctn 8400 nnacncggcg actctgcggc gttacctgga gcaactgcgc ggcanggatt ggcagcacga 8460 catcagcagg gacgtcatcc cggngatgct ggcgggcggc gaactcatcc acgggtatga 8520 ggtcaagagc tactgggagg acatcggcac cgtggaccgc taccaccgcg cccatcgcgg 8580 actgctgcgg ncggatcc 8598 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ValC-F (forword primer) <400> 2 gtacgtccgc atacccacga ccctgatc 28 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ValC-R (reverse primer) <400> 3 catctccacg ctgggtgaga aggagtg 27  

Claims (2)

Validamycin biosynthetic gene cluster comprising all of the ValA to ValF genes represented by SEQ ID NO: 1. delete

Images