CN109790558A

CN109790558A - Method

Info

Publication number: CN109790558A
Application number: CN201780023087.6A
Authority: CN
Inventors: R·科尔曼; B·尼兰
Original assignee: Australian New South Innovation Co Ltd; Bergen Teknologioverforing AS
Current assignee: Australian New South Innovation Co Ltd; Bergen Teknologioverforing AS
Priority date: 2016-02-12
Filing date: 2017-02-10
Publication date: 2019-05-21
Also published as: US10920256B2; MX2018009676A; US20210108239A1; IL261106A; CA3014109A1; EP3414334A1; EP4279577A2; EP3414334C0; GB2552859B; GB2569907A; AU2017218598A1; GB201903649D0; JP2019504650A; AU2017218598B2; GB2552859A; GB201702275D0; WO2017137606A1; GB201602576D0; US11566271B2; EP4279577A3

Abstract

The present invention relates to the methods that N-STX and the like and variant and the intermediate in production N-STX are prepared in recombinant host cell.N-STX and the like and variant can be used for producing pharmaceutical composition.

Description

Method

Technical field

The present invention relates to the preparation methods of N-STX and the like, and generate newly in recombinant host cell The intermediate of saxitoxin.N-STX can be used for producing pharmaceutical composition.

Background technique

Voltage-gated sodium channel (VGSC) is complete memebrane protein, forms ion channel, conducts sodium by cytoplasma membrane Ion (Na⁺).They play an important role in the starting of action potential.

People are early known that the transmitting for blocking these channels to potentially contribute to prevention pain impulses；It sufficiently verifies now VGSC is the target for treating pain.Particularly, currently to study many VGSC in the production of antalgesic and anesthetic short of money Anti-agent.

Both saxitoxin and N-STX are used as the specific inhibition agent of VGSC.Therefore, these compounds It may be useful in treatment pain.Saxitoxin (SXT) is also referred to as paralytic shellfish poisoning (PSP) (PST), is by many indigo plants Algae (such as anabena (Anabaena), Aphanizomenon (Aphanizomenon), quasi- column spore Trentepohlia (Cylindrospermopsis), sheath Ulothrix (Lyngbya), floating Ulothrix (Planktothrix), tip Trentepohlia (Raphidiopsis), Scytonema (Scytonema)) and dinoflagellate (Alexandrium (Alexandrium), unarmored dinoflagellate (Gymnodinium) and pears dinoflagellate (Pyrodinium)) generate neurotoxin.Saxitoxin is hitherto known most fatal One of non-protein neurotoxin, and reversibly combine VGSC to cause to paralyse.It leads to many human foods poisonings, Because having taken in contaminated filter-feeding aquatic animal (such as shellfish, mollusk, shellfish), these animals can be to poison Element carries out bioaccumulation.

However, include N-STX (it is the N1- hydroxylated analog of SXT) there are many SXT analogs, although They have high specific toxicity, but they do not have general toxicity when being applied with low dosage.Therefore they possibly serve for the mankind Therapeutic agent.

In June, 2015, German pharmaceutical quotient Grunenthal and Chile company Proteus S.A. and boston, U.S.A children Hospital cooperation is to develop the Novel anesthetic for using N-STX as local anaesthesia and postoperative pain management.

There is also the markets of other saxitoxin analogs, such as Gonyautoxin (gonyautoxin), have faced Bed test is muscle relaxant.

Proteus S.A. had submitted with from naturally-produced N-STX and saxitoxin cell (such as Cells of Blue-green Algae) production patent application relevant with harvest N-STX and saxitoxin (such as US2015/ 0099879)。

Shimizu etc. be put forward for the first time generate saxitoxin biosynthesis pathway (J.Am.Chem.Soc. (1984), 106,6433–6434).However, until ability first identified saxitoxin (sxt) gene cluster in 2008；This is to intend column in cyanobacteria (Kellmann etc. in spore algae (Cylindrospermopsis raciborskii) T3 Appl.Environ.Microbiol.2008,74,4044–4053).Sxt gene cluster is by 34 genes or open reading frame (ORF) it forms.Theoretical function based on Sxt albumen, this (10 step) for causing the propositions such as Kellmann to be revised is for generating stone room The biosynthesis pathway of clam toxin (referring to Fig. 1 of this paper).

Other four sxt gene clusters are accredited in different categories: curling anabena (Anabaena Circinalis) 131C and Aphanizomenon (Aphanizomenon sp.) NH-5 (BMC such as Mihali Biochem.10,8 (2009))；Sheath silk algae (Lyngbyawollei) (PloS such as Mihali One 6, e14657 (2011))；With tip algae (Raphidiopsis brookii) D9 (PLoS such as Stucken, K. ONE 5, e9235 (2010)).However it is noticeable It is that there are some differences for these gene clusters, including lack certain genes and other Duplications.In addition, the structure of sxt cluster is one It is rearranged in a little genomes, leads to the biosynthesis of saxitoxin analog.This make for generate saxitoxin and Illustrating for the biosynthesis pathway of N-STX is especially difficult, therefore prevents saxitoxin and neolite by recombination approach The generation of Saxitoxin.

In the approach that Kellmann (2008) propose, propose that the first step is related to sxtA gene product.SxtA gene coding Multidomain albumen relevant to polyketide synthase (PKS).Kellmann proposes SxtA catalysis arginine and a methyl Change the condensation of acetate unit to generate 4- amino -3- oxo-guanidine radicals heptane (AOGH) intermediate.It is proposed this method with gradually into Row, and be catalyzed by four structural domains of SxtA.It is said that acetyl coenzyme A is selectively connected to full acyl by transacetylase structural domain In the general acetyl base arm of base load body protein.It is said that the SAM dependence methyl of the acetyl group part by the catalysis of first SxA structural domain Change the formation for leading to propionate.It is said that the final step of AOGH biosynthesis is propionate and arginic condensation, by II class ammonia The catalysis of based transferase structural domain.AOGH is used as the downstream enzyme biosynthesis Saxidomus poison encoded by other members of sxt gene cluster The substrate of element.However, the structure of AOGH is confirmed due to lacking chemical standard.

Although Tsuchiya and its colleague have illustrated route of synthesis (Tsuchiya, S. etc. of AOGH recently Org.Biomol.Chem.12,3016–3020(2014)；The Chem.Eur.J.21,7835-7840 such as Tsuchiya, S. (2015)).There is no the productions that research SxtA or any other Sxt albumen participate in AOGH for the research.The step is Saxidomus poison Committed step in element and N-STX production.

Therefore, it is presently available for preparing unique commercially available height of saxitoxin and N-STX in a word Yield approach is to separate it with its naturally-produced cell (such as cyanobacteria).

Method currently used for producing N-STX cannot be produced newly with manufacturing amount needed for required pharmaceutical composition Saxitoxin.Accordingly, there exist the needs of the method to improved production N-STX.

The biosynthesis pathway for producing N-STX has been illustrated in detail enough now so as to logical Cross recombination approach production N-STX.Particularly, in the 34 sxt genes or ORF of Kellmann (2008) identification, It is identified for producing those necessary to N-STX.

It has now been found that the biosynthesis pathway that Kellmann (2008) is proposed is incorrect, and Kellmann Approach refers to some genes unnecessary for recombinant production N-STX；Kellmann (2008) approach also fails to refer to Sxt gene necessary to some production N-STXs.

Therefore, the present invention provides the recombination approach for producing N-STX and the like, Yi Jiyong for the first time The recombination approach of various intermediates is produced in the production in N-STX and the like.

The present invention additionally aids production saxitoxin and its other analogs, such as Gonyautoxin.

Summary of the invention

In one embodiment, the present invention provides the methods for producing N-STX or its analog, should Method the following steps are included:

(A) following substrate is contacted with SxtA, B, D, G, H, I, S, T, U, V, W and X polypeptide in reaction medium:

(i) S-adenosylmethionine,

(ii) arginine,

(iii) acetyl coenzyme A, malonyl coenzyme A or propionyl coenzyme A, and

(iv) carbamyl phosphate ester

And optionally

(B) N-STX or its analog are separated and/or purified from reaction medium.

Preferably, this method carries out in host cell, and the host cell includes the nucleic acid point for encoding the Sxt polypeptide Son.

The present invention also provides the method for producing saxitoxin or its analog in host cell, this method include with Lower step:

(A) in the presence of following substrate, in the medium culture comprising coding Sxt polypeptide A, B, D, G, H, I, S, T, U, V, the host cell of the nucleic acid molecules of W and X:

(i) S-adenosylmethionine,

(ii) arginine,

(iii) acetyl coenzyme A, malonyl coenzyme A or propionyl coenzyme A, and

(iv) carbamyl phosphate ester

It is preferred that under conditions of being suitble to production N-STX or its analog.Preferably, host cell additionally comprises Encode the nucleic acid molecules of PPT enzyme.

Preferably, this method further include from host cell or culture medium separate and/or purify N-STX or its The step of analog.

As used herein, term " N-STX " refers to the compound having following structure or its stereoisomer:

Host cell can be any cell that can express the nucleic acid molecules for encoding all specific Sxt polypeptides.Host is thin Born of the same parents are preferably recombinant host cell.

As used herein, term " recombination " refers to host cell not the fact that be wild-type host cells, such as they are Nucleic acid molecules by introducing one or more one or more specific Sxt polypeptides of coding are modified.

Host cell can be prokaryotic cell or eukaryocyte.For example, host cell can be bacterial cell.Bacterium can be with It is Gram-positive or gramnegative bacterium.Gram-positive bacterium can selected from by actinomyces (Actinobacteria), The group of Firmicutes (Firmicutes) and soft film bacterium door (Tenericutes) composition.Gramnegative bacterium can selected from by Produce water bacterium door (Aquificae), Bacteroidetes/cellulomonas door-green bacterium door (Bacteroidetes/Fibrobacteres- Chlorobi) (FCB group), abnormal cocci-Thermus door (Deinococcus-Thermus), Fusobacterium door (Fusobacteria), bud monad door (Gemmatimonadetes), nitrification spirillum door (Nitrospirae), floating mould Door-wart germ door/Chlamydia door (Planctomycetes-Verrucomicrobia/Chlamydiae) (PVC group), mycetozoan The group of door (Proteobacteria), conveyor screw door (Spirochaetes) and mutual bacteria door (Synergistetes) composition.

Preferably, host cell is bacteriode door (Phylum Proteobacteria)；More preferably γ-mycetozoan Class (Gammaproteobacteria)；More preferably enterobacteria (Enterobacteriaceae) section；It is even more preferably angstrom uncommon Salmonella (Escherichia) belongs to.Most preferably, host cell is Escherichia coli (E.coli) kind.In some embodiments, place Chief cell is that pseudomonad (Pseudomonas) belongs to.

Also eukaryocyte, such as yeast cells and mammalian cell can be used.Since N-STX is to many Eukaryocyte is toxic, therefore eukaryotic host cell is preferably the host cell insensitive to N-STX toxicity.These are thin Born of the same parents, which can be natural not susceptible (such as yeast cells) or they, can be engineered to that not susceptible (such as coexpression is new The mammalian cell of saxitoxin antagonist).

Alternatively, host cell can be the host cell for not secreting N-STX, that is, any new Saxidomus generated Toxin retains in the cell (thus preventing it from playing its toxic effect).Host cell is also possible to plant cell.

In some embodiments, host cell is heterotrophic organism.Host cell can be photoheterotroph or chemistry Heterotrophic organism.Heterotrophic organism is a kind of biology for being unable to fixed carbon and being grown using organic carbon.Heterotrophic organism can be based on them How to obtain energy and further division: if heterotrophic organism utilizes laser energy supply, it is exactly photoheterotroph；If different Health object uses chemical energy, then it is exactly chemoheterotroph.In some embodiments, host cell is not from health Object.Autotroph can be photoautotroph or chemoautotroph.

N-STX is spontaneous by several marine dinoflagellates and Fresh Watcr Blue Algae.The present invention is not related to by this open country The raw naturally-produced N-STX of type host cell species.Therefore, in certain embodiments of the present invention, host cell is not It is dinoflagellate or cyanobacteria.

Particularly, host cell, which is not preferably selected from, intends column spore algae (Cylindrospermopsis by cyanobacteria Raciborskii), aphanizomenon flos aquae (Anphanizomenon flos-aquae), synnema algae (APh) are according to husky synnema algae (Aphanizomenon) (APh), (issatschenkoi (usaceb) Proskina-Lavrenco), soft and fine synnema algae (Aphanizomenon gracile (Lemm) Lemm), curling anabena (Anabaena circinalis), sheath silk algae The group of (Lyngbya wollei) and Alexandrium tamarense (Alexandrium tamarens) composition.

Particularly, host cell preferably selected from by anabena (Anabaena), Aphanizomenon (Aphanizomenon), Quasi- column spore Trentepohlia (Cylindrospermopsis), sheath Ulothrix (Lyngbya), floating Ulothrix (Planktothrix), tip Trentepohlia (Raphidiopsis), Scytonema (Scytonema) and dinoflagellate (Alexandrium (Alexandrium), unarmored dinoflagellate (Gymnodinium) and pears dinoflagellate (Pyrodinium)) composition group.

However, host cell can be recombination dinoflagellate or recombined blue algae, such as compared with wild type dinoflagellate or cyanobacteria The dinoflagellate being modified or cyanobacteria (such as by adding one or more genes, preferably passing through addition one or more sxt gene). Host cell includes and/or expression encodes the nucleic acid molecules of specific Sxt albumen.

Preferably, Sxt polypeptide and sxt gene are obtained from cyanobacteria or dinoflagellate.It is highly preferred that Sxt polypeptide and sxt gene are obtained from fish Raw meat algae (Anabaena), Aphanizomenon (Aphanizomenon) intend column spore Trentepohlia (Cylindrospermopsis), sheath silk algae Belong to (Lyngbya), floats Ulothrix (Planktothrix), tip Trentepohlia (Raphidiopsis), Scytonema (Scytonema), Alexandrium (Alexandrium), unarmored dinoflagellate (Gymnodinium) or pears dinoflagellate (Pyrodinium). Even further preferably, Sxt polypeptide and sxt gene, which are obtained from cyanobacteria, intends column spore algae (Cylindrospermopsis Raciborskii), aphanizomenon flos aquae (Anphanizomenon flos-aquae), synnema algae (APh) is according to husky synnema algae (Aphanizomenon) (APh), (issatschenkoi (usaceb) Proskina-Lavrenco), soft and fine synnema algae (Aphanizomenon gracile (Lemm) Lemm) is crimped anabena (Anabaena circinalis), sheath silk algae (Lyngbya wollei) or Alexandrium tamarense (Alexandrium tamarens).Most preferably, Sxt polypeptide and sxt Gene is obtained from cyanobacteria and intends column spore algae (C.raciborskii) T3 bacterial strain.In some embodiments, Sxt polypeptide and sxt gene can To be obtained from long spore anabena (Dolichosporum circinale) 134C or Alexandrium mimutum Halim (A.minutum).

The nucleic acid molecules for encoding specific Sxt albumen can be heterologous molecule, i.e., does not deposit naturally in wild-type host cells Molecule.

As used herein, term SxtA preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:10 or Have the function of at least 50% amino acid sequence identity with it and there is the polyketide synthase GAP-associated protein GAP containing four catalyst structure domains Sequence: sxtA1: transmethylase；SxtA2:GNAT transacetylase；SxtA3: acyl carrier protein and sxtA4:II class ammonia Based transferase.

As used herein, term sxtA preferably refers to the core with the nucleotide sequence provided in SEQ ID NO:11 or 12 Acid molecule has at least 50% nucleotide sequence homology to it and encodes related containing the polyketide synthase of four catalyst structure domains The sequence of albumen: sxtA1: transmethylase；SxtA2:GNAT transacetylase；SxtA3: acyl carrier protein and sxtA4:II Class aminopherase.

As used herein, term SxtB preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:7 or With it at least 50% amino acid sequence identity and with the sequence of cytidine deaminase function.

As used herein, term sxtB preferably refers to the nucleic acid with the nucleotide sequence provided in SEQ ID NO:8 or 9 Molecule has at least 50% nucleotide sequence homology with it and encodes the sequence of cytidine deaminase.SxtB polypeptide can also energy Enough cyclisation.

As used herein, term SxtC preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:4 or There is at least 50% amino acid sequence identity with it and encode the sequence of adjusting subunit.As used herein, term SxtC is preferred Refer to the nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:5 or 6 or there is at least 50% nucleotides sequence with it Column identity simultaneously encodes the sequence for adjusting subunit.SxtC polypeptide can also being capable of decarbamylation.

As used herein, term SxtD preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:1 or With it at least 50% amino acid sequence identity and with the sequence of desaturase function.As used herein, term sxtD It is preferred that referring to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:2 or 3 or there is at least 50% nucleosides with it Acid sequence identity and the sequence for encoding desaturase.

As used herein, term SxtE preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:13 or With it at least 50% amino acid sequence identity and with the sequence of companion's sample protein function.As used herein, term SxtE preferably refers to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:14 or 15 or has at least with it 50% nucleotide sequence homology and the sequence for encoding companion's sample albumen.

As used herein, term SxtF preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:16 or The sequence of protein function is squeezed out with it at least 50% amino acid sequence identity and with sodium driving multiple medicine and toxic chemical Column.As used herein, term sxtF preferably refers to the nucleic acid with the nucleotide sequence provided in SEQ ID NO:17 or 18 point Son has at least 50% nucleotide sequence homology with it and encodes the sequence of sodium driving multiple medicine and toxic chemical extrusion albumen Column.

As used herein, term SxtG preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:19 or With it at least 50% amino acid sequence identity and with the sequence of amidinotransferase function.As used herein, term SxtG preferably refers to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:20 or 21 or has at least with it 50% nucleotide sequence homology and the sequence for encoding amidinotransferase.

As used herein, term SxtH preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:22 or With it at least 50% amino acid sequence identity and with the sequence of dioxygenase function.As used herein, term sxtH It is preferred that referring to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:23 or 24 or there is at least 50% core with it Nucleotide sequence identity and the sequence for encoding dioxygenase.SxtH polypeptide can also being capable of C12 hydroxylating.

As used herein, term SxtI preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:25 or With it at least 50% amino acid sequence identity and with the sequence of O- carbamyl based transferase function.Such as this paper institute Preferably refer to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:26 or 27 with, term sxtI or has with it At least 50% nucleotide sequence homology and the sequence for encoding O- carbamyl based transferase.

As used herein, term SxtJ preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:28 or There is the sequence of at least 50% amino acid sequence identity with it.As used herein, term sxtJ preferably refers to SEQ ID The nucleic acid molecules of the nucleotide sequence provided in NO:29 or 30 or the sequence with it at least 50% nucleotide sequence homology Column.

As used herein, term SxtK preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:31 or There is the sequence of at least 50% amino acid sequence identity with it.As used herein, term sxtK preferably refers to SEQ ID The nucleic acid molecules of the nucleotide sequence provided in NO:32 or 33 or the sequence with it at least 50% nucleotide sequence homology Column.SxtJ and sxtK is usually related to O- carbamyl based transferase.They, which can be, adjusts subunit and/or mediation SxtI and its The combination of its albumen or film.

As used herein, term SxtL preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:34 or With it at least 50% amino acid sequence identity and with the sequence of GDSL- lipase function.As used herein, term SxtL preferably refers to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:35 or 36 or has at least with it 50% nucleotide sequence homology and the sequence for encoding GDSL- lipase.SxtL polypeptide can also being capable of decarbamylation.

As used herein, term SxtM preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:37 or Protein function is squeezed out with it at least 50% amino acid sequence identity and with sodium driving multiple medicine and toxic chemical Sequence.As used herein, term sxtM preferably refers to the nucleic acid with the nucleotide sequence provided in SEQ ID NO:38 or 39 Molecule has at least 50% nucleotide sequence homology with it and encodes sodium driving multiple medicine and toxic chemical squeezes out albumen Sequence.

As used herein, term SxtN preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:40 or With it at least 50% amino acid sequence identity and with the sequence of sulfotransferase function.As used herein, term SxtN preferably refers to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:41 or has at least 50% core with it The sequence of nucleotide sequence identity and encoding sulfotransferase.

As used herein, term SxtO preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:72 or With it at least 50% amino acid sequence identity and with the sequence of adenylylsulfate kinase function.As used herein, art Language sxtO preferably refers to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:73 or has at least 50% with it Nucleotide sequence homology and the sequence for encoding adenylylsulfate kinase.SxtO polypeptide can also being capable of PAPS biosynthesis.

As used herein, term SxtP preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:69 or With the sequence of its saxitoxin binding protein function at least 50% amino acid sequence identity and with presumption.Such as this Used in text, term sxtP preferably refer to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:70 or 71 or and its With at least 50% nucleotide sequence homology and encode the protein-bonded sequence of saxitoxin of presumption.

As used herein, term SxtQ preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:66 or There is the sequence of at least 50% amino acid sequence identity with it.As used herein, term sxtQ preferably refers to SEQ ID The nucleic acid molecules of the nucleotide sequence provided in NO:67 or 68 or the sequence with it at least 50% nucleotide sequence homology Column.

As used herein, term SxtR preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:63 or With it at least 50% amino acid sequence identity and with the sequence of acyl-CoA N- acyltransferase function.As herein Used, term sxtR preferably refers to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:64 or 65 or has with it There is the sequence of at least 50% nucleotide sequence homology and encoding acyl coacetylase N- acyltransferase.

As used herein, term SxtS preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:57 or There is at least 50% amino acid sequence identity with it and be capable of the sequence of epoxidation and ring formation N-STX precursor. As used herein, term sxtS preferably refer to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:58 or 59 or There is at least 50% nucleotide sequence homology with it and be capable of the sequence of epoxidation and ring formation N-STX precursor.

As used herein, term SxtT preferably refer to polypeptide with the amino acid sequence provided in SEQ ID N:54 or There is at least 50% amino acid sequence identity with it and the hydroxylated sequence of N-STX precursor C-11 can be made.Such as It is used herein, term sxtT preferably refer to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:55 or 56 or with It has at least 50% nucleotide sequence homology and can make the hydroxylated sequence of N-STX precursor C-11.

As used herein, term SxtU preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:51 or With it at least 50% amino acid sequence identity and with the sequence of short-chain alcohol dehydrogenase function.As used herein, term SxtU preferably refers to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:52 or 53 or has at least with it The sequence of 50% nucleotide sequence homology and encoding short-chain alcohol dehydrogenase.SxtU polypeptide can also can C1 reduction.

As used herein, term SxtV preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:48 or Have the function of at least 50% amino acid sequence identity with it and there is FAD dependence succinate dehydrogenase/fumaric reductase Sequence.As used herein, term sxtV preferably refers to the core with the nucleotide sequence provided in SEQ ID NO:49 or 50 Acid molecule has at least 50% nucleotide sequence homology with it and encodes FAD dependence succinate dehydrogenase/fumaric acid also The sequence of protoenzyme.SxtV polypeptide can also encode dioxygenase reductase.

As used herein, term SxtW preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:45 or With it at least 50% amino acid sequence identity and with the sequence of ferredoxin function.As used herein, term SxtW preferably refers to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:46 or 47 or has at least with it The sequence of 50% nucleotide sequence homology and encoding ferredoxin.SxtW polypeptide can also be with coded electronic carrier.

As used herein, term SxtX preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:42 or There is at least 50% amino acid sequence identity with it and the hydroxylated sequence of N-STX N-1 can be made.As herein Used, term sxtX preferably refers to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:43 or 44 or has with it There is at least 50% nucleotide sequence homology and the hydroxylated sequence of N-STX N-1 can be made.

As used herein, term SxtY preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:74 or The sequence of subfunction is adjusted with it at least 50% amino acid sequence identity and with phosphoric acid dependent transcription.Such as this paper institute Preferably refer to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:75 with, term sxtY or has at least with it 50% nucleotide sequence homology and the sequence for encoding phosphoric acid dependent transcription regulator.SxtY polypeptide can also can signal turn It leads.

As used herein, term SxtZ preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:76 or With it at least 50% amino acid sequence identity and with the sequence of histidine kinase function.As used herein, term SxtZ preferably refers to nucleic acid molecules with the nucleotide sequence provided in SEQ ID NO:77 or has at least 50% core with it The sequence of nucleotide sequence identity and encoding histidine kinases.

The function and ability of some sxt genes further illustrate in Fig. 2, Fig. 3, Fig. 4 A, Fig. 4 B, in which it can be seen that one A bit intermediate X can be converted to intermediate Y (the wherein structure that X and Y is determining intermediate).

As used herein, term ORF5 preferably refer to polypeptide with the amino acid sequence provided in SEQ ID NO:60 or With it at least 50% amino acid sequence identity and with the sequence of cyanophage S-PM2 PROTEIN C AF34141 sample protein function Column.ORF5 is also referred to as ORF24 in the art.As used herein, term orf5 preferably refers to SEQ ID NO:61 or 62 In the nucleic acid molecules of nucleotide sequence that provide or there is at least 50% nucleotide sequence homology and encode with it bite algae phagocytosis The sequence of body S-PM2 PROTEIN C AF34141 sample albumen.

Preferably, host cell, which is additionally comprised and/or expressed, encodes 4'-phosphopantetheine based transferase (PPT Enzyme) nucleic acid molecules.As used herein, term PPT enzyme preferably refers to the amino acid provided in SEQ ID NO:78 or 90 The polypeptide of sequence at least 50% amino acid sequence identity and has Phosphopantetheinyl transferase function with it The sequence of energy.As used herein, term PPT enzyme gene preferably refers to the nucleosides provided in SEQ ID NO:79,80 or 89 The nucleic acid molecules of acid sequence have at least 50% nucleotide sequence homology with it and encode phosphopantetheine base turn Move the sequence of enzyme.Preferably, PPT enzyme is encoded by bacillus subtilis sfp gene (SEQ ID NO:89).Most preferably, PPT enzyme Intend column spore algae (C.raciborskii) T3 bacterial strain from cyanobacteria.In some embodiments, first 20 of PPT enzyme can be removed The 1-20 (such as 20) of amino acid is to increase the solubility of PPT enzyme.Furthermore it is possible to which first V in amino acid sequence is changed For M.

Preferably, the nucleotide sequence of nucleic acid molecules carries out codon optimization for host cell.

Sxt polypeptide, ORF and PPT enzyme are preferably defined herein as the ammonia for having at least 50% with reference amino acid sequence Base acid sequence identity.Preferably, Sxt, ORF and PPT enzyme polypeptide and specific reference polypeptide have at least 60%, 70%, 80%, 90%, 95%, 98% or 99% amino acid sequence identity.Sxt nucleic acid molecules, orf and PPT enzymatic nucleic acid molecule exist The nucleotide sequence homology preferred herein for being defined as having at least 50% with reference nucleotide sequence.Preferably, sxt, orf With PPT enzymatic nucleic acid molecule and specific reference nucleic acid molecule have at least 60%, 70%, 80%, 90%, 95%, 98% or 99% nucleotide sequence homology.

Nucleic acid molecules can be DNA or RNA.It is same that percent amino acid sequence can be obtained using BLAST comparison method Property and nucleotide sequence homology (Altschul etc. (1997), " Gapped BLAST and PSI-BLAST:a new generation of protein database search programs",Nucleic Acids Res.25:3389- 3402；and http://www.ncbi.nlm.nih.gov/BLAST).Preferably, using standard or default alignment parameters.Mark Quasi- protein-protein BLAST (blastp) can be used for finding similar sequence in albumen database.With other blast programs Equally, blastp is intended to find similar regional area.When sequence similarity crosses over entire sequence, blastp will also report complete Office compares, this is the preferred result of Identification of Fusion Protein purpose.Preferably, using standard or default alignment parameters.In some cases, " low complex degree filter " can be cancelled.BLAST protein searches can also be carried out with BLASTX program, score=50, and word length= 3.It is compared to obtain vacancy for comparative purposes, it can such as Altschul (1997) Nucleic Acids Res.25: 3389 uses Gapped BLAST (in BLAST 2.0).Alternatively, PSI-BLAST (in BLAST 2.0) can be used for holding The iterative search (ibid referring to Altschul etc. (1997)) of remote relationship between row detection molecules.When using BLAST, When Gapped BLAST, PSI-BLAST, the default parameters of each program can be used.About nucleotide sequence comparison, can make The target is realized with MEGABLAST, discontinuous megablast and blastn.Preferably, ginseng is compared using standard or default Number.MEGABLAST is specially designed for effectively finding the long alignment between closely similar sequence.Discontinuous MEGABLAST It can be used for finding nucleotide sequence similar but different to nucleic acid of the invention.BLAST nucleotide algorithm will be by that will inquire The short subsequence of referred to as word is decomposed into find similar sequence.The program identifies that (word is ordered with the accurate match of query word first In).Then, blast program extends the hit of these words with multiple steps and is compared with generating final vacancy.In some embodiments In, BLAST nucleotide search can be carried out with BLASTN program, score=100, word length=12.Control blast search sensitivity Important parameter first is that word size.More sensitive most important of blastn ratio MEGABLAST is the reason is that it uses shorter default Word size (11).Therefore, blastn is better than in terms of finding the comparison with the related nucleotide sequences of other biologies MEGABLAST.Word size can adjust in blastn, and can be reduced to minimum value 7 from default value to improve search spirit Sensitivity.By using the discontinuous megablast page (www.ncbi.nlm.nih.gov/Web/Newsltr/ newly introduced FallWinter02/blastlab.html it) may be implemented more sensitively to search for.The algorithm that the page uses is similar to the report such as Ma Algorithm (the Bioinformatics.2002Mar in road；18(3):440-5).Expand compared to requiring accurate word matching to be used as to compare The origin of exhibition, discontinuous megablast use discrete word in longer template window.In coding mode, pass through It concentrates on the discovery matching at the first and second codon positions and ignores the mispairing in the third place to consider that third basis is put It is dynamic.It is searched in discontinuous MEGABLAST than using the standard blastn of same words size quicker using identical word size Feel and effective.The discontinuous unique parameter of megablast is: word size: 11 or 12；Template: 16,18 or 21；Template type: Encode (0), non-coding (1) or both (2).

The Sxt polypeptide sequence that cyanobacteria intends column spore algae (Cylindrospermopsis raciborskii) T3sxt gene can To obtain (http://www.ncbi.nlm.nih.gov/nuccore/ at registration number DQ787200 from GenBank DQ787200).The amino acid sequence that cyanobacteria intends column spore algae (Cylindrospermopsis raciborskii) T3Sxt polypeptide exists It is provided in annex " sequence " part of this paper.However, the present invention is not limited to the sequences of those polypeptides；The present invention covers from other The polypeptide of species has identical as quasi- column spore algae (Cylindrospermopsis raciborskii) the T3 polypeptide of the cyanobacteria Function.

In the method for the invention, make that substrate is contacted with Sxt polypeptide A, B, D, G, H, I, S, T, U, V, W and X or host is thin Born of the same parents include the nucleic acid molecules of one or more such polypeptides of coding.In certain embodiments of the present invention, substrate is not more with Sxt One of peptide A, B, D, G, H, I, S, T, U, V, W and X or a variety of contacts or host cell do not include one or more codings this The nucleic acid molecules of class polypeptide.In some embodiments of the method for the present invention, it can be used or without using the such polypeptide of coding Other Sxt polypeptides or nucleic acid molecules.

If method of the invention uses specific Sxt polypeptide really, substrate will be contacted with the Sxt polypeptide and/or place Chief cell is by the nucleic acid molecules comprising encoding this polypeptide.If method of the invention does not use specific Sxt polypeptide, substrate It will not be contacted with the Sxt polypeptide and/or host cell will not include the nucleic acid molecules for encoding this polypeptide.

In some embodiments, method of the invention can in addition with or without the use of independently selected from by Sxt C, E, J, one of group of K, L and R composition or a variety of Sxt polypeptides, or the nucleic acid molecules of the such polypeptide of coding.Preferably, of the invention Method in addition using selected from by one of Sxt C, E, J, K, L and R (preferably C and/or E) group formed or a variety of Sxt it is more Peptide, or the nucleic acid molecules of the such polypeptide of coding.

In some embodiments, in addition method of the invention uses Sxt E or the such polypeptide of coding nucleic acid molecules.? In other embodiment, in addition method of the invention does not use the nucleic acid molecules of Sxt E or this polypeptide of coding.

In some embodiments, method of the invention can be used or without using Sxt Q polypeptide or this polypeptide of coding Nucleic acid molecules.

In some embodiments, method of the invention can be used or without using Sxt R polypeptide or this polypeptide of coding Nucleic acid molecules.

In some embodiments, method of the invention can be used or without using ORF24 polypeptide or this polypeptide of coding Nucleic acid molecules.

In other embodiments, method of the invention can be used or without using independently selected from by Sxt F, M, N, O, P, one of group of Y, Z, ORF3, ORF4, ORF29, ORF34, OMPR or HISA composition or a variety of Sxt polypeptides, or encode this The nucleic acid molecules of class polypeptide.Preferably, method of the invention do not use selected from by Sxt F, M, N, O, P, Y, Z, ORF3, ORF4, One of group of ORF29, ORF34, OMPR or HISA composition or a variety of Sxt polypeptides, or the nucleic acid molecules of the such polypeptide of coding.

In certain embodiments of the present invention, method of the invention can be used or without using independently selected from by following One of group of composition or a variety of Sxt polypeptides (or nucleic acid molecules of the such polypeptide of coding):

It is special to prepare the sheath silk algae (Lyngbya wollei) of saxitoxin (LWTX-1 to -6) to need Sxt ACT Anisotropic " weird " analog.They carry methyl-acetyl ester side chain rather than carbamyl base side chain.

May need Sxt DIOX and Sxt SUL to prepare C-11 sulphation toxin analog, for example, Gonyautoxin 1 to 4 and C-1 is to C-4 toxin.

SxtN1 and SxtN2 may be needed to prepare various N- sulfocarbamoyl analogs (C- toxin).From cyanobacteria The SxtN of quasi- column spore algae (C.raciborskii) T3 may due to catalytic site mutation and inactivate.

In other embodiments, method of the invention can be used or without using independently selected from by ORF24, P and Q group At one of group or a variety of Sxt polypeptides, or nucleic acid molecules of the such polypeptide of coding.Preferably, method of the invention does not make With selected from one or more Sxt polypeptides by ORF24, P and Q group formed, or the nucleic acid molecules of the such polypeptide of coding.

Host cell of the invention can be used standard molecular biological technique (such as Green&Sambrook, " Molecular Cloning:A Laboratory Manual ", Fourth Edition, 2012) and with reference to disclosed herein Embodiment produces.

The coded sequence of every kind of particular polypeptide will be operably associated with suitable regulating element, and the regulating element helps In generating specific polypeptide in host cell.For example, each coded sequence will with suitable promoter and terminate subcomponent can It is operatively connected.Preferably, these regulating elements are optimized for host cell.For example, if host cell is Escherichia coli, Then it is preferable to use Escherichia coli regulating element (such as promoter, terminator, ribosome binding sequences).

One or more nucleic acid molecules can be integrated into the genome of host cell.One or more nucleic acid molecules can It is present in host cell by the form of plasmid or carrier.Preferably, all specific nucleic acids are all integrated into the base of host cell Because in group.It can will be in the sugared operon in one or more specific nucleic acid Insertion Into Host Cell genomes.

Nucleic acid molecules can exist in the form of operon or gene cluster segment, that is, encode more than one required polypeptide. These can independently be transformed into host cell.For example, the first nucleic acid molecules may include coding sxtA, sxtB and sxtC's Open reading frame；Second nucleic acid molecules may include coding sxtD, sxtE, sxtG, sxtH, sxtI, sxtJ, sxtK and sxtL's Open reading frame；Third nucleic acid molecules may include coding sxtQ, sxtR, orf24, sxtS, sxtT, sxtU, sxtV, sxtW and The open reading frame of sxtX；And/or the 4th nucleic acid molecules may include coding sxtF, sxtP and sxtM open reading frame.? In some embodiments, third nucleic acid molecules may include coding sxtQ, sxtR, sxtS, sxtT, sxtU, sxtV, sxtW and sxtX；Or the open reading frame of sxtS, sxtT, sxtU, sxtV, sxtW and sxtX.

Nucleic acid molecules can also include suitable selected marker (such as gene of coding antibiotic resistance).Nucleic acid molecules are also It may include other control elements, so that the expression of one or more polypeptides is derivable.In some preferred embodiments In, the expression of SxtA is derivable.

In certain embodiments of the present invention, the nucleic acid of one or more nucleic acid molecules or encoding function equivalent polypeptide point Son may endogenously be present in host cell (in host cell gene group or in indigenous plasmid).

The present invention also extends to all host cells as defined herein.Particularly, the present invention provides host cell, Comprising encoding the core independently selected from one of group being made of A, B, D, G, H, I, S, T, U, V, W and X or a variety of Sxt polypeptides Acid molecule.Host cell can additionally comprise or not comprising coding independently selected from being made of Sxt C, E, J, K, L and/or R The nucleic acid molecules of one of group or a variety of Sxt polypeptides.Host cell can additionally comprise or the nucleic acid not comprising coding Sxt Q Molecule.

Host cell can additionally comprise or do not include coding independently selected from by Sxt F, M, N, O, P, Y, Z, ORF3, One or more cores of a variety of or all Sxt polypeptides of one of the group of ORF4, ORF29, ORF34, OMPR or HISA composition Acid molecule.Preferably, host cell do not include coding selected from by Sxt F, M, N, O, P, Y, Z, ORF3, ORF4, ORF29, The nucleic acid molecules of a variety of or all Sxt polypeptides of one of the group of ORF34, OMPR or HISA composition.

Reaction medium and culture medium provide suitable condition for production N-STX or its analog.Condition will be wrapped also Suitable pH and temperature are included, this can be readily determined by technical staff.It is being suitable for production N-STX or its analog Under conditions of cultivate host cell in the medium.Suitable culture medium is well known in the art.These will be according to being used Host cell selected.Preferably, culture medium will be aqueous medium.

Starting material for producing N-STX or its analog or variant is:

(i) S-adenosylmethionine,

(ii) arginine,

(iii) acetyl coenzyme A, malonyl coenzyme A or propionyl coenzyme A, and

(iv) carbamyl phosphate ester.

Therefore, when this method starts, need to obtain the above-mentioned substrate of suitable concentration in reaction medium and culture medium.This Field technical staff can readily determine that the above-mentioned substrate of suitable concentration.It can be by arginine easily from the culture medium of surrounding It is middle to take in as substrate into host cell.Other substrate (i.e. S-adenosylmethionine, acetyl coenzyme A, malonyl coenzyme A, third Acyl coenzyme A and carbamyl phosphate ester) it is unstable.Preferably, these substrates are produced with enough amounts in host cell (they are present in all living cells).Increase in such a way that this field is conventional if desired, host cell can be modified easily Add the yield of these substrates.

In certain embodiments of the present invention, this method is carried out in 14-24 DEG C of temperature；It is preferred that being carried out at 16-22 DEG C； Even preferably carried out at about 17,18,19,20 or 21 DEG C；Most preferably carried out at about 19 DEG C.

Preferably, N-STX is separated and/or purified from reaction or culture medium.This separation/purifying can lead to Any suitable method is crossed to carry out.

In embodiments of the present invention, wherein the method carries out in host cell, and N-STX will be in place It is produced in chief cell.Therefore host cell can be separated with culture medium (such as by filtering or being centrifuged)；Then it can crack Host cell；With harvest N-STX.

Can be separated from reaction or culture medium by the Solid Phase Extraction on C-18 reversed-phase resin N-STX with Remove hydrophobic compound；N-STX will occur with flow type (flow-through).Also it can be used in active carbon On using cation exchange resin Solid Phase Extraction.For further purification technique, US2015/0099879 can be referred to.

The present invention also provides the methods of the production such as various intermediates of undefined N-STX.These methods can To be carried out in cell-free medium or in the host cell of the nucleic acid molecules comprising encoding suitable Sxt polypeptide.

In other embodiments, the present invention provides the methods of production compound of formula I [intermediate 4]:

Wherein, R is OH, method includes the following steps:

(A) Formula II compound [intermediate 3] and Sxt S and optional α-ketoglutaric acid and optional molecular oxygen are connect Touching,

Wherein R is OH；And (B) isolated or purified compound of formula I from reaction medium.

The present invention also provides the methods of production compound of formula I [intermediate 4]:

Wherein R is OH, method includes the following steps:

(A) under conditions of to produce Sxt S and Formula II compound is converted compound of formula I by Sxt S, in Formula II Culture includes the host cell of the nucleic acid molecules of coding Sxt S in the medium in the presence of compound (intermediate 3):

Wherein R is OH.

In other embodiments, the present invention provides the methods of production compound of formula I [intermediate 4']:

Wherein R is OH, method includes the following steps:

The present invention also provides the methods of production compound of formula I [intermediate 4']:

Wherein R is OH, method includes the following steps:

Wherein R is OH.

In other embodiments, the present invention provides the methods of production compound of formula I [intermediate 5]:

Wherein R is OH, method includes the following steps:

(A) Formula II compound [intermediate 4] and Sxt D and optional NADH and optional NADPH are contacted:

Wherein R is OH；And

(B) the isolated or purified compound of formula I from reaction medium.

The present invention also provides the methods of production compound of formula I [intermediate 5]:

Wherein R is OH, method includes the following steps:

(A) under conditions of to produce Sxt D and Sxt D converts Formula II compound to the compound of Formulas I, in formula Culture includes the host cell of the nucleic acid molecules of coding Sxt D in the medium in the presence of II compound [intermediate 4]:

Wherein R is OH.

In other embodiments, the present invention provides the methods of production compound of formula I [intermediate 5']:

Wherein R is OH, method includes the following steps:

(A) Formula II compound [intermediate 4'] and Sxt D and optional NADH and optional NADPH are contacted:

Wherein R is OH；And

(B) the isolated or purified compound of formula I from reaction medium.

The present invention also provides the methods of production compound of formula I [intermediate 5']:

Wherein R is OH, method includes the following steps:

(A) under conditions of to produce Sxt D and Formula II compound is converted compound of formula I by Sxt D, in Formula II Culture includes the host cell of the nucleic acid molecules of coding Sxt D in the medium in the presence of compound [intermediate 4']:

Wherein R is OH.

In other embodiments, the present invention provides production compound of formula I [intermediate 6] method,

Wherein R is OH, method includes the following steps:

(A) Formula II compound [intermediate 5] and Sxt S and optional α-ketoglutaric acid and optional molecular oxygen are connect Touching:

The present invention also provides the methods of production compound of formula I [intermediate 6]:

Wherein R is OH, method includes the following steps:

(A) under conditions of to produce Sxt S and Formula II compound is converted compound of formula I by Sxt S, in Formula II Culture includes the host cell of the nucleic acid molecules of coding Sxt S in the medium in the presence of compound [intermediate 5]:

Wherein R is OH.

In other embodiments, the present invention provides the methods of production compound of formula I [intermediate 6']:

Wherein R is OH, method includes the following steps:

(A) make Formula II compound [intermediate 5'] and Sxt S and optional α-ketoglutaric acid and optional molecular oxygen Contact:

The present invention also provides the methods of production compound of formula I [intermediate 6']:

Wherein R is OH, method includes the following steps:

(A) under conditions of to produce Sxt S and Formula II compound is converted compound of formula I by Sxt S, in Formula II Culture includes the host cell of the nucleic acid molecules of coding Sxt S in the medium in the presence of compound [intermediate 5']:

Wherein R is OH.

In other embodiments, the present invention provides the methods of production compound of formula I [intermediate 7]:

Wherein R is OH, method includes the following steps:

(A) Formula II compound [intermediate 6] and Sxt S and optional α-ketoglutaric acid and optional molecular oxygen are connect Touching:

The present invention also provides the methods of production compound of formula I [intermediate 7]:

Wherein R is OH, method includes the following steps:

(A) under conditions of to produce Sxt S and Formula II compound is converted compound of formula I by Sxt S, in Formula II Culture includes the host cell of the nucleic acid molecules of coding Sxt S in the medium in the presence of compound [intermediate 6]:

Wherein R is OH.

In other embodiments, the present invention provides the methods of production compound of formula I [intermediate 7']:

Wherein R is OH, method includes the following steps:

(A) make Formula II compound [intermediate 6'] and Sxt S and optional α-ketoglutaric acid and optional molecular oxygen Contact:

The present invention also provides the methods of production compound of formula I [intermediate 7']:

Wherein R is OH, method includes the following steps:

(A) under conditions of to produce Sxt S and Formula II compound is converted compound of formula I by Sxt S, in Formula II Culture includes the host cell of the nucleic acid molecules of coding Sxt S in the medium in the presence of compound [intermediate 6']:

Wherein R is OH.

Present invention also contemplates that the above method, wherein R is H.

The term as used herein " N-STX analog " covers the analog and variant of N-STX, such as Compound (preferably saxitoxin) those of is mentioned below.

Saxitoxin as disclosed herein and illustrating for N-STX biosynthesis pathway also allow for giving birth to Various saxitoxins, N-STX and Gonyautoxin variant, such as variant shown below are produced (with reference to Saxidomus poison The structure of element):

Saxitoxin as disclosed herein and illustrating for N-STX biosynthesis pathway also allow for giving birth to Produce following N-STX analog and variant (structure with reference to saxitoxin is as follows):

The molecular structure of saxitoxin.

The natural derivative (Oshima 1995) of paralytic shellfish poisoning (PSP).The abbreviation used is STX: saxitoxin； GTX: Gonyautoxin；C:C- toxin；Dc: deaminizating formyl；Do: deoxidation.

The substituent group of uncommon saxitoxin derivative.

(abbreviation used is LTX: sheath silk algae (Lyngbya wollei) toxin；GC: unarmored dinoflagellate (Gymnodinium Catenatum) toxin).

Zeteki toxin AB from the golden frog (Atelopus zeteki) molecular structure (Yotsu-Yamashita etc., 2004)。

Therefore, on the other hand, the present invention provides produce saxitoxin variant defined in table as above or its production In intermediate method, this method include it is disclosed herein for produce N-STX or N-STX production in Intermediate method, wherein improved this method with produce saxitoxin variant or its production in intermediate.

For example, in the production of saxitoxin, the use of Sxt X polypeptide or sxt X gene may be it is unnecessary, because Being responsible for the N1- hydroxylation steps in N-STX production for SxtX polypeptide, (and saxitoxin is non-N1- hydroxylating ).

Before C-11 sulfonation is to produce C-11 sulphation toxin (such as GTX-1 to -4), need carbon C-11 hydroxylating. This is by the estimated progress of SxtDIOX.

Sulfotransferase SxtN presumption catalysis N- sulfonation to produce N- sulfocarbamoyl toxin, such as GTX5/6 and C1-4 toxin.Do not know that these where of reaction in approach occur.However, they are likely to occur before STX is formed, i.e., Occur on intermediate rather than on the final product of approach.

On the other hand, the present invention provides the method for producing N-STX or its analog or variant, In, the method also comprises the step for contacting N-STX or its analog or variant with SxtN or SxtDIOX polypeptide Suddenly.For example, host cell can be the host cell for additionally comprising the gene of coding sxtN and/or sxtDIOX.

In this way it is possible to be converted saxitoxin to by SxtN (passing through the sulphation of carbamyl base side chain) GTX-5.Similarly, 11- hydroxystone etoxin can be converted for saxitoxin by SxtDIOX.The step will be in C- GTX-2/3 (or converting GTX-4/1 for N-STX) is converted by saxitoxin before 11 sulphations.

The toxin array produced in given bacterial strain is likely to different dynamic (reaction speed) and by each The result of every kind of enzyme combination to the relaxation substrate specificity of intermediate metabolites is modified and changed to kind.

Intermediate 8 is converted into intermediate 9 by O- carbamyl based transferase SxtI.Intermediate 8 and intermediate 9 To be the substrate of dioxygenase SxtH and SxtT, these enzymes convert dcSTX for intermediate 8 and convert STX for intermediate 9. Similar approach may be the production of neoSTX and dcneoSTX.

Conversion and intermediate 9 of the intermediate 8 to intermediate 9 and deaminizating formyl toxin turn to saxitoxin Change.

Conversion and hydroxyl of the hydroxylated intermediate 8 to hydroxylated intermediate 9 and deaminizating formyl N-STX Change conversion of the intermediate 9 to N-STX.

In yet another embodiment, the present invention provides the N-STX produced by means of the present invention or its Analog.The N-STX produced by means of the present invention or its analog can further with inorganic or organic acid or Alkali is converted into salt, especially its pharmaceutically acceptable salt.

Can be used for this purpose acid include hydrochloric acid, hydrobromic acid, sulfuric acid, sulfonic acid, methanesulfonic acid, phosphoric acid, fumaric acid, succinic acid, Lactic acid, citric acid, tartaric acid, maleic acid, acetic acid, trifluoroacetic acid and ascorbic acid.Alkali suitable for this purpose includes alkali metal And alkaline earth metal hydroxide, such as sodium hydroxide, potassium hydroxide or cesium hydroxide, ammonia and organic amine for example diethylamine, triethylamine, Ethanol amine, diethanol amine, cyclohexylamine and dicyclohexyl amine.The program of forming salt is conventional in the art.

By means of the present invention or its salt production N-STX or its analog can further be formulated for Pharmaceutical composition.Therefore, on the other hand, the present invention provides the sides of production N-STX or its analog or its salt Method, this method are additionally included in pharmaceutical composition the step of preparing separation or purifying N-STX or its salt.It is excellent Selection of land, the step include N-STX will separate or purifying or its analog or its salt and it is one or more pharmaceutically Acceptable carrier, adjuvant and/or excipient composition.

It particularly, can be by N-STX or its analog or its salt and one kind according to technology well known in the art Or a variety of conventional carriers, diluent and/or excipient are prepared together.Pharmaceutically acceptable carrier, adjuvant and/or excipient can To be preservative.

The composition may be adapted to be administered orally or parenteral administration, for example, by intradermal, subcutaneous, peritonaeum, it is intravenous Or intramuscular injection.Therefore, suitable medicament forms include common or coated tablet, capsule, suspension and solution, containing active Component and optionally one or more conventional inert carriers and/or diluent, such as cornstarch, lactose, sucrose, crystallite are fine Dimension element, magnesium stearate, polyvinylpyrrolidone, citric acid, tartaric acid, water, water/ethyl alcohol, water/glycerol, water/D-sorbite, water/ The suitable mixing of polyethylene glycol, propylene glycol, stearyl alcohol, carboxymethyl cellulose or fatty material such as tristearin or any of above substance Object.

Alternatively, N-STX or its salt can be formulated for local application, such as with gel, creams, lotion, paste Etc. forms, such as include N-STX or its salt and conventional thinner, carrier or excipient.

In other embodiments, N-STX or its salt can be formulated for transdermal administration.

Detailed description of the invention

Fig. 1: the previous bio-chemical pathway for being used to produce saxitoxin proposed by Kellmann (2008).

The bio-chemical pathway for being used to produce N-STX of-Fig. 3: two kinds of Fig. 2 revisions.In Fig. 2, which is related to And use 6-5-5 member ring intermediate.

In Fig. 3, which is related to being converted into 6-5-5 loop system using 5-5-5 member ring intermediate.

Fig. 4 A- Fig. 4 B: what in approach the bio-chemical pathway of proposition is shown in the generation of N-STX Place introduces N-1 hydroxyl.Hydroxylated position may occur for R group expression.

The SDS-PAGE of SxtA after Fig. 5: IMAC.Swimming lane 1: the protein solution containing SxtA (147kDa)；Companion, DnaK and GroES, (respectively 70kDa and 60kDa)；Sfp, (27kDa).Swimming lane 2: trapezoidal precision+protein standard is double-colored (BioRad).

The MALDI-TOF-TOF of the phosphopantetheine base of Fig. 6: SxtA-ACP structural domain is analyzed.Pass through The SxtA (a) of the MALDI-TOF-TOF analysis purifying and SxtA co-expressed with Sfp (b), respective quality is respectively 14694Da And 15034Da.The difference of 340Da corresponds to the attachment of phosphopantetheine base arm.

Fig. 7: the liquid chromatography-mass spectrography of Escherichia coli transformant methanolic extract.A) it induces (dotted line) and non-induced (real Line) both extracts total ion chromatogram.B) m/z=of both (dotted line) and non-induced (solid line) extract is induced 187.06 extraction chromatography of ions figure.C) ProgenesisQI is statisticallyd analyze, and compares induction (rectangular) and non-induced (circle) M/z 187.06 punishes the expression of daughter ion between extract.D) mass spectrum of the extract induced.

Fig. 8: by the scheme in the mannitol operon of PPT enzyme gene construct insertion Escherichia coli.

Fig. 9 A and Fig. 9 B:(a) it is integrated into the sxt1 in lactose operon, it is recombinated by flippase and removes kanamycins box. (b) sxt2 being integrated into maltose operon is recombinated by flippase and is removed kanamycins box.(c) it is integrated into xylose manipulation Sxt3 (all genes) in son is recombinated by flippase and is removed kanamycins box.(d) it is integrated into Melibiose operon Sxt4 does not remove kanamycins box.

Figure 10: the detection of the intermediate 8 in the cell extract of e. coli bl21 (DE3) T3PPT enzyme NSX3v1.

Figure 11: the MS/MS spectrum of the intermediate 8 in the cell extract of e. coli bl21 (DE3) T3PPT enzyme NSX3v1.

Figure 12: the accurate mass LC-MS analysis of N-STX standard solution (100nM).m/z 316.13639 The Salbutamol Selected Ion Monitoring chromatogram of (400mmu window) is shown in upper figure, and the MS spectrogram and theoretical spectra of peak value are respectively displayed on In the intermediate and following figure.Retention time (RT), manual integrated peak areas (MA), signal-to-noise ratio (SN) provide in upper figure.The matter of measurement Amount, chemical composition and quality error (ppm) provide in the intermediate and following figure.

Figure 13: the accurate mass LC-MS analysis of the extract from e. coli bl21 (DE3) sfp NSX3v3.m/z The Salbutamol Selected Ion Monitoring chromatogram of 316.13639 (400mmu windows) is shown in upper figure, the MS spectrogram and theoretical spectra of peak value It is respectively displayed in the intermediate and following figure.Retention time (RT), manual integrated peak areas (MA), signal-to-noise ratio (SN) are given in upper figure Out.Quality, chemical composition and the quality error (ppm) of measurement provide in the intermediate and following figure.

Figure 14: intermediate 1 is recycled from e. coli bl21 (DE3) pVB-sxtABC by various cell lysing methods. LC-MS analysis carries out (m/z 187.15534, mass window 400mmu) under SIM mode.Instrument response is (every with peak area Second counts) it provides.

Figure 15: the neoSTX production level percentage relative to Escherichia coli sfp NSX3v4 (sfp sxt123V4).sfp The estimated concentration of neoSTX is 2.8nM in the extract of sxt123V4.

Figure 16: e. coli bl21 (DE3) sfp grown in the diastatochromogenes in leisure 50ml TB culture medium in the future The sodium channel of (negative control bacterial strain) and BL21 (DE3) sfp NSX3v3 block toxin neoSTX concentration.Each represents biology It learns and repeats.Error bars indicate the standard deviation of 4 repetition MNBA measurement of identical extract.It is analyzed from 1.2g cell precipitate Before, all samples are extracted by weak cation exchange Solid Phase Extraction.Concentration is provided with nmol neoSTX/ liter.In extract The mean concentration of neoSTX is 38.74nM (± 7.8 standard deviation).

Figure 17: intermediate 1 is produced by e. coli bl21 (DE3) sfp pVB-sxtA.Sfp pVB: the pVB being not inserted into Carrier.Sfp nat 8: using with natural sxtA codon and the pVB of the 8bp spacer region between RBS and initiation codon is carried Body.Sfp nat 10: using with natural sxtA codon and the pVB of the 10bp spacer region between RBS and initiation codon is carried Body.Sfp syn 8: there is synthesis sxtA gene (by codon using optimization in expression in escherichia coli) and RBS and starting The pVB carrier of 8bp spacer region between codon.Sfp syn 10: have synthesis sxtA gene (by codon using optimization with In expression in escherichia coli) and RBS and initiation codon between 10bp spacer region pVB carrier.

Figure 18: the production of intermediate 8 and neoSTX in coli strain.T3PPT: Escherichia coli T3PPT enzyme NSX3V1. NsPPT: Escherichia coli T3PPT enzyme NSX3V1pET28b-NsPPT, coding tubercle bacterium (Hodularia spumigena) phosphoric acid is general Acyl mercaptoethylmaine based transferase.T3Ala18T3PPT enzyme: Escherichia coli T3PPT enzyme NSX3V1pET30b-Ala18T3PPT enzyme is compiled Code T3PPT enzyme, which removes preceding 18 -terminal amino acids to improve the solubility during expression.With 0.2mM IPTG and 1mM toluic acid Induced cultures, as shown in the figure.

Figure 19: use saxitoxin as the LC chromatogram of the sulfotransferase of the SxtN of substrate measurement, MS spectrum, MS/ MS fragmentation (from top to bottom).

Figure 20: use STX as the LC chromatogram of the dioxygenase of substrate measurement (SxtDIOX), MS spectrum, MS/MS segment Change (from top to bottom).The peak indicated by an arrow for indicating that hydroxyl-STX is generated and is not present in control (left side) in measurement (right side).

Specific embodiment

Embodiment

It is further illustrated by the examples that follow the present invention, unless otherwise indicated, wherein parts and percentages are with weight Meter, degree are degree Celsius.It should be understood that although these embodiments show the preferred embodiment of the present invention, but only with The mode of explanation provides.From described above and these embodiments, those skilled in the art can determine spy substantially of the invention Sign, and in the case of without departing from the spirit and scope, various changes and modification can be carried out to the present invention to adapt it to Various uses and condition.Therefore, of the invention from the foregoing description various to repair in addition to shown and described herein other than those It would have been obvious for a person skilled in the art for decorations.These modifications, which are also intended to, to be fallen within the scope of the appended claims.

The disclosure of every bibliography as described herein is incorporated herein in its entirety by reference.

The production of embodiment 1:SxtA

SxtA and sfp is subcloned in pET28b

It carries out intending column spore algae from cyanobacteria from genomic DNA using Velocity polymerase (Bioline) The sxtA of (Cylindrospermopsis raciborskii) T3 and come from bacillus subtilis (Bacillus subtilis) Sfp PCR amplification.It follows the manufacturer's protocol, annealing temperature is 55 DEG C, and the extension of time of sxtA and sfp are respectively 4 minutes With 1 minute (sxtA primer: positive 5'-GGGCTTTCATATGTTACAAAAGATTAA-3'(SEQ ID NO:81) and reversed 5'- AAAGTATGCGGCCGCATGCTTGAGTAT-3'(SEQ ID NO:82)；Sfp primer: positive 5'- GGCATCCATGGGCAAGATTTACGGAA-3'(SEQ ID NO:83) and reversed 5'- GGCATCTCGAGTTATAAAAGCGCTTCG-3'(SEQ ID NO:84)).Purify PCR amplification sub (DNA clean and concentrating agents 5X kit, ZymoResearch) and with NdeI/NotI (sxtA) or NcoI/XhoI (sfp；New England Biolabs) Digestion.It by the product purification of digestion and is connected in pET-28b (Novagen), is cut with identical digestion, and is solidifying by agarose Gel electrophoresis (DNA QIAquick Gel Extraction Kit, ZymoResearch) purifying.After being converted in Electrocompetent Escherichia coli GB2005 cell, It is sieved with universal primer T7 promoter and T7 terminator by the PCR of plasmid purification (PureLink Miniprep, Invitrogen) Select positive colony.(Ramaciotti Center, UNSW, Australia) is sequenced for verifying to insert.

In order to co-express with sxtA, sfp gene is expanded from pET28b::sfp using Velocity polymerase (Bioline), For the primer of T7 promoter and T7 terminator be (5'-GGTTAAGATCTGAAATTAATACGACTC-3'(SEQ ID NO: 85), 5'-TTTTAAGATCTTTTCAGCAAAAAACCC-3'(SEQ ID NO:86)).It follows the manufacturer's protocol, annealing temperature Degree is 55 DEG C, and extension of time is 1 minute.Amplicon (DNA purification and concentrating agents 5X kit, ZymoResearch) is purified to be used in combination BglII (New England Biolabs) digestion.It by the product purification of digestion and is connected in pET28b::sxtA, use is identical Digestion cut, and purified as previously described.After converting in Electrocompetent Escherichia coli GB2005 cell, pass through plasmid purification The PCR screening positive clone of (PureLink Miniprep, Invitrogen).(Ramaciotti is sequenced to insert Center, UNSW, Australia) for verifying.

SxtA is expressed with sfp and purifies holo-SxtA

In order to express sxtA, 0.5mL is contained into pET28b::sxtA, sfp and pRARE plasmid (Invitrogen's) stays overnight E. coli bl21 (DE3) transformant in 50mL Lysogeny Broth (LB) culture medium secondary culture and 30 DEG C stir It is incubated under (200rpm) until the optical density at 600nm is 0.8-1.0, the culture medium is supplemented with 50 μ g.mL^-1Kanamycins With 30 μ g.mL^-1Chloramphenicol.Then it with 200 μM of isopropyl ss-D- thiogalactoside (IPTG) Induced cultures, and is stirred at 18 DEG C Mix and be incubated overnight, and by centrifugation (4000rpm, 4 DEG C 20 minutes, Hitachi CR22GIII centrifuge, R10A5 rotor) it is heavy It forms sediment.Cell precipitation is frozen up to and is further purified.

By the cell of precipitating be resuspended in 10mL lysis buffer (20mM sodium phosphate buffer, pH 7.4,500mM NaCl, 20mM imidazoles) in, and by ultrasound cracking (Branson Digital Sonifier M450,3mm probe, 30% amplitude, 4 DEG C It 3 minutes, is powered within 15 seconds and 59 seconds closes).By the centrifugation of obtained suspension (20000rpm, 60 minutes at 4 DEG C, Hitachi CR22GIII centrifuge, R20A2 rotor), and supernatant is loaded to Ni- affinity column (1mL HiTrap column, is mounted on On AKTApurifier, GE Healthcare), with 20mM sodium phosphate buffer, pH 7.4,500mM NaCl, 20mM imidazoles (buffer solution A) balance.After injection, pillar (35mL buffer solution A, 1mL.min are washed^-1) and use 20mM sodium phosphate buffer, pH 7.4,500mM NaCl, 500mM imidazoles (buffer solution B) elute albumen, and in 0% to the 20% gradually buffer solution B of gradient Washing 20 minutes is then washed 10 minutes 20%, is then washed 20 minutes in 20% to 100% linear gradient, Yi Ji 100% last washing 10 minutes.(SDS-PAGE) is collected by 10% Polyacrylamide Gel Electrophoresis under Denaturing Fraction (1mL, at 280nm detect), merge the fraction containing pure protein.By protein solution 50mM HEPES-150mM Then NaCl pH7.4 is added by centrifugal filter (Amicon Ultra-4 centrifugal filter unit 100k) desalination and concentration Glycerol is to final concentration 10% (w/v).Protein concentration is measured by using protein determination kit (Bio-Rad) and is stored in -80 ℃。

The acyl carrier protein domain of clone sxtA is expressed for single expression and together with sfp

Use Velocity polymerase (Bioline) (primer: positive 5'- ATATCCATGGGACCTGGTGATCGCAAAGGA-3'(SEQ ID NO:87) and reversed 5'- TATCTCGAGAGTGTTGATTTCGTTGGCTG-3'(SEQ ID NO:88)) amplification sxtA (sxtA-ACP) encoding gene acyl Base load body protein.Manufacturer's scheme is followed, annealing temperature is 54 DEG C, and extension of time is 1.5 minutes.Using identical as described in sfp Method purifying, digestion PCR amplification son and be connected in pET-28b.It is converted in Electrocompetent Escherichia coli GB2005 cell Afterwards, it with universal primer T7 promoter and T7 terminator screening positive clone, and is sequenced as previously described.It, will in order to be co-expressed with sfp Gene cloning is into pET28b::sxtA-ACP plasmid, as previously described.

The expression and purifying of apo- and holo-sxtA-ACP

In order to express sxtA-ACP, as described above, 10mL is contained pET28b::sxtA-ACP and pET28b::sxtA- Overnight e. coli bl21 (DE3) transformant of ACP, sfp plasmid is cultivated in 1L Lysogeny meat soup (LB) and is stirred at 37 DEG C It mixes and is incubated under (200rpm) until being induced with 100 μM of IPTG, which is supplemented with 50 μ g.mL^-1Kanamycins and 30 μ g.mL^-1 Chloramphenicol.By centrifugation (4000rpm, 4 DEG C 20 minutes, Hitachi CR22GIII centrifuge, R10A5) collect cell, weight It is suspended from 15mL lysis buffer, and passes through ultrasonication (Branson Digital Sonifier M450,3mm probe, vibration 30%, 4 DEG C of 3min are powered, then 4 seconds circulations closed for 1 second).Obtained suspension is centrifuged (20000g, at 4 DEG C 60 Minute, Hitachi CR22GIII centrifuge, R20A2 rotor), and supernatant is loaded to Ni- affinity column (1mL HiTrap Column, is mounted on AKTApurifier, on GE Healthcare), 20mM sodium phosphate buffer, pH 7.4,500mM are used in advance NaCl, 20mM imidazoles (buffer solution A) balance.After injection, pillar (35mL buffer solution A, 1mL.min are washed^-1), with 20mM sodium phosphate Buffer, pH7.4,500mM NaCl, 500mM imidazoles (buffer solution B) elute albumen, wash in the B of 0% to 20% linear gradient It washs 20 minutes, then washs 10 minutes, then washed 20 minutes in 20% to 100% linear gradient, and 100% 20% Finally wash 20 minutes.(SDS-PAGE) passes through the fraction that 15% Polyacrylamide Gel Electrophoresis is collected under Denaturing (1mL is detected at 280nm), merges the fraction containing pure protein.Protein solution is used into centrifugal filtration (Amicon Ultra- 15 centrifugal filter device 3k) and 50mM HEPES-150mM NaCl, pH7.4 desalination and concentration, it freezes and stores in liquid nitrogen At -80 DEG C.Protein concentration is measured by using protein determination kit (Bio-Rad).

It successfully is detected SxtA (Fig. 5) after purification on IMAC and SDS-PAGE.Purify the egg that expected size is 143kDa White, the yield of culture is 0.5mg.L^-1, digesting confirmation identity by tryptose is SxtA.

The MALDI-TOF-TOF mass spectral analysis of Apo- and holo-sxtA-ACP

Albumen quality is detected by MALDI-TOF-TOF mass spectrography.It prepared by matrix, by 3, the 5- dimethoxy of 10mg Base -4- hydroxycinnamic acid is added in 80% acetonitrile of 1mL containing 0.1%TFA, and 1mL matrix and 1 μ l protein sample are mixed It closes on the surface of MALDI target plate.Then by Bruker ultrafleXtreme MALDI-TOF/TOF with YAG laser into Row analysis.Data acquisition, and the calibration instrument immediately before each analysis are carried out with positive ion mode.Obtaining 100 averagely It is analyzed in the linear delay extraction mode of spectrum.As a result as shown in Figure 6.

The extraction of 4- amino -3- oxo-guanidine radicals heptane

PRARE and pET28b::sxtA will be contained, BL21 (DE3) transformant of sfp is resuspended in 0.1% sour acetic acid Methanol in.By sonicated cells (Branson Digital Sonifier M450,3mm probe, 30% amplitude, 4 DEG C 2 Minute, be powered the circulation closed with 15 seconds for 5 seconds).By obtained suspension centrifugation (20000rpm, 4 DEG C 30 minutes, Hitachi CR22GIII centrifuge, R20A2 rotor).Supernatant is dried under rotary evaporation and is stored in -20 DEG C until further dividing Analysis.The mass spectral analysis of 4- amino -3- oxo-guanidine radicals heptane

It is in order to determine the biosynthetic products of SxtA, the Escherichia coli containing pET28b::sxtA, sfp and pRARE are thin The endocellular metabolism object chemical extraction of born of the same parents is simultaneously analyzed by LC-MS.

Sample is resuspended in 95:5 acetonitrile: in water (usual 1mL), and being transferred in HPLC bottle and is analyzed by mass spectrometry.Make Pass through heating with the Dionex U3000UHPLC for being connected to Q-Exactive Plus (ThermoFisher Scientific) Electrospray interface carries out LC-MS analysis to 10 μ L samples.Under the conditions of default sources (as proposed by the Tune software of manufacturer) It is ionized with holotype.It will be in sample injection to Waters BEH HILIC column (2.1 × 100mm, 1.9 μm).Chromatographic condition As described in Turner etc., do not modify.

Mass spectrograph collects six MS/MS spectrums with Data dependency analysis mode operation after each full scan mass spectrum.It comes from The detection for being used to pay the utmost attention to them comprising list of the toxin and metabolin of document.

Inducing cell and do not induce control between mass spectrographic comparison be shown in m/z 187.06 [M+H]+1.1 minutes at deposit In molecular ion, correspond to AOGH (C₈H₁₈N₄O protonation quality).The secondary ion fragmentation of the molecular ion causes and AOGH Closely similar fragmentation mode.The experiment realizes in 8 repetitions, and by Progenesis QI analyze qualitative data with Differential expression between quantization induction and non-induced extraction.Compared with the control not induced, the AOGH compound of presumption is observed Be overexpressed (figure) in the cell of induction, the variation of maximum multiple be equal to infinity (being completely absent in negative control) and ANOVAp value is 1.1 × 10^-16。

The compound of 187.06Da mass is purified and analyzes, NMR confirms the structure of AOGH.

Embodiment 2:sxt1 segment

Following three open reading frame (ORF) for intending column spore algae (C.raciborskii) T3 from cyanobacteria are placed in label For " sxt1 ": in the nucleotide fragments of sxtA, sxtB and sxtC.Using GeneArt software, pass through Life Technology couple Each ORF carries out codon optimization in expression in escherichia coli.

EcoRI restriction site is added at the both ends of segment.In addition, the 50bp of lacZ (H1) and lacA (H2) gene is same Source region is respectively added to the end 5'- and 3'-, with the recombination and integration that is mediated by RED ET into genome of E.coli.? Terminator is added to prevent from reading in the downstream of H1, followed by transcription factor gene xylS and its Ps2 promoter.(XylS be with From transcription factor needed for Pm promoter transcription after the combination of its inducer toluic acid.) followed by terminator, followed by Pm starts Son is for transcribing downstream sxt gene.In the upstream of each ORF, add ribosome bind site (RBS).Finally, being added has For the kalamycin resistance label in two sites flank FRT by flippase-recombinase (GeneBridges) excision and same Source arm H2, including terminal EcoRI site.

Embodiment 3:sxt2 segment

Following sxt gene is included in " sxt2 " segment: sxtD, sxtE, sxtG, sxtH, sxtI, sxtJ, sxtK, sxtL.Using GeneArt software, codon optimization is carried out in Escherichia coli to each ORF by Life Technology Expression.

Sxt2 segment is designed with terminal EcoRI site, for the malE (H1) and malG (H2) base with Escherichia coli Because of the homology arm of recombination and the Pm promoter of sxt upstream region of gene.The segment also contains the kanR resistance box with the site FRT, Such as segment sxt1.

Embodiment 4:sxt3 segment

Devise three kinds of variants of sxt3 segment.Following sxt gene is included in " sxt3 " segment, variant 1:sxtQ, sxtR,orf24,sxtS,sxtT,sxtU,sxtV,sxtW,sxtX.Following sxt gene is included in " sxt3 " segment, variant 2: sxtQ,sxtR,sxtS,sxtT,sxtU,sxtV,sxtW,sxtX.Following sxt gene is included in " sxt3 " segment, variant 3: sxtS,sxtT,sxtU,sxtV,sxtW,sxtX.Using GeneArt software, by Life Technology to each ORF into Row codon optimization is in expression in escherichia coli.

Each variant of sxt3 segment is designed with terminal EcoRI site, for Escherichia coli xylF (H1) and The homology arm of xylB (H2) genetic recombination and the Pm promoter of sxt upstream region of gene.Each variant of the segment, which also contains, to be had The kanR resistance box in the site FRT, such as segment sxt1.

Embodiment 5:sxt4 segment

Following sxt gene is included in " sxt4 " segment: sxtF, sxtP, sxtM.Using GeneArt software, pass through Life Technology carries out codon optimization in expression in escherichia coli to each ORF.

Sxt4 segment is designed with terminal EcoRI site, for the melR (H1) and melB (H2) base with Escherichia coli Because of the homology arm of recombination and the Pm promoter of sxt upstream region of gene.The segment also contains the kanR resistance box with the site FRT, Such as segment sxt1.

Embodiment 6: the generation of e. coli bl21 (DE3) PPT enzyme

Preferably use Phosphopantetheinyl transferase (PPT enzyme) by the load rouge shape of polyketide synthase Formula SxtA is converted into its holo- form.

To Raphidiopsis brooki D9 and Cylindrospermopsis racoborskii CS-505's Whole gene group is sequenced, and sequence is stored in GenBank.Each in these bacterial strains only contains single PPT enzyme Gene.Specific PCR primers are designed based on D9 and CS-505PPT enzyme gene, and column spore algae is intended from cyanobacteria with PCR amplification and sequencing (C.raciborskii) the PPT enzyme gene of T3.

Design synthesis gene construct is integrated into greatly so that cyanobacteria is intended column spore algae (C.racicorskii) T3PPT enzyme gene In the maltose operon of enterobacteria BL21 (DE3).Codon optimization is carried out in expression in escherichia coli to PPT enzyme gene, And the construct is equipped with T7 promoter and beta-lactam enzyme gene for selecting amicillin resistance.Initiation codon Also it is changed to ATG.

Then using Quick&Easy bacillus coli gene missing kit according to the explanation (Gene of manufacturer Bridges, catalog number (Cat.No.) K006) gene construct is integrated into the malt of e. coli bl21 (DE3) (Life Technology) In sugared operon, as shown in Figure 8.Pass through the correct integration of the unexpected mutation of sequence verification and missing.

Embodiment 7: 4- amino -3- oxo-guanidine radicals heptane is produced by e. coli bl21 (DE3) PPT enzyme pSxt1

Sxt1 segment is generated in pMA-RQ (ampR) plasmid backbone by Life Technology.The plasmid is herein In be referred to as pSxt1.PSxt1 plasmid is transformed into e. coli bl21 (DE3) PPT enzyme, is carried in its genome Cyanobacteria intend column spore algae (Cylindrospermopsis raciborskii) T3 Phosphopantetheinyl transferase. PPT enzyme gene is under the control of T7 promoter (IPTG induction type), and sxtA, B and C gene on pSxt1 are under the control of Pm promoter (meta-toluic acid is inducible).

The purpose of this experiment is measurement the three of constant inducer concentrations (IPTG (0.5mM) and meta-toluic acid (1mM)) Expression and activity at 5 DEG C, 19 DEG C and 30 DEG C of a different temperatures in sxtA gene Escherichia coli.Experimental strain is Escherichia coli BL21 (DE3) PPT enzyme pSxt1, negative control are e. coli bl21 (DE3) (parent strains).It is expected that the only enzyme product of SxtA, Because the substrate of SxtB and SxtC is the enzyme product of other enzymes, such as SxtG, do not encoded on pSxt1.

The inoculum of BL21 (DE3) (parent strain) and BL21 (DE3) PPT enzyme pSxt1 are respectively at 37 DEG C in LB With overnight growth in LB50 μ g/ml ampicillin and kanamycins.Second day, by the 200ml of 50 μ g/ml containing kanamycin The LB culture medium of volume is inoculated in triplicate, is connect every time with the 2ml inoculum of e. coli bl21 (DE3) PPT enzyme pSxt1 Kind, and incubate at 30 DEG C until culture reaches OD₆₀₀It is~0.6.

For negative control, it is used to each triplicate inoculation of 2ml inoculum from e. coli bl21 (DE3) The not antibiotic LB of 200ml volume, and OD is incubated at 30 DEG C₆₀₀It is~0.6.Then all cultures are transferred to phase The temperature answered, and adapt to 30 minutes.Then, IPTG (0.5mM final concentration) and meta-toluic acid are added into every kind of culture (1mM final concentration) is then incubated 48 hours at 5 DEG C, is incubated 18 hours at 19 DEG C, and is incubated 18 hours at 30 DEG C.

Acquisition sample for SDS-PAGE and is used for RT-PCR before induction and at the end of experiment.After induction 18 hours, 12 minutes harvest cultures are centrifuged by 7500rpm.Cell precipitation is frozen up to extraction and is used for LC-MS analysis.

It extracts

Cell precipitation is resuspended in 1ml water and on ice ultrasonic treatment (output control 4, duty ratio 50%, 7 points in total Clock recycles 2-3 minutes).After ultrasonic treatment, 4ml acetonitrile is added, vortex sample is centrifuged off cell fragment and other particles.

LC-MS/MS analysis

LC-MS analysis is carried out on Hikelaboratory, the Waters Xevo TQ-S of Haukeland university hospital, The Waters Xevo TQ-S and the iclass Acquity UPLC equipped with 50 × 2.1mm Acquity BEH amide column are even Connection.Mobile phase A is made of 10mM ammonium formate pH 3.0, and Mobile phase B is made of 95% acetonitrile and 10mM ammonium formate pH 3.0.Flow velocity For 0.4ml per minute, column temperature is maintained at 40 DEG C.Applied in 3 minutes with gradient 85%B to 70%B.Volume injected always 1 μ l.

Analyte is ionized with holotype by electrospray ionisation.According to Tsuchiya etc. (2014) and Tsuchiya etc. (2015), following mrm transition is measured.Arginine 175.05- > 60.00,175- > 70.02,4- amino -3- oxo-guanidine radicals heptan Alkane: 187.1- > 170.1,187.1- > 128.1,187.1- > 110.1,187.1- > 72.08,187.1- > 60.05.

It is detected big arginine peak (data are not shown) in all cultures processing and pure arginine solution, and smart ammonia 4- amino -3- oxo-guanidine radicals heptane signal is not present in acid solution and all controls.In addition, in addition to the culture induced at 19 DEG C Beyond the region of objective existence, all there is no 4- amino -3- oxo-guanidine radicals heptane letters in all e. coli bl21 (DE3) PPT enzyme pSxt1 cultures Number.

This is experiments have shown that can be in e. coli bl21 (DE3) in the form of catalytic activity using the DNA construct of synthesis Express SxtA.In this experiment, after with the induction of 0.5mM IPTG and 1mM toluic acid, expression is only in 19 DEG C of growth temperature Lower generation.

Embodiment 8: segment sxt1 and sxt3 the sugar decomposition metabolism for being integrated into Escherichia coli DE3 (BL21) PPT enzyme are manipulated In son

Sxt1 construct is integrated into the lac operon of e. coli bl21 (DE3) PPT enzyme, as follows:

Using 2 μ l template DNAs, 0.4 μM of primer, Phusion archaeal dna polymerase carries out PCR amplification in 50 μ l reaction volumes The DNA construct sxt1 of synthesis.

PCR cycle is as follows: 98 DEG C 1 minute, 30 circulation: 98 DEG C 5 seconds, 72 DEG C 2 minutes, 72 DEG C 5 minutes, be then maintained at 4℃。

Passing through gel electrophoresis and gel extraction after purification, is then mediating PCR product (8019bp) for RED ET Recombination.Before a reorganization, e. coli bl21 (DE3) PPT enzyme is converted with plasmid pRED (GeneBridges) by electroporation, And the transcription of the recombinase of induction pRED coding according to the manufacturer's instructions.Then, with above-mentioned PCR product (2.5kV, 200Ohm, 25 μ F, the 150ng PCR product in 5 μ l) Electroporation Transformation bacterial strain, then recombination enters lac operon.

By the cell inoculation of electroporation to the LB agar containing 15 μ g/ml kanamycins on, and in 37 DEG C of overnight growths.It chooses The clone that obtains simultaneously is inoculated on the MacConkey containing 15 μ g/ml kanamycins (containing lactose) agar, and grows at 37 DEG C At least 24 hours.Obtained white colony is separated in pure culture, and is tested by PCR and sequencing to ensure segment Sxt1 is correct and is integrated into lac operon without mutation.

After confirmation, according to the scheme (GeneBridges) of manufacturer, pass through flippase recombination selection gram using plasmid p707 It is grand to remove kanamycin resistance cassette.The kalamycin resistance of obtained clone is screened, and kalamycin resistance is verified by PCR The successful removal of box.In addition, PCR is complete for verifying the rest part of sxt1 segment.

Then obtained strains are used to for segment sxt2 being integrated into maltose operon using identical method.Pass through phase Same method uses obtained strains (after segment sxt1 and sxt2 and removal kanamycin resistance cassette) by sxt3 piece Each in three kinds of variants of section is integrated into xylose operon.

Sxt3 variant e. coli bl21 (DE3) bacterial strain

Bacterial strain	Bacterial strain design	The missing gene from sxt3
			T3PPT enzyme sxt1 sxt2 sxt3 v1	NSX3v1	Nothing
T3PPT enzyme sxt1 sxt2 sxt3 v2	NSX3v2	orf24
			T3PPT enzyme sxt1 sxt2 sxt3 v3	NSX3v3	SxtQ, sxtR and orf24

Then turned using the 4'-phosphopantetheine base from bacillus subtilis (Bacillus subtilis) Move the T3PPT enzyme in the above-mentioned every kind of bacterial strain of enzyme gene sfp (Pfeifer BA waits (2001) Science 291:1790-2) replacement To produce other bacterial strain.

Then obtained strains are used to for segment sxt4 to be integrated into e. coli bl21 (DE3) T3PPT enzyme and Escherichia coli In the Melibiose operon of BL21 (DE3) sfp.Kanamycins box is not removed.The chart of sxt1-4 segment is in Fig. 9 A and Fig. 9 B In provide.

Embodiment 9: the generation of the variant strain of e. coli bl21 (DE3) sfp NSX3v3

Use strain Escherichia coli BL21 (DE3) sfp NSX3v3 as parent strain to generate following bacterial strain, wherein leading to Cross methods of homologous recombination missing individual or multiple groups gene.

E. coli bl21 (DE3) bacterial strain table and the gene in nonessential sugared operon is would be integrated into

Embodiment 10: LC-MS detection N-STX and intermediate are used

LC-MS is used to detect the intermediate in N-STX and N-STX production.LC-MS analysis exists It is carried out on ThermoFisher Scientific Q Exative Hybrid Quadrupole mass spectrograph, which is equipped with There is ESI II ion source, and is coupled to Dionex 3000Ultimate RSLC Ultrapressure liquid chromatograph online.

Can by e. coli bl21 (DE3) NSX3 bacterial strain generate possible saxitoxin analog and intermediate supersession The mass-to-charge ratio (m/z) of object

Compound	M/z [M+H]+adduct	Chemical composition
			Intermediate 1	187.15534	C₈H₁₉ON₄
Intermediate 2	229.17714	C₉H₂₁ON₆
			Intermediate 3	211.16657	C₉H₁₉N₆
Intermediate 4	209.14584	C₉H₁₇N₆
			Intermediate 5	207.13527	C₉H₁₅N₆
Intermediate 6	223.13019	C₉H₁₅ON₆
			Intermediate 7	223.13090	C₉H₁₅ON₆
Intermediate 8	225.14584	C₉H₁₇ON₆
			Intermediate 9	268.15165	C₁₀H₁₈O₂N₇
dcSTX	257.13566	C₉H₁₇O₃N₆
			dcneoSTX	273.13058	C₉H₁₇O₄N₆
STX	300.14148	C₁₀H₁₈O₄N₇
			neoSTX	316.13639	C₁₀H₁₈O₅N₇
STX-15N4	304.12962	C₁₀H₁₈O₄N₃-¹⁵N₄

Embodiment 11: the detection of intermediate 1 and intermediate 8 in E. coli extract

E. coli bl21 (DE3) T3PPt enzyme NSX3v1 shakes in the 20ml LB meat soup in 100ml flask at 19 DEG C Swing (200rpm) growth.When it reaches OD₆₀₀When being 0.9, with 0.2mM IPTG, 1mM toluic acid Induced cultures, and grow 18 hours to OD₆₀₀=5.

Cell is harvested by centrifugation, and is extracted in the methanol solution of the 0.1M acetic acid in 800 μ l.Lysate is centrifuged, and Supernatant is diluted with 1:5 with acetonitrile before LC-MS analysis.

Intermediate 1 and 8 is detected in extract.Spectrum from intermediate 8 is shown in Figure 10 and Figure 11.

Embodiment 12: the production of N-STX

The inoculum of Escherichia coli sfp NSX3v3 is prepared in 50ml Hi YE culture medium, and at 30 DEG C (225rpm) is incubated overnight.According to the explanation of manufacturer, establish and be equipped with having heaters, water cooling, pH and dissolved oxygen probe it is new 110 fermentor of Brunswick BioFlo (2L volume) is used for fermenting experiment.2L Hi-YE culture medium is packed into fermentor, and High pressure sterilization.After autoclaving, the stock solution of yeast extract, magnesium chloride, glucose and glycerol is sterilely added to In fermentor.In addition, the disinfectant solution of 5% defoaming agent 204 (Sigma Aldrich) of 2ml is added into fermentor.With 20ml Overnight seed cultures inoculation medium, OD₆₀₀It is 5.71.The OD of starting culture₆₀₀It is measured under 0.15.At 19 DEG C Culture is incubated, initial mixing speed is 50rpm, increases to 600rpm after incubating 26 hours.With forced air with 2 liters/it is small When flow velocity purge culture.Continuous monitoring pH and dissolved oxygen levels, and off-line measurement is grown after sampling.In entire experiment periods Between pH (pH 7.1) and dissolved oxygen levels (100%) be stable.(OD after incubating 22 hours₆₀₀=10.6) with first between 0.5mM Benzoic acid and 0.2mM IPTG Induced cultures, and incubate again 22 hours.By sterile dextrose solution (400g/l) with 2.9ml/ The flow velocity of min is added in culture (11.4g in total) between 24 and 26.3 hours of experiment, and the sterile 1M sulfuric acid of 1.8ml Magnesium solution is adding for 26.3 hours in experiment, to attempt to stimulate the growth and generation of neoSTX.Experiment is terminated after 45 hours, this When by centrifugation (5000 × 5,30 minutes, 4 DEG C) harvest cultures.By cell precipitation with 50ml ice-cold MQ water (5000 × g, 10 minutes, 4 DEG C) it washes twice, it weighs, and be stored in -20 DEG C until analysis.The total biomass of acquisition is 23.77g.

Crack the cell from fermenting experiment by boiling in 0.1% formic acid, and with containing before LC-MS analysis There is the acetonitrile of 0.1% formic acid to dilute extract with 1:5 (referring to Figure 12 and Figure 13).MS is also measured by mouse neuroblastoma The content of neoSTX in analysis precipitating.

Embodiment 13: optimization cell cracking is to extract intermediate

Natural gene sxtA, sxtB, sxtC are cloned into pVB carrier (Vectrons Biosolutions), and will To carrier pVB-sxtABC be transformed into Escherichia coli BAP1.BAP1pVB-sxtABC is at 19 DEG C in 10ml TB culture medium In with 200rpm oscillating growth 24 hours.Cell is harvested by centrifugation, and twice with ice-cold MQ water washing, sediment is claimed Weight, and -20 DEG C are stored in until analysis.

(1:3 weight in wet base: volume) is resuspended in sediment in various cracked solutions:

1. 50% methanol containing 25mM sodium hydroxide

2. 50% methanol containing 0.5% ammonium hydroxide

3. 50% methanol containing 0.1% formic acid

4.0.1mM hydrochloric acid

5.0.1% formic acid

6.0.5% ammonium hydroxide

1,2 and 3 will be handled using the Branson Sonifier 250 (output 2, duty ratio 50%) equipped with microprobe Ultrasonic treatment 2 minutes.Processing 3 to 5 is boiled 5 minutes in boiling water batch.Extract is centrifuged 10 under 18000 × g (4 DEG C) Minute.250 μ l supernatants are mixed with the 750 μ l acetonitriles containing 0.4% formic acid, and are centrifuged (10 minutes, 18000 × g, 4 DEG C). Supernatant is transferred to the LC-MS analysis that intermediate 1 is used in autosampler bottle (referring to Figure 14).

It is considered as most suitable method that 5 minutes are boiled in 0.1% formic acid, because it will not cause to HILIC LC- The interference of MS, and the precipitating of minimum is generated during the extraction process.

Embodiment 14: optimum strain and production level

The inoculum of coli strain is prepared in 10ml LB meat soup, and is vibrated and given birth to 200rpm at 30 DEG C It is long to stay overnight.Compare the neoSTX production level of following bacterial strain:

E. coli bl21 (DE3) sfp

E. coli bl21 (DE3) T3PPT enzyme sxt1sxt2

E. coli bl21 (DE3) T3PPT enzyme NSX3v1

E. coli bl21 (DE3) sfp NSX3v1

E. coli bl21 (DE3) sfp NSX3v2

E. coli bl21 (DE3) sfp NSX3v3

E. coli bl21 (DE3) sfp NSX3v4

E. coli bl21 (DE3) sfp NSX3v5

E. coli bl21 (DE3) sfp NSX3v6

E. coli bl21 (DE3) sfp NSX3v7

30ml is had into 0.4% glycerol and is buffered to the Terrific Broth of pH 6.8 with 89mM phosphate buffer (TB) OD is seeded to 300 μ l Overnight seed cultures₆₀₀It is 0.05.Culture is straight with 225rpm incubated under agitation at 30 DEG C Reach OD to them₆₀₀It is 0.4.Then culture is transferred to 19 DEG C (oscillation 225rpm), and grows to OD₆₀₀It is 0.5.In order to Sfp and sxt gene is induced, 0.05mM IPTG (0.05mM final concentration) and toluic acid (0.5mM final concentration) are added to culture In object, incubated 48 hours at 19 DEG C after persistent oscillation (225rpm).Every kind of bacterial strain is grown in triplicate subculture object.It is logical It crosses and every kind of culture of 25ml was harvested with 3000 × g centrifugation 10 minutes at 4 DEG C.The aliquot of 1ml supernatant is stored At -20 DEG C, remaining supernatant is discarded.Cell precipitate is used respectively 25 and 5ml ice-cold MQ water (3000 × g, 4 DEG C, 10 points Clock) it washes twice.Weighing cell precipitation is simultaneously stored in -20 DEG C.

Toxin is extracted from cell precipitation

Bacterium cell pellet object is resuspended in 0.1% formic acid and is boiled 5 minutes with the ratio of 1:4 (weight in wet base: volume).It will Extract of short duration cooling on ice collects supernatant with 16000 × g centrifugation 10 minutes.LC-MS is analyzed, supernatant is used Contain 25nM saxitoxin-¹⁵N₄Interior 90% acetonitrile of target: 10% methanol: 0.1% formic acid is with the dilution proportion of 1:5.By sample It is centrifuged (16000 × g, 10 minutes, 4 DEG C), supernatant is transferred to progress LC-MS analysis in autosampler bottle.

Toxin is extracted from growth medium

Growth medium (200 μ l) 2 μ l, 10% formic acid is acidified, boils 5 minutes, cools down on ice, and at 4 DEG C With 16000 × g centrifugation 10 minutes.Supernatant is transferred in new pipe, and 40 μ l internal standard (25nM saxitoxins-are added¹⁵N₄ In 10% methanol, 90% acetonitrile and 0.1% formic acid).Pipe is centrifuged 10 minutes in the case where 4 DEG C of 16000 × g, and supernatant is turned HPLC autosampler bottle is moved to analyze for LC-MS.As a result as shown in figure 15.

Embodiment 15: the mouse neuroblastoma measurement (MNBA) of toxin is blocked for detecting sodium channel

Culture of Escherichia coli for MNBA

The kind of coli strain BL21 (DE3) sfp and BL21 (DE3) sfp NSX3v3 is prepared in 10ml LB meat soup Sub- culture, and stayed overnight at 30 DEG C with 200rpm oscillating growth.50ml had into 0.4% glycerol and with 89mM phosphate-buffered The Terrific Broth (TB) that liquid is buffered to pH 6.8 is seeded to OD with 500 μ l Overnight seed cultures₆₀₀About 0.05.It will Culture is at 30 DEG C with 225rpm incubated under agitation until they reach OD₆₀₀It is 0.4.Then culture is transferred to 19 DEG C of (vibrations Swing 225rpm) and grow to OD₆₀₀It is 0.5.In order to induce sfp and sxt gene, by 0.05mM IPTG (0.05mM final concentration) and Toluic acid (0.5mM final concentration) is added in culture, is incubated 48 hours at 19 DEG C after persistent oscillation (225rpm).Every kind Bacterial strain is grown in triplicate subculture object.By being centrifuged 10 minutes with 2500 × g at 4 DEG C to harvest culture.It will be thin Born of the same parents' sediment uses 25 DEG C of ice-cold MQ water (2500 × g, 4 DEG C, 10 minutes) to wash twice respectively.Weighing cell precipitate simultaneously stores At -20 DEG C.

The cell extraction of MNBA

Passed through according to following scheme using Accell Plus CM column (360mg, 1.1ml, WAT010910, Waters) Weak cation exchange solid phase extractions (WCX-SPE) are that MNBA extracts bacterial cell.

1.2g cell precipitate is resuspended in 0.15% formic acid of 3.6ml simultaneously boiling lysis 5 minutes.By with 16000 × G, which is centrifuged 10 minutes, carrys out clarified cell extract.

With 3.6ml methanol adjustable column, then adjusted with 0.15% formic acid of 3.6ml.3ml sample is added, with 1.8ml MQ water Pillar is washed, is then washed with 1.8ml acetonitrile.Then column is dry, sample is washed in 2 × 3.6ml methanol containing 5% formic acid It is de-.By the dry eluent of traditional vacuum, and sample is reconstructed in 200 μ l, 0.01% formic acid.

Mouse neuroblastoma detection for sodium channel retardance toxin

Using mouse neuroblastoma cell line (CCL131), and (such as using mouse neuroblastoma measuring method Described in Humpage etc. (2007) .Environ.Toxicol.Chem.26:1512-9).

Using the certified reference material for being directed to neoSTX, it is bent that the calibration that MNBA is measured is prepared with and without bio-matrix Line (CRM-NEO-c, batch 2009-02-18,65.6 μM in 3mM HCl).As a result as shown in figure 16.

Embodiment 16: N-STX is detected by ELISA immunochemistry

It is detected using saxitoxin ELISA kit (Abraxis PN 52255B, Microtiter Plate 96T) The neoSTX generated in Escherichia coli.The kit uses polyclonal saxitoxin antibody, with neoSTX with 1.3% Cross reactivity.It prepares the culture of Escherichia coli T3PPT enzyme NSX3v3 and obtains cell lysate.In SampliQ silicagel column (Agilent PN 5982-2211,1ml, 100mg, Jansson D and Astot C (2015) m J Chromatogr A Sample is extracted by Solid Phase Extraction on 1417:41-8).It will extract and the sample of evaporation be dissolved in and mentioned by STX ELISA kit In the 100 μ l sample buffers supplied.Also it is prepared for the diluted Escherichia coli T3PPT enzyme NSX3v3 of the 1:1000 in sample buffer Extract.The Std 0 (as blank), Std 1 (0.0668nM STX) and 5 (1.3365nM of STd for using kit to provide STX) pass through 2 standard curve calibration measurements.Reference sample is used to estimate the accuracy of the STX ELISA kit of neoSTX, And the rate of recovery of the neoSTX during SPE is estimated based on the ratio of the reference sample of extraction and reference sample.Measurement result is aobvious Show in the following table.The accuracy of estimation is 119%, and the rate of recovery during SPE is 92%.The measurement is in Escherichia coli T3PPT It is detected in the cell extract of enzyme NSX3v3 and is equivalent to 1.16nM STX.NeoSTX is converted to, this is equivalent to 89.1nM, and every liter The yield of culture of Escherichia coli is about 223pmol neoSTX.

STX ELISA.Std 0, Std 1 and Std 5 are provided by STX ELISA kit.Pass through 2 points of (y=-0.4627+ 0.7597) calibration ELISA measurement.According to manufacturer, 1.3% cross reactivity based on STX antibody calculates the concentration of neoSTX. ND: it does not detect.SPE is 92% to the rate of recovery of neoSTX.

Embodiment 17: the effect with natural gene and RBS spacer region of synthesis

Many pVB constructs have been made using following element:

(i) Pm promoter；

(ii) sxtA (codon optimization is carried out to Escherichia coli) or sxt natural gene synthesized；And

(iii) the 8 or 10bp spacer region between ribosome bind site (RBS) and initiation codon.

The sequence of Pm promoter with the 8bp spacer region between RBS and SxtA initiation codon is as follows.RBS and Initiation codon shows that spacer region is marked with underscore with capitalization:

agtccagccttgcaagaagcggatacaggagtgcaaaaaatggctatctctagaaaggcctacccctt aggctttatgcaacagaaacaataataatGGAGtcatgaacATG(SEQ ID NO:100)

The sequence of Pm promoter with the 10bp spacer region between RBS and SxtA initiation codon is as follows.RBS and Initiation codon shows that spacer region is marked with underscore with capitalization:

agtccagccttgcaagaagcggatacaggagtgcaaaaaatggctatctctagaaaggcctacccctt aggctttatgcaacagaaacaataataatGGAGtcatgaacatATG(SEQ ID NO:101)

Four kinds of pVB-sxtA plasmids are independently transformed into e. coli bl21 (DE3) sfp.

Prepare the culture of each and receipts in four kinds of e. coli bl21 (DE3) sfp with pVB-sxtA variant Obtain cell.It extracts cell precipitate and analyzes the presence of intermediate 1 by LC-MS.As a result as shown in figure 17.As can be seen that with Synthesis sxtA construct containing 8bp spacer region is compared, the synthesis containing 10bp spacer region between RBS and initiation codon Significantly more intermediate 1 is generated in sxtA construct.

Embodiment 18: intermediate 8 is prepared in the presence of various PPT enzymes

In this experiment, following PPT enzyme is compared:

1.T3PPT: e. coli bl21 (DE3) T3PPT enzyme NSX3v1

2.T3PPT: e. coli bl21 (DE3) T3PPT enzyme NSX3v1pET28B-NsPPT (has and comes from tubercle bacterium The pET carrier of the Phosphopantetheinyl transferase of (Nodularia spumigena))

3.Ala18T3PPT: e. coli bl21 (DE3) T3PPT enzyme NSX3v1pET30b-Ala18T3PPT enzyme (T3PPT Enzyme, wherein removing its preceding 18 amino acid to increase the solubility of expression albumen.)

By bacterial strain in 20ml LB meat soup at 19 DEG C with 200rpm shaken cultivation 18 hours.Bacterial strain with pET carrier exists It is grown in the presence of 50 μ g/ml kanamycins.Culture is grown in the case where no inducer, or in OD₆₀₀At about 0.8 DEG C It is induced with 0.2mM IPTG and 1mM toluic acid.In the case where no inducer, sxt and PPT enzyme gene has apparent background Expression.

Intermediate 8 and neoSTX are measured, and is used as the index of PPT enzyme validity.As a result as shown in figure 18.Ala18T3PPT Highest level is provided, but horizontal reduction after induction.This phenomenon may be due to inhibiting SxtA when PPT enzyme level is excessively high and accounting for According to enzyme.

Embodiment 19: the generation of saxitoxin analog and variant

Saxitoxin can be converted into GTX-5 (sulfonation for passing through carbamyl base side chain) by SxtN.Similarly, Saxitoxin can be converted into 11- hydroxyl STX by SxtDIOX.This is to convert GTX-2/ for STX before C-11 sulfonation The step of 3 (or converting GTX-4/1 for N-STX).

SxtN from Scytonema cf.crispum UCFS15 is cloned into suitable expression vector, is placed in Under the control of IPTG induction type T7 promoter, and hexahistidine tag is provided in itself end N- and C-.

SxtO from S.cf.crispum UCFS15 is cloned into suitable expression vector, IPTG induction is placed in Under the control of type T7 promoter, and hexahistidine tag is provided in itself end N- and C-.

Expression vector purifies Sxt albumen in expression in escherichia coli, and using No-NTA resin (Novagen).In SDS The purity of albumen is assessed on gel.

Use the sulfotransferase activity of saxitoxin or GTX2 test SxtN.Use HPLC-MS/MS measurement result. Use saxitoxin as substrate, identifies the peak at 2.13 minutes be not present in control.It includes m/z 380.10 Main peak, fragmentation (LC-MS/MS) to m/z be 300.14 and 282.13, it is proposed that be GTX5 (as shown in figure 19).It is using When GTX2 is as substrate, difference existing for toxin is not observed between sample and control.

Use the dioxygenase activity of saxitoxin test SxtDIOX.Use HPLC-MS/MS measurement result.It is measuring Substrate is identified in control the two.In addition, identifying the m/z316.14 at 1.66 minutes be not present in control in the assay > 296.13 peak shows that there are hydroxylated saxitoxin (Figure 20).

Sequence

Appended sequence table is entirely incorporated into this as part of specification.

Independent text of sequence table

SEQ ID NO:91

The sequence of sxt1 segment after being integrated into E coli lac operon.

SEQ ID NO:92

It is integrated into the sequence of the sxt3 segment version 1 in Escherichia coli xylose operon.

SEQ ID NO:93

It is integrated into the sequence of the sxt3 segment version 2 in Escherichia coli xylose operon.

SEQ ID NO:94

It is integrated into the sequence of the sxt3 segment version 3 in Escherichia coli xylose operon.

SEQ ID NO:95

It is integrated into the sequence of the sxt1 segment in E coli lac operon.

SEQ ID NO:96

It is integrated into the sequence of the sxt4 segment in Escherichia coli Melibiose operon.

SEQ ID NO:97

It is integrated into the sequence of the sxt2 segment in E. coli. maltose operon.

SEQ ID NO:98

The sequence of the sxt2 segment in maltose operon is integrated into after missing sxtL.

SEQ ID NO:99

It is integrated into the sequence of the sxt2 segment in maltose operon.

Sequence table

<110>Bergen Teknologioverforing AS

University of New South Wales

<120>method

<130> 489.121403/01

<160> 101

<170> PatentIn version 3.5

<210> 1

<211> 252

<212> PRT

<213>cyanobacteria intends column spore algae T3 (Cylindrospermopsis raciborskii T3)

<400> 1

Met Ile Asp Thr Ile Ser Val Leu Leu Arg Glu Trp Thr Val Ile Ser

1 5 10 15

Leu Thr Gly Leu Ala Phe Trp Leu Trp Glu Ile Arg Ser Pro Phe His

20 25 30

Gln Ile Glu Tyr Lys Ala Lys Phe Phe Lys Glu Leu Gly Trp Ala Gly

35 40 45

Ile Ser Phe Val Phe Arg Asn Val Tyr Ala Tyr Val Ser Val Ala Ile

50 55 60

Ile Lys Leu Leu Ser Ser Leu Phe Met Gly Glu Ser Ala Asn Phe Ala

65 70 75 80

Gly Val Met Tyr Val Pro Leu Trp Leu Arg Ile Ile Thr Ala Tyr Ile

85 90 95

Leu Gln Asp Leu Thr Asp Tyr Leu Leu His Arg Thr Met His Ser Asn

100 105 110

Gln Phe Leu Trp Leu Thr His Lys Trp His His Ser Thr Lys Gln Ser

115 120 125

Trp Trp Leu Ser Gly Asn Lys Asp Ser Phe Thr Gly Gly Leu Leu Tyr

130 135 140

Thr Val Thr Ala Leu Trp Phe Pro Leu Leu Asp Ile Pro Ser Glu Val

145 150 155 160

Met Ser Val Val Ala Val His Gln Val Ile His Asn Asn Trp Ile His

165 170 175

Leu Asn Val Lys Trp Asn Ser Trp Leu Gly Ile Ile Glu Trp Ile Tyr

180 185 190

Val Thr Pro Arg Ile His Thr Leu His His Leu Asp Thr Gly Gly Arg

195 200 205

Asn Leu Ser Ser Met Phe Thr Phe Ile Asp Arg Leu Phe Gly Thr Tyr

210 215 220

Val Phe Pro Glu Asn Phe Asp Ile Glu Lys Ser Lys Asn Arg Leu Asp

225 230 235 240

Asp Gln Ser Val Thr Val Lys Thr Ile Leu Gly Phe

245 250

<210> 2

<211> 759

<212> DNA

<400> 2

atgatagata caatatcagt actattaaga gagtggactg taatttttct tacaggttta 60

gccttctggc tttgggaaat tcgctctccc ttgcatcaaa ttgaatacaa agctaaattc 120

ttcaaggaat tgggatgggc gggaatatca ttcgtcttta gaattgttta tgcatatgtt 180

tctgtggcaa ttataaaact attgagttct ctatttatgg gagagtcagc aaattttgca 240

ggagtaatgt atgtgcccct ctggctgagg atcatcactg catatatatt acaggactta 300

actgactatc tattacacag gacaatgcat agtaatcagt ttctttggtt gacgcacaaa 360

tggcatcatt caacaaagca atcatggtgg ctgagtggaa acaaagatag ctttaccggc 420

ggacttttat atactgttac agctttgtgg tttccactgc tggacattcc ctcagaggtt 480

atgtctgtag tggcagtaca tcaagtgatt cataacaatt ggatacacct caatgtaaag 540

tggaactcct ggttaggaat aattgaatgg atttatgtta cgccccgtat tcacactttg 600

catcatcttg atacaggggg aagaaatttg agttctatgt ttactttcat cgaccgatta 660

tttggaacct atgtgtttcc agaaaacttt gatatagaaa aatctaaaaa tagattggat 720

gatcaatcag taacggtgaa gacaattttg ggtttttaa 759

<210> 3

<211> 759

<212> DNA

<400> 3

atgattgata ccattagcgt tctgctgcgt gaatggaccg ttatttttct gaccggtctg 60

gcattttggc tgtgggaaat tcgtagtccg ctgcatcaga ttgaatacaa agccaaattt 120

ttcaaagaac tgggttgggc aggtatcagc tttgtttttc gtattgttta tgcctatgtt 180

agcgtggcca ttatcaaact gctgagcagc ctgtttatgg gtgaaagcgc aaattttgcc 240

ggtgttatgt atgttccgct gtggctgcgt attattaccg catatattct gcaggatctg 300

accgattatc tgctgcatcg taccatgcat agcaatcagt ttctgtggct gacccataaa 360

tggcatcata gcaccaaaca gagttggtgg ctgagcggta ataaagatag ctttaccggt 420

ggtctgctgt ataccgttac cgcactgtgg tttccgctgc tggatattcc gagcgaagtt 480

atgagcgttg ttgcagttca tcaggtgatt cataacaact ggattcacct gaatgtgaaa 540

tggaatagct ggctgggtat tatcgaatgg atttatgtta caccgcgtat ccataccctg 600

catcatctgg ataccggtgg tcgtaatctg agcagtatgt ttacctttat tgatcgtctg 660

tttggcacct atgtgtttcc ggaaaacttt gatatcgaaa aaagcaaaaa ccgcctggat 720

gatcagagcg ttaccgttaa aaccattctg ggtttctga 759

<210> 4

<211> 117

<212> PRT

<400> 4

Met Phe Gln Thr Lys Ser Tyr Tyr Ser Val Val Gly Leu Glu Thr Glu

1 5 10 15

Leu Ile Lys Gly Lys Phe Phe Met Ser Asn Glu Leu Thr Asn Glu Gln

20 25 30

Val Phe Lys Leu Val Cys Met Glu Val Ile Glu Lys Met Gly Phe Ala

35 40 45

His Phe Pro Pro Ile Ile Leu Val Tyr Glu Met Thr Asn Ser Gly Phe

50 55 60

Val Asp Trp Cys Glu Gln Met Val Phe Val Asp Asp Lys Gly Lys Leu

65 70 75 80

Asp Glu Gly Glu Lys Phe Leu Leu Asp Trp Met Arg Arg Asn Val Gly

85 90 95

Asn Phe Asp Leu Ile Arg Glu Leu Met Pro Val Ala Glu Arg Leu Glu

100 105 110

Met Lys Met Arg Ser

115

<210> 5

<211> 354

<212> DNA

<400> 5

atgttccaga ccaagagtta ttactctgtg gtaggattag aaacagaatt gattaaagga 60

aaattcttta tgtctaatga attgacaaac gaacaagtat ttaagctggt ttgtatggaa 120

gtcattgaaa aaatgggatt cgcacacttt cctcccatca ttttagtcta tgagatgact 180

aattccggat ttgtagattg gtgcgagcag atggtttttg ttgatgataa aggtaagcta 240

gatgaaggag aaaaattctt attagactgg atgagacgga acgtaggaaa ctttgatctg 300

atacgtgagt taatgcccgt tgctgaacgt ctagaaatga aaatgaggtc ataa 354

<210> 6

<211> 354

<212> DNA

<400> 6

atgtttcaga ccaaaagcta ttatagcgtc gttggcctgg aaaccgaact gattaaaggt 60

aaattcttca tgagcaacga actgaccaat gaacaggtgt ttaaactggt gtgcatggaa 120

gtgattgaaa aaatgggttt tgcacacttt ccgcctatta tcctggttta tgaaatgacc 180

aattccggct ttgttgattg gtgcgagcag atggtttttg tggatgataa aggcaaactg 240

gatgagggcg aaaaatttct gctggattgg atgcgtcgta atgtgggtaa ttttgatctg 300

attcgcgaac tgatgccggt ggcagaacgc ctggaaatga aaatgcgtag ctaa 354

<210> 7

<211> 318

<212> PRT

<400> 7

Met Thr His Val Ala Leu Glu Gln Ala Ile Ala Lys Val Pro Arg Ser

1 5 10 15

Ile Gln Ser Glu Leu Arg Thr Ile Leu Ala Gln His Ala Val Ile Asp

20 25 30

Ser Ser Val Val Ala Ser Trp Ile Asp Arg Leu Gly Thr Asn Ile Ser

35 40 45

Thr Leu Met Ile Gln Leu Leu Pro Val Ala Ala Thr Tyr Ala Arg Val

50 55 60

Pro Ile Ser Gln Phe Tyr Val Gly Ala Ile Ala Leu Gly Lys Pro Gln

65 70 75 80

Ser Lys Asn Gln Leu Gly Ser Gly Thr Leu Tyr Phe Gly Ala Asp Met

85 90 95

Glu Phe Val Gly Gln Ala Leu Ser Phe Ser Val His Ala Glu Gln Ser

100 105 110

Ala Thr Ile Asn Ala Trp Leu His Gly Glu Thr Gly Leu Gln Ala Leu

115 120 125

Ala Ile His Glu Ala Pro Cys Gly Tyr Cys Arg Gln Phe Leu Tyr Glu

130 135 140

Met Ala Thr Val Asn Gln Asn Phe Val Leu Leu Val Lys Ser Asn Glu

145 150 155 160

Ser Gln Pro Glu Gln Thr Tyr Thr Ser Asn Lys Leu Pro His Phe Leu

165 170 175

Pro Glu Pro Phe Gly Pro Ala Asp Leu Gly Leu Thr Gly Gly Leu Met

180 185 190

Gln Thr Val Phe His Asp Leu Glu Thr Tyr Ser Thr Asp Asp Val Val

195 200 205

Leu Ala Ala Leu Ser Ala Ala Asn Gln Ser Tyr Ala Pro Tyr Thr Lys

210 215 220

Asn Phe Ala Gly Val Ala Leu Lys Asp Ser His Gly Asn Ile Phe Thr

225 230 235 240

Gly Arg Tyr Ala Glu Asn Ala Ala Phe Asn Ser Ser Met Ser Pro Met

245 250 255

Glu Ser Ala Leu Thr Phe Met Asn Met Asn Arg Tyr Ser Gln Ser Leu

260 265 270

Phe Asp Ile Cys Asp Ala Val Leu Val Glu Val Glu Thr Gly Ile Ser

275 280 285

Gln Arg Pro Val Thr Glu Ala Phe Leu Ser Ser Ile Ala Pro Lys Val

290 295 300

Lys Leu Arg Tyr Ala Pro Ala Thr Pro Ser Ser Asn Lys Leu

305 310 315

<210> 8

<211> 957

<212> DNA

<400> 8

atgacccatg tagcattaga acaggcgatt gccaaggttc cacgttccat tcaatcagag 60

ttaaggacaa ttcttgccca acatgctgta attgactcaa gtgttgtcgc atcttggatt 120

gatcgacttg gtactaatat tagtacgtta atgattcaat tactacccgt agccgcaact 180

tatgctaggg taccaatatc gcagttttat gtaggggcga tcgctcttgg taaaccacaa 240

tctaagaatc aactgggttc tggaactctt tattttggtg ccgacatgga atttgtagga 300

caggcactta gtttctcagt tcacgcagaa caatccgcca ccataaatgc gtggttgcac 360

ggagaaaccg gtttacaagc attagcaatc cacgaagcac catgtggata ctgccgacaa 420

tttttatacg agatggcaac tgtaaatcaa aattttgttc ttcttgtgaa gtctaatgaa 480

tcacagcctg agcaaactta tacctcaaat aaactcccac attttctacc cgagccattt 540

ggaccagcgg atctaggact cacaggtgga ttaatgcaaa cagtatttca tgatctggag 600

acctattcta ccgatgatgt tgtgcttgct gctctatccg ctgccaatca aagttatgct 660

ccctacacga aaaattttgc aggggtagcg ttaaaagatt cccacgggaa tatatttaca 720

ggtcgatacg ctgaaaacgc tgcctttaat tcatccatgt ctccgatgga atctgctctg 780

actttcatga atatgaatag atattctcaa tcactattcg acatttgtga tgctgtttta 840

gttgaagtgg aaactgggat tagtcaaaga cccgtcactg aagccttcct ttcttctatc 900

gctcccaagg tcaagttaag gtatgcccct gcaactccgt caagtaataa gttatga 957

<210> 9

<211> 957

<212> DNA

<400> 9

atgacccatg ttgccctgga acaggcaatt gcaaaagttc cgcgtagcat tcagagcgaa 60

ctgcgtacca ttctggcaca gcatgcagtt attgatagca gcgttgtggc aagctggatt 120

gatcgtctgg gcaccaatat tagtaccctg atgatccagc tgctgccggt tgcagcaacc 180

tatgcacgtg ttccgattag ccagttttat gttggtgcca ttgcactggg caaaccgcag 240

agtaaaaatc agctgggtag cggcaccctg tattttggtg cagatatgga atttgttggt 300

caggcactga gctttagcgt tcatgcagaa cagagcgcca ccattaatgc ctggctgcat 360

ggcgaaaccg gactgcaggc actggcaatc catgaagcac cgtgtggtta ttgtcgccag 420

tttctgtatg aaatggcaac cgtgaatcag aattttgtgc tgctggtgaa aagcaatgaa 480

agccagccgg aacagaccta taccagcaac aaactgccgc attttctgcc tgaaccgttt 540

ggtccagccg atctgggtct gaccggtggc ctgatgcaga ccgtgtttca cgatctggaa 600

acctatagca ccgatgatgt tgttctggca gcactgagtg cagcaaatca gagttatgca 660

ccgtatacca aaaactttgc cggtgttgca ctgaaagata gtcatggtaa catttttaca 720

ggtcgctatg ccgaaaacgc agcatttaat agcagcatga gcccgatgga aagcgcactg 780

acctttatga atatgaatcg ttattcacag agcctgttcg atatttgtga tgcagttctg 840

gtagaagtgg aaaccggtat tagtcagcgt ccggttaccg aagcctttct gagtagcatt 900

gcaccgaaag tgaaactgcg ctatgcaccg gcaaccccga gcagtaacaa actgtga 957

<210> 10

<211> 1245

<212> PRT

<400> 10

Met Leu Gln Lys Ile Asn Arg Tyr Thr His Gly Phe Val Ala Val Pro

1 5 10 15

Val Ile Leu Ala Cys Arg Glu Lys Gly Val Phe Glu Leu Leu Ala Asp

20 25 30

Glu Ser Pro Leu Ser Leu Asn Gln Met Val Glu His Leu Gly Ala Asn

35 40 45

Ser Gly His Phe Gln Val Ala Leu Arg Met Leu Glu Ser Leu His Trp

50 55 60

Leu Ser Arg Asn Lys Glu Leu Lys Tyr Ser Leu Thr Ala Glu Ala Ala

65 70 75 80

Ile His Asn Lys Ile Ser Glu Asp Ile Leu Gln Leu Tyr Asn Leu Pro

85 90 95

Ile Gln Ser Tyr Leu Glu Gly Lys Gln Gly Asn Leu Leu Gly Arg Trp

100 105 110

Ile Glu Arg Ser Cys Gln Leu Trp Asn Leu Asp Asn Pro Leu Met Ala

115 120 125

Asp Phe Leu Asp Gly Leu Leu Val Ile Pro Leu Leu Leu Ala Leu His

130 135 140

Lys His Asn Leu Leu Ala Asp Ser Glu Asp Lys Pro Leu Leu Ser Ser

145 150 155 160

Leu Ser Ser Thr Val Gln Glu Glu Leu Gly Lys Leu Phe Leu His Leu

165 170 175

Gly Trp Ala Asp Leu Thr Ala Gly Arg Leu Thr Ile Thr Glu Leu Gly

180 185 190

Arg Phe Met Gly Glu Arg Ala Leu Asn Thr Ala Ile Val Ala Ser Tyr

195 200 205

Thr Pro Met Leu Ser Arg Ile His Asp Val Leu Phe Gly Asn Cys Leu

210 215 220

Ser Val Phe Gln Arg Asp Ala Ser Gly His Glu Arg His Ile Asp Arg

225 230 235 240

Thr Leu Asn Val Ile Gly Ser Gly Phe Gln His Gln Lys Tyr Phe Ala

245 250 255

Asp Leu Glu Glu Ser Ile Leu Ser Val Phe Asn Gln Leu Pro Leu Glu

260 265 270

Glu Gln Pro Lys Tyr Ile Thr Asp Met Gly Cys Gly Asp Gly Thr Leu

275 280 285

Leu Lys Arg Val Trp Glu Thr Ile Gln Phe Lys Ser Ala Arg Gly Lys

290 295 300

Ala Leu Glu Gln Tyr Pro Leu Arg Leu Ile Gly Val Asp Tyr Asn Glu

305 310 315 320

Ala Ser Leu Lys Ala Thr Thr Arg Thr Leu Ala Ser Leu Pro His Leu

325 330 335

Val Leu Gln Gly Asp Ile Gly Asn Pro Glu Gln Met Val Arg Ser Leu

340 345 350

Glu Ala His Gly Ile His Asp Pro Glu Asn Ile Leu His Ile Arg Ser

355 360 365

Phe Leu Asp His Asp Arg Leu Phe Ile Pro Pro Gln Lys Arg Asn Glu

370 375 380

Leu Lys Glu Arg Ala His Leu Pro Tyr Gln Ser Val Cys Val Asp Asp

385 390 395 400

Gln Gly Glu Leu Ile Pro Pro His Val Met Val Gln Ser Leu Val Glu

405 410 415

His Leu Glu Arg Trp Ser Gln Val Val Asn Lys His Gly Leu Met Ile

420 425 430

Leu Glu Val His Cys Leu Glu Pro Arg Val Val Tyr Gln Phe Leu Asp

435 440 445

Lys Ser Glu Asn Leu His Phe Asp Ala Phe Gln Gly Phe Ser Gln Gln

450 455 460

Tyr Leu Val Glu Ala Glu Val Phe Leu Met Ser Ala Ala Gln Val Gly

465 470 475 480

Leu Phe Pro Lys Leu Glu Leu Ser Lys Arg Tyr Pro Lys Thr Phe Pro

485 490 495

Phe Thr Arg Ile Thr Leu Asn Tyr Phe Glu Lys Arg Pro Tyr Lys Ile

500 505 510

Ser His Ala Tyr Leu Ser Asp Leu Pro Ala Leu Val Asp Leu Glu Val

515 520 525

Lys Cys Trp Pro Glu Asn Leu Arg Ala Ser Thr His Glu Ile Arg Arg

530 535 540

Arg Leu Glu Leu Asn Pro Gln Gly Asn Leu Val Leu Ile Ile Glu Asp

545 550 555 560

Gln Ile Ile Gly Ala Ile Tyr Ser Gln Thr Ile Thr Ser Thr Glu Ala

565 570 575

Leu Glu Asn Val Lys Tyr Ala Gln Val Pro Thr Leu His Thr Pro Gln

580 585 590

Gly Ser Val Ile Gln Leu Leu Ala Leu Asn Ile Leu Pro Glu Phe Gln

595 600 605

Ala Arg Gly Leu Gly Asn Glu Leu Arg Asp Phe Met Leu Tyr Tyr Cys

610 615 620

Thr Leu Lys Gly Gly Ile Glu Ser Val Val Gly Val Thr Arg Cys Arg

625 630 635 640

Asn Tyr Val Asn Tyr Ser Gln Met Pro Met Met Glu Tyr Leu Lys Leu

645 650 655

His Asn Glu Gln Arg Gln Leu Leu Asp Pro Ile Val Gly Phe His Val

660 665 670

Ser Gly Gly Ala Glu Ile Arg Gly Ile Ile Ala Asn Tyr Arg Pro Glu

675 680 685

Asp Thr Asp Asn Leu Gly Met Gly Ile Leu Ile Glu Tyr Asn Leu Arg

690 695 700

Asp Ser Ala Leu His Ser Pro Gly Asp Arg Lys Gly Pro Tyr Ile Asn

705 710 715 720

Ser Ala Ile Gly Ser Leu Val Pro Lys Ala Thr Ser Ala Thr Lys Glu

725 730 735

Asn Lys Thr Val Ala Asp Leu Val Lys Glu Cys Ile Leu Lys Val Met

740 745 750

Gly Ser Gln Arg Gln Ala Ala Tyr Ala Pro Gln Gln Lys Leu Leu Asp

755 760 765

Met Gly Leu Asp Ser Leu Asp Leu Leu Glu Leu Gln Thr Leu Leu Glu

770 775 780

Glu Arg Leu Gly Ile Asn Leu Ser Gly Thr Phe Phe Leu Gln Lys Asn

785 790 795 800

Thr Pro Thr Ala Ile Ile Thr Tyr Phe Gln Asn Gln Val Val Gln Glu

805 810 815

Lys Gln Ser Asp Leu Ala Pro Pro Val Asp Ser Ala Asn Glu Ile Asn

820 825 830

Thr Leu Glu Asn Val Val Asn Gln Gln Lys Ile Pro Gln Val Thr Arg

835 840 845

Val Val Thr Glu Gln Gln Gly Arg Lys Val Leu Ile Asp Gly His Trp

850 855 860

Val Ile Asp Phe Ala Ser Cys Asn Tyr Leu Gly Leu Asp Leu His Pro

865 870 875 880

Lys Val Lys Glu Ala Ile Pro Pro Ala Leu Asp Lys Trp Gly Thr His

885 890 895

Pro Ser Trp Thr Arg Leu Val Ala Ser Pro Ala Ile Tyr Glu Glu Leu

900 905 910

Glu Glu Glu Leu Ser Lys Leu Leu Gly Val Pro Asp Val Leu Val Phe

915 920 925

Pro Ala Val Thr Leu Leu Gln Ile Gly Ile Leu Pro Leu Leu Thr Gly

930 935 940

Asn Asn Gly Val Ile Phe Gly Asp Ile Ala Ala His Arg Cys Ile Tyr

945 950 955 960

Glu Ala Cys Cys Leu Ala Gln His Lys Gly Ala Gln Phe Ile Gln Tyr

965 970 975

Arg His Asn Asp Leu Asn Asp Leu Ala Glu Lys Leu Ala Lys Tyr Pro

980 985 990

Pro Glu Gln Val Lys Ile Ile Val Ile Asp Gly Val Tyr Ser Met Ser

995 1000 1005

Ala Asp Phe Pro Asp Leu Pro Ala Tyr Val His Leu Ala Lys Glu

1010 1015 1020

Tyr Asn Ala Leu Ile Tyr Met Asp Asp Ala His Gly Phe Gly Ile

1025 1030 1035

Leu Gly Glu Asn Pro Ser Ser Asp Met Pro Tyr Gly Tyr Lys Gly

1040 1045 1050

Asn Gly Met Val Asn Tyr Phe Asp Leu Arg Phe Ala Glu Asp Asn

1055 1060 1065

Ile Ile Tyr Val Ala Gly Leu Ser Lys Ala Tyr Ser Ser Tyr Ala

1070 1075 1080

Ala Phe Leu Thr Cys Gly Asp Arg Arg Ile Lys Thr Asn Phe Arg

1085 1090 1095

Asn Ala Trp Thr Ala Ile Phe Ser Gly Pro Ser Pro Val Ala Ser

1100 1105 1110

Leu Ala Ser Ala Leu Ala Gly Leu Gln Val Asn Arg Gln Glu Gly

1115 1120 1125

Glu Gln Leu Arg Lys Gln Ile Tyr His Leu Thr His Lys Leu Val

1130 1135 1140

Thr Gln Ala Arg Ala Ile Gly Phe Glu Val Asp Asn Tyr Gly Tyr

1145 1150 1155

Val Pro Ile Val Gly Val Leu Val Gly Asp Ala Gln His Met Ile

1160 1165 1170

Asp Val Cys Gln Leu Leu Trp Glu Tyr Gly Ile Leu Ile Thr Pro

1175 1180 1185

Ala Ile Phe Pro Ile Val Pro Leu Asn Lys Ser Ala Leu Arg Phe

1190 1195 1200

Ser Ile Thr Ala Ala Asn Thr Glu Glu Glu Ile Asp Gln Ala Ile

1205 1210 1215

Lys Ser Leu Lys Ala Val Trp Asp Leu Leu Gln Lys Arg Lys Ala

1220 1225 1230

Leu Pro Cys Lys Gln Glu Glu Asn Ile Leu Lys His

1235 1240 1245

<210> 11

<211> 3738

<212> DNA

<400> 11

atgttacaaa agattaatcg ttatactcac ggctttgtgg cggttcccgt tattcttgcg 60

tgtcgagaaa aaggtgtttt tgaattactc gccgatgaaa gtcctctctc tttaaaccaa 120

atggtggaac atctgggagc taacagcgga cattttcaag ttgctttgag gatgctcgag 180

tctttacatt ggctttcccg aaataaggag cttaaatact ctctaaccgc agaagcagcg 240

attcacaaca aaatttcgga agacattctt caattgtaca acctaccaat tcagtcttat 300

ttagaaggga aacaaggaaa tttgctggga agatggattg agcgttcttg ccaattgtgg 360

aacctggaca atcccctaat ggcagatttt ttagatggat tactggtcat cccactcctg 420

ctggcactgc acaaacacaa cttgcttgca gattcggagg acaaaccttt gctctcctca 480

ttaagctcaa cagtgcaaga agagttgggt aagttatttc tccaccttgg ctgggctgac 540

cttacagcag gtcgtttgac cataaccgaa cttggtcgat ttatgggaga gcgagccttg 600

aatacagcca tagtggcgtc ctacactcct atgttgtccc gcattcatga tgtattgttt 660

ggcaattgtc tctccgtatt ccaaagagat gcttccggtc acgaaaggca cattgatcgc 720

acccttaacg tgatcgggag tggatttcaa caccagaaat attttgccga tttagaagaa 780

agtatcctct cagtattcaa tcagttgcca ttagaagaac aacccaaata cattactgac 840

atggggtgtg gcgatggaac tctcctgaaa cgagtctggg aaaccattca atttaagtct 900

gctaggggaa aagcactcga acagtatccc ctgcgtctta taggtgtaga ttataacgaa 960

gcttctttaa aagctaccac acgcaccctt gctagccttc cccacttagt tttacaggga 1020

gatattggga acccagaaca aatggtgcgt tctttagaag ctcatggcat tcatgatccc 1080

gaaaatatcc tgcacatccg ttcgttcctc gaccatgatc gtctctttat tcctcctcag 1140

aaaagaaacg aattgaaaga acgtgctcac ttaccttacc aatcagtctg tgtcgatgat 1200

caaggagagc ttattcctcc tcatgttatg gtgcaaagtt tggtggaaca cttagaaaga 1260

tggtctcaag tggtcaataa acacggttta atgattttgg aggtccattg tttggaacca 1320

agggtagtct atcagttttt agacaaaagc gaaaacttac atttcgatgc gtttcaggga 1380

ttttctcagc agtatcttgt ggaagctgag gtttttctca tgtctgctgc acaagtaggt 1440

ctatttccaa aactagagct ttctaaaaga tacccaaaaa catttccttt tactcgcatt 1500

acgcttaatt acttcgagaa aagaccttac aaaattagtc atgcctattt gtcagattta 1560

cctgccttag ttgacttgga ggtcaagtgt tggccagaaa atttacgggc atctactcat 1620

gaaattcggc gaagacttga gctaaacccg caaggtaatt tagtgctgat tatagaagat 1680

caaattattg gtgcgattta ttcccaaaca attaccagca ctgaggcatt agagaatgta 1740

aaatatgcgc aagtgccgac gttacatact ccccaagggt cagttattca actgctcgca 1800

ctaaatattc tacctgagtt tcaggcgcgg gggttaggaa atgaattgcg ggactttatg 1860

ctttactact gtaccctgaa aggcggcatt gagagcgtgg tgggtgtaac tcgctgtcga 1920

aattatgtca attattccca aatgccgatg atggagtatt taaagctaca caatgagcaa 1980

cgacagcttc tggatccaat tgtgggtttc catgtgtcgg gaggagccga aattagggga 2040

attattgcta attatcgtcc ggaagataca gataatctcg gcatgggtat tttgattgaa 2100

tataacctgc gcgacagtgc tttgcactcg cctggtgatc gcaaaggacc gtatattaac 2160

tcagcaattg gttcattggt accaaaagca acatctgcaa ctaaggaaaa caaaactgta 2220

gcggatctcg ttaaagaatg catcttaaaa gtaatgggtt cccaacgtca ggcagcctac 2280

gctccacaac aaaaactgct ggatatggga ttagattctt tagatttatt agaactgcaa 2340

acgctcctag aggaacgttt agggatcaat ctgtctggaa cgttcttttt acaaaagaac 2400

actccaactg ccatcatcac ttatttccaa aaccaagtgg tacaagagaa acaatctgat 2460

ctagctccac ctgttgactc agccaacgaa atcaacactc tggaaaacgt agttaaccaa 2520

caaaaaattc ctcaagtcac aagagtcgtc acagaacaac aaggtcgcaa ggtgctaatt 2580

gacggacatt gggtgataga ctttgcttct tgcaactatt taggtcttga cttgcatcca 2640

aaagttaagg aagcaattcc accagctttg gataaatggg gcacacatcc aagctggact 2700

cggcttgttg cttccccagc aatttatgag gaattggagg aagaattgtc caaactttta 2760

ggcgtacctg atgttttagt atttccagct gtaacactgc ttcagatagg aattttacca 2820

ctattaactg ggaataatgg tgtcatcttt ggtgacatag ctgcacatcg ttgtatttat 2880

gaagcgtgct gtctggctca gcacaaagga gcccagttca tccaatatcg acataatgat 2940

ttgaacgatt tagccgaaaa actagcaaaa tatccgcctg aacaagtaaa gattattgtc 3000

attgatggcg tgtattccat gtcggcagat tttcccgatc tgccagctta cgtgcatctg 3060

gcaaaagagt acaatgcctt aatttacatg gatgatgctc atggttttgg cattttgggc 3120

gaaaatccca gcagcgatat gccttacggt tacaaaggaa acgggatggt gaattatttt 3180

gacctgcggt ttgcagagga taatatcatc tatgtagctg gtttgtccaa agcctattct 3240

tcttacgcag cattcttaac ttgtggcgat cgccggatca aaaccaactt ccgcaacgct 3300

tggactgcca tattttctgg tccttctcct gttgcgagtt tggcaagtgc cttagccgga 3360

ttacaggtga atcgtcagga gggggagcag ttaagaaaac aaatttatca cctaactcac 3420

aaattggtta cacaagcaag agccattgga ttcgaagtgg ataactatgg ttacgttccc 3480

atcgtaggcg tgttagtggg agatgctcaa cacatgattg atgtgtgtca actcctttgg 3540

gaatatggta ttttaattac tcctgctatt tttccaatcg tacctttaaa taaaagtgct 3600

ttaaggtttt cgattacagc cgccaatacc gaagaggaga tagaccaagc aattaaatct 3660

ctcaaagcag tttgggattt gctacaaaaa aggaaagctt tgccttgtaa gcaggaggaa 3720

aacatactca agcattaa 3738

<210> 12

<211> 3738

<212> DNA

<400> 12

atgctgcaga aaatcaatcg ttatacccat ggttttgttg ccgttccggt tattctggca 60

tgtcgtgaaa aaggtgtttt tgaactgctg gcagatgaaa gtccgctgag cctgaatcag 120

atggttgaac atctgggtgc caatagcggt cattttcagg ttgcactgcg tatgctggaa 180

agtctgcatt ggctgagccg taataaagaa ctgaaatata gcctgaccgc agaagcagca 240

attcataaca aaattagcga agatatcctg cagctgtata atctgccgat tcagagctat 300

ctggaaggta aacagggcaa tctgctgggt cgttggattg aacgtagctg tcagctgtgg 360

aatctggata atccgctgat ggcagatttt ctggatggtc tgctggttat tccgctgctg 420

ctggcactgc ataaacataa cctgctggcc gattctgaag ataaaccgct gctgagcagc 480

ctgagcagta ccgttcaaga agaactgggt aaactgtttc tgcatctggg ttgggcagat 540

ctgacagcag gtcgtctgac cattaccgaa ctgggtcgct ttatgggtga acgtgcactg 600

aataccgcaa ttgttgcaag ctataccccg atgctgagtc gtattcatga tgttctgttt 660

ggtaattgcc tgagcgtttt tcagcgtgat gcaagcggtc atgaacgtca tattgatcgt 720

accctgaatg ttattggtag cggttttcag caccagaaat actttgcaga tctggaagaa 780

agcattctga gcgtgtttaa tcagctgccg ctggaagaac agccgaaata cattaccgat 840

atgggttgtg gtgatggcac cctgctgaaa cgtgtttggg aaaccattca gtttaaaagc 900

gcacgtggta aagcactgga acagtatccg ctgcgtctga ttggtgttga ttataatgaa 960

gcaagcctga aagcaaccac ccgtaccctg gcaagcctgc cgcatctggt tctgcagggt 1020

gatattggta atccggaaca aatggttcgt agcctggaag cacatggcat tcatgatccg 1080

gaaaatattc tgcatattcg cagctttctg gatcacgatc gtctgtttat tccgcctcag 1140

aaacgtaatg aactgaaaga acgtgcccat ctgccgtatc agagtgtttg tgttgatgat 1200

cagggtgaac tgattcctcc gcatgttatg gttcagagcc tggtggaaca cctggaacgt 1260

tggagccagg ttgttaataa acatggtctg atgattctgg aagtgcattg tctggaaccg 1320

cgtgttgttt atcagtttct ggataaaagc gaaaacctgc actttgatgc atttcagggt 1380

tttagccagc agtatctggt tgaagccgaa gtttttctga tgagcgcagc acaggttggt 1440

ctgtttccga aactggaact gagcaaacgt tatccgaaaa cctttccgtt tacccgtatt 1500

accctgaact atttcgaaaa acgtccgtac aaaatcagcc atgcatatct gagcgatctg 1560

cctgcactgg ttgacctgga agttaaatgt tggcctgaga atctgcgtgc aagcacccat 1620

gaaattcgtc gtcgtctgga actgaatccg cagggtaacc tggttctgat tattgaagat 1680

cagattatcg gtgccattta cagccagacc attacaagca ccgaagccct ggaaaatgtt 1740

aaatatgcac aggttccgac cctgcataca ccgcagggtt cagtgattca gctgctggcc 1800

ctgaacattc tgccggaatt tcaggcacgt ggtctgggca atgaactgcg tgattttatg 1860

ctgtattatt gcaccctgaa aggtggtatt gaaagcgttg ttggtgttac ccgttgtcgc 1920

aattatgtga attatagcca gatgccgatg atggaatatc tgaaactgca taatgaacag 1980

cgtcaactgc tggatccgat tgttggtttt catgttagcg gtggtgcaga aattcgtggc 2040

attattgcaa attatcgtcc ggaagataca gataatctgg gtatgggtat tctgatcgaa 2100

tataacctgc gtgatagcgc actgcattca ccgggtgatc gtaaaggtcc gtatatcaat 2160

agcgcaattg gtagcctggt tccgaaagcg accagcgcaa ccaaagaaaa caaaaccgtt 2220

gcggatctgg tgaaagaatg tattctgaaa gtgatgggta gccagcgtca ggcagcatat 2280

gcaccgcagc agaaactgct ggacatgggt ctggatagcc tggatctgct ggaactgcag 2340

accctgctgg aagaacgtct gggtattaat ctgagcggca ccttttttct gcaaaaaaac 2400

accccgaccg ccatcattac ctattttcag aatcaggtcg tgcaagagaa acagagtgat 2460

ctggcaccgc ctgttgatag cgccaatgaa atcaatacac tggaaaacgt tgtgaatcag 2520

cagaaaattc cgcaggttac acgtgttgtt accgaacagc agggacgtaa agttctgatt 2580

gatggtcatt gggttattga ttttgccagc tgtaattatc tgggcctgga cctgcatccg 2640

aaagttaaag aagcaattcc tccggcactg gataaatggg gcacccatcc gagctggacc 2700

cgtctggttg caagtccggc aatttatgag gaactggaag aggaactgtc aaaactgctg 2760

ggtgtgccgg atgttctggt ttttccggca gttacactgc tgcagattgg tattctgcct 2820

ctgctgaccg gtaataatgg tgtgattttt ggcgatattg cagcccatcg ttgtatttat 2880

gaagcatgtt gtctggccca gcataaaggt gcacagttta ttcagtatcg tcataacgac 2940

ctgaatgatc tggccgaaaa actggccaaa tatccgcctg aacaggttaa aatcattgtg 3000

atcgatggtg tgtatagcat gagtgccgat ttcccggacc tgcctgcata tgttcatctg 3060

gcaaaagaat ataacgccct gatctatatg gatgatgcac atggctttgg cattctgggt 3120

gaaaatccga gcagcgatat gccgtatggt tataaaggta atggcatggt gaactacttt 3180

gatctgcgtt ttgccgaaga taacatcatt tatgttgcag gtctgagcaa agcctatagc 3240

agctatgcag catttctgac ctgtggtgat cgtcgtatta aaaccaattt tcgtaatgca 3300

tggaccgcga tttttagcgg tccgagtccg gttgcaagcc tggccagcgc actggcaggt 3360

ctgcaggtta atcgtcaaga aggtgaacag ctgcgcaaac aaatctatca tctgacacat 3420

aaactggtta cccaggctcg tgccattggt tttgaagttg ataattatgg ttatgtgccg 3480

attgtgggtg ttctggtggg tgatgcacag catatgattg atgtgtgcca actgctgtgg 3540

gaatatggta tcctgattac ccctgcaatt tttccgattg tgccgctgaa taaatcagca 3600

ctgcgtttta gcattaccgc agcaaatacc gaagaagaaa ttgatcaggc catcaaaagt 3660

ctgaaagcag tttgggacct gctgcaaaaa cgtaaagccc tgccgtgtaa acaagaagaa 3720

aatatcctga aacattga 3738

<210> 13

<211> 128

<212> PRT

<400> 13

Met Leu Lys Asp Phe Asn Gln Phe Leu Ile Arg Thr Leu Ala Phe Val

1 5 10 15

Phe Ala Phe Gly Ile Phe Leu Thr Thr Gly Val Gly Ile Ala Lys Ala

20 25 30

Asp Tyr Leu Val Lys Gly Gly Lys Ile Thr Asn Val Gln Asn Thr Ser

35 40 45

Ser Asn Gly Asp Asn Tyr Ala Val Ser Ile Ser Gly Gly Phe Gly Pro

50 55 60

Cys Ala Asp Arg Val Ile Ile Leu Pro Thr Ser Gly Val Ile Asn Arg

65 70 75 80

Asp Ile His Met Arg Gly Tyr Glu Ala Ala Leu Thr Ala Leu Ser Asn

85 90 95

Gly Phe Leu Val Asp Ile Tyr Asp Tyr Thr Gly Ser Ser Cys Ser Asn

100 105 110

Gly Gly Gln Leu Thr Ile Thr Asn Gln Leu Gly Lys Leu Ile Ser Asn

115 120 125

<210> 14

<211> 387

<212> DNA

<400> 14

atgttgaaag atttcaacca gtttttaatc agaacactag cattcgtatt cgcatttggt 60

attttcttaa ccactggagt tggcattgct aaagctgact acctagttaa aggtggaaag 120

attaccaatg ttcaaaatac ttcttctaac ggtgataatt atgccgttag tatcagcggt 180

gggtttggtc cttgcgcaga tagagtgatt atcctaccaa cttcaggagt gataaatcga 240

gacattcata tgcgtggcta tgaagccgca ttaactgcac tatccaatgg ctttttagta 300

gatatttacg actatactgg ctcttcttgc agcaatggtg gccaactaac tattaccaac 360

caattaggta agctaatcag caattag 387

<210> 15

<211> 387

<212> DNA

<400> 15

atgctgaaag attttaacca gttcctgatt cgtaccctgg catttgtttt tgcctttggc 60

atttttctga caaccggtgt tggtattgca aaagcagatt atctggtgaa aggtggcaaa 120

attaccaatg ttcagaatac cagcagcaac ggtgataatt atgcagttag cattagcggt 180

ggttttggtc cgtgtgcaga tcgtgttatt attctgccga ccagcggtgt tattaatcgt 240

gatattcaca tgcgtggtta tgaagcagca ctgaccgcac tgagcaatgg ttttctggtt 300

gatatctatg attataccgg tagcagctgt agcaatggtg gccagctgac cattaccaat 360

cagctgggta aactgattag caattga 387

<210> 16

<211> 471

<212> PRT

<400> 16

Met Glu Thr Thr Ser Lys Lys Phe Lys Ser Asp Leu Ile Leu Glu Ala

1 5 10 15

Arg Ala Ser Leu Lys Leu Gly Ile Pro Leu Val Ile Ser Gln Met Cys

20 25 30

Glu Thr Gly Ile Tyr Thr Ala Asn Ala Val Met Met Gly Leu Leu Gly

35 40 45

Thr Gln Val Leu Ala Ala Gly Ala Leu Gly Ala Leu Ala Phe Leu Thr

50 55 60

Leu Leu Phe Ala Cys His Gly Ile Leu Ser Val Gly Gly Ser Leu Ala

65 70 75 80

Ala Glu Ala Phe Gly Ala Asn Lys Ile Asp Glu Val Ser Arg Ile Ala

85 90 95

Ser Gly Gln Ile Trp Leu Ala Val Thr Leu Ser Leu Pro Ala Met Leu

100 105 110

Leu Leu Trp His Gly Asp Thr Ile Leu Leu Leu Phe Gly Gln Glu Glu

115 120 125

Ser Asn Val Leu Leu Thr Lys Thr Tyr Leu His Ser Ile Leu Trp Gly

130 135 140

Phe Pro Ala Ala Leu Ser Ile Leu Thr Leu Arg Gly Ile Ala Ser Ala

145 150 155 160

Leu Asn Val Pro Arg Leu Ile Thr Ile Thr Met Leu Thr Gln Leu Ile

165 170 175

Leu Asn Thr Ala Ala Asp Tyr Val Leu Ile Phe Gly Lys Phe Gly Leu

180 185 190

Pro Gln Leu Gly Leu Ala Gly Ile Gly Trp Ala Thr Ala Leu Gly Phe

195 200 205

Trp Val Ser Phe Thr Leu Gly Leu Ile Leu Leu Ile Phe Ser Leu Lys

210 215 220

Val Arg Asp Tyr Lys Leu Phe Arg Tyr Leu His Gln Phe Asp Lys Gln

225 230 235 240

Ile Phe Val Lys Ile Phe Gln Thr Gly Trp Pro Met Gly Phe Gln Trp

245 250 255

Gly Ala Glu Thr Ala Leu Phe Asn Val Thr Ala Trp Val Ala Gly Tyr

260 265 270

Leu Gly Thr Val Thr Leu Ala Ala His Asp Ile Gly Phe Gln Thr Ala

275 280 285

Glu Leu Ala Met Val Ile Pro Leu Gly Val Gly Asn Val Ala Met Thr

290 295 300

Arg Val Gly Gln Ser Ile Gly Glu Lys Asn Pro Leu Gly Ala Arg Arg

305 310 315 320

Val Ala Ser Ile Gly Ile Thr Ile Val Gly Ile Tyr Ala Ser Ile Val

325 330 335

Ala Leu Val Phe Trp Leu Phe Pro Tyr Gln Ile Ala Gly Ile Tyr Leu

340 345 350

Asn Ile Asn Asn Pro Glu Asn Ile Glu Ala Ile Lys Lys Ala Thr Thr

355 360 365

Phe Ile Pro Leu Ala Gly Leu Phe Gln Met Phe Tyr Ser Ile Gln Ile

370 375 380

Ile Ile Val Gly Ala Leu Val Gly Leu Arg Asp Thr Phe Val Pro Val

385 390 395 400

Ser Met Asn Leu Ile Val Trp Gly Leu Gly Leu Ala Gly Ser Tyr Phe

405 410 415

Met Ala Ile Ile Leu Gly Trp Gly Gly Ile Gly Ile Trp Leu Ala Met

420 425 430

Val Leu Ser Pro Leu Leu Ser Ala Val Ile Leu Thr Val Arg Phe Tyr

435 440 445

Arg Val Ile Asp Asn Leu Leu Ala Asn Ser Asp Asp Met Leu Gln Asn

450 455 460

Ala Ser Val Thr Thr Leu Gly

465 470

<210> 17

<211> 1416

<212> DNA

<400> 17

atggaaacaa cctcaaaaaa atttaagtca gatctgatat tagaagcacg agcaagccta 60

aagttgggaa tccccttagt catttcacaa atgtgcgaaa cgggtattta tacagcgaat 120

gcagtcatga tgggtttact tggtacgcaa gttttggccg ccggtgcttt gggcgcgctc 180

gcttttttga ccttattatt tgcctgccat ggtattctct cagtaggagg atcactagca 240

gccgaagctt ttggggcaaa taaaatagat gaagttagtc gtattgcttc cgggcaaata 300

tggctagcag ttaccttgtc tttacctgca atgcttctgc tttggcatgg cgatactatc 360

ttgctgctat tcggtcaaga ggaaagcaat gtgttattga caaaaacgta tttacactca 420

attttatggg gctttcccgc tgcgcttagt attttgacat taagaggcat tgcctctgct 480

ctcaacgttc cccgattgat aactattact atgctcactc agctgatatt gaataccgcc 540

gccgattatg tgttaatatt cggtaaattt ggtcttcctc aacttggttt ggctggaata 600

ggctgggcaa ctgctctggg tttttgggtt agttttacat tggggcttat cttgctgatt 660

ttctccctga aagttagaga ttataaactt ttccgctact tgcatcagtt tgataaacag 720

atctttgtca aaatttttca aactggatgg cccatggggt ttcaatgggg ggcggaaacg 780

gcactattta acgtcaccgc ttgggtagca gggtatttag gaacggtaac attagcagcc 840

catgatattg gcttccaaac ggcagaactg gcgatggtta taccactcgg agtcggcaat 900

gtcgctatga caagagtagg tcagagtata ggagaaaaaa accctttggg tgcaagaagg 960

gtagcatcga ttggaattac aatagttggc atttatgcca gtattgtagc acttgttttc 1020

tggttgtttc catatcaaat tgccggaatt tatttaaata taaacaatcc cgagaatatc 1080

gaagcaatta agaaagcaac tacttttatc cccttggcgg gactattcca aatgttttac 1140

agtattcaaa taattattgt tggggctttg gtcggtctgc gggatacatt tgttccagta 1200

tcaatgaact taattgtctg gggtcttgga ttggcaggaa gctatttcat ggcaatcatt 1260

ttaggatggg gggggatcgg gatttggttg gctatggttt tgagtccact cctctcggca 1320

gttattttaa ctgttcgttt ttatcgagtg attgacaatc ttcttgccaa cagtgatgat 1380

atgttacaga atgcgtctgt tactactcta ggctga 1416

<210> 18

<211> 1416

<212> DNA

<400> 18

atggaaacca cgagcaaaaa attcaaaagc gatctgattc tggaagcacg tgcaagcctg 60

aaactgggta ttccgctggt tattagccag atgtgtgaaa ccggtattta taccgcaaat 120

gcagttatga tgggtctgct gggcacccag gttctggcag ccggtgctct gggtgcactg 180

gcatttctga ccctgctgtt tgcatgtcat ggtattctga gcgttggtgg tagcctggca 240

gcggaagcat ttggtgcaaa caaaattgat gaagttagcc gtattgcaag cggtcagatt 300

tggctggcag ttaccctgag cctgcctgca atgctgctgc tgtggcatgg tgataccatt 360

ctgctgttat ttggtcaaga agaaagcaac gttctgctga ccaaaaccta tctgcatagc 420

attctgtggg gttttccggc agcactgagt attctgacac tgcgtggtat tgccagcgca 480

ctgaatgttc cgcgtctgat taccattacc atgctgaccc agctgattct gaataccgca 540

gcagattatg ttctgatctt tggtaaattt ggtctgccgc agctgggtct ggcaggtatt 600

ggttgggcaa ccgcactggg tttttgggtt agctttaccc tgggtctgat cctgctgatt 660

tttagcctga aagtgcgtga ttataaactg tttcgttatc tgcaccagtt cgacaagcag 720

atctttgtga aaatctttca gaccggttgg ccgatgggtt ttcagtgggg tgcagaaaca 780

gcactgttta atgttaccgc atgggttgca ggttatctgg gcaccgttac cctggcagca 840

catgatattg gttttcagac agcagaactg gcaatggtta tcccgctggg tgttggtaat 900

gttgcaatga cccgtgttgg tcagagcatt ggtgaaaaaa atccactggg tgcccgtcgt 960

gttgcaagca ttggtattac cattgttggt atttatgcca gcattgttgc cctggttttt 1020

tggctgtttc cgtatcagat tgcaggcatt tatctgaaca ttaataaccc ggaaaacatt 1080

gaagccatca aaaaagccac cacctttatt ccactggcag gtctgtttca gatgttttat 1140

agcattcaga tcattatcgt tggtgcgctg gttggtctgc gtgatacctt tgttccggtt 1200

agcatgaatc tgattgtttg gggtctgggt ttagcaggta gctattttat ggcaattatt 1260

ctgggttggg gtggtattgg tatctggctg gccatggttc tgagtccgct gctgagcgca 1320

gttattctga ccgttcgttt ttatcgcgtg attgataatc tgctggccaa cagtgatgat 1380

atgctgcaga atgcaagcgt taccaccctg ggatga 1416

<210> 19

<211> 377

<212> PRT

<400> 19

Met Thr Asn Gln Asn Asn Gln Glu Leu Glu Asn Asp Leu Pro Ile Ala

1 5 10 15

Lys Gln Pro Cys Pro Val Asn Ser Tyr Asn Glu Trp Asp Thr Leu Glu

20 25 30

Glu Val Ile Val Gly Ser Val Glu Gly Ala Met Leu Pro Ala Leu Glu

35 40 45

Pro Ile Asn Lys Trp Thr Phe Pro Phe Glu Glu Leu Glu Ser Ala Gln

50 55 60

Lys Ile Leu Ser Glu Arg Gly Gly Val Pro Tyr Pro Pro Glu Met Ile

65 70 75 80

Thr Leu Ala His Lys Glu Leu Asn Glu Phe Ile His Ile Leu Glu Ala

85 90 95

Glu Gly Val Lys Val Arg Arg Val Lys Pro Val Asp Phe Ser Val Pro

100 105 110

Phe Ser Thr Pro Ala Trp Gln Val Gly Ser Gly Phe Cys Ala Ala Asn

115 120 125

Pro Arg Asp Val Phe Leu Val Ile Gly Asn Glu Ile Ile Glu Ala Pro

130 135 140

Met Ala Asp Arg Asn Arg Tyr Phe Glu Thr Trp Ala Tyr Arg Glu Met

145 150 155 160

Leu Lys Glu Tyr Phe Gln Ala Gly Ala Lys Trp Thr Ala Ala Pro Lys

165 170 175

Pro Gln Leu Phe Asp Ala Gln Tyr Asp Phe Asn Phe Gln Phe Pro Gln

180 185 190

Leu Gly Glu Pro Pro Arg Phe Val Val Thr Glu Phe Glu Pro Thr Phe

195 200 205

Asp Ala Ala Asp Phe Val Arg Cys Gly Arg Asp Ile Phe Gly Gln Lys

210 215 220

Ser His Val Thr Asn Gly Leu Gly Ile Glu Trp Leu Gln Arg His Leu

225 230 235 240

Glu Asp Glu Tyr Arg Ile His Ile Ile Glu Ser His Cys Pro Glu Ala

245 250 255

Leu His Ile Asp Thr Thr Leu Met Pro Leu Ala Pro Gly Lys Ile Leu

260 265 270

Val Asn Pro Glu Phe Val Asp Val Asn Lys Leu Pro Lys Ile Leu Lys

275 280 285

Ser Trp Asp Ile Leu Val Ala Pro Tyr Pro Asn His Ile Pro Gln Asn

290 295 300

Gln Leu Arg Leu Val Ser Glu Trp Ala Gly Leu Asn Val Leu Met Leu

305 310 315 320

Asp Glu Glu Arg Val Ile Val Glu Lys Asn Gln Glu Gln Met Ile Lys

325 330 335

Ala Leu Lys Asp Trp Gly Phe Lys Pro Ile Val Cys His Phe Glu Ser

340 345 350

Tyr Tyr Pro Phe Leu Gly Ser Phe His Cys Ala Thr Leu Asp Val Arg

355 360 365

Arg Arg Gly Thr Leu Gln Ser Tyr Phe

370 375

<210> 20

<211> 1134

<212> DNA

<400> 20

atgaccaatc aaaataacca agaattagag aacgatttac caatcgccaa gcagccttgt 60

ccggtcaatt cttataatga gtgggacaca cttgaggagg tcattgttgg tagtgttgaa 120

ggtgcaatgt taccggccct agaaccaatc aacaaatgga cattcccttt tgaagaattg 180

gaatctgccc aaaagatact ctctgagagg ggaggagttc cttatccacc agagatgatt 240

acattagcac acaaagaact aaatgaattt attcacattc ttgaagcaga aggggtcaaa 300

gttcgtcgag ttaaacctgt agatttctct gtccccttct ccacaccagc ttggcaagta 360

ggaagtggtt tttgtgccgc caatcctcgc gatgtttttt tggtgattgg gaatgagatt 420

attgaagcac caatggcaga tcgcaaccgc tattttgaaa cttgggcgta tcgagagatg 480

ctcaaggaat attttcaggc aggagctaag tggactgcag cgccgaagcc acaattattc 540

gacgcacagt atgacttcaa tttccagttt cctcaactgg gggagccgcc gcgtttcgtc 600

gttacagagt ttgaaccgac ttttgatgcg gcagattttg tgcgctgtgg acgagatatt 660

tttggtcaaa aaagtcatgt gactaatggt ttgggcatag aatggttaca acgtcacttg 720

gaagacgaat accgtattca tattattgaa tcgcattgtc cggaagcact gcacatcgat 780

accaccttaa tgcctcttgc acctggcaaa atactagtaa atccagaatt tgtagatgtt 840

aataaattgc caaaaatcct gaaaagctgg gacattttgg ttgcacctta ccccaaccat 900

atacctcaaa accagctgag actggtcagt gaatgggcag gtttgaatgt actgatgtta 960

gatgaagagc gagtcattgt agaaaaaaac caggagcaga tgattaaagc actgaaagat 1020

tggggattta agcctattgt ttgccatttt gaaagctact atccattttt aggatcattt 1080

cactgtgcaa cattagacgt tcgccgacgc ggaactcttc agtcctattt ttaa 1134

<210> 21

<211> 1134

<212> DNA

<400> 21

atgaccaatc agaacaacca agagctggaa aatgatctgc cgattgcaaa acagccgtgt 60

ccggttaata gctataatga atgggatacc ctggaagaag ttattgttgg tagcgttgaa 120

ggtgcaatgc tgcctgcact ggaaccgatt aacaaatgga cctttccgtt tgaagaactg 180

gaaagcgcac agaaaattct gagcgaacgt ggtggtgttc cgtatccgcc tgaaatgatt 240

accctggcac ataaagaact gaacgagttt attcatatcc tggaagccga aggtgttaaa 300

gttcgtcgtg ttaaaccggt tgattttagc gttccgttta gcacaccggc atggcaggtt 360

ggtagcggtt tttgtgcagc aaatccgcgt gatgtttttc tggttattgg caacgaaatt 420

atcgaagcac cgatggcaga tcgtaatcgt tattttgaaa cctgggcata tcgcgaaatg 480

ctgaaagaat attttcaggc aggcgcaaaa tggaccgcag caccgaaacc gcagctgttt 540

gatgcacagt atgatttcaa ttttcagttt ccgcagctgg gtgaaccgcc tcgttttgtt 600

gttaccgaat ttgaaccgac ctttgatgca gccgattttg ttcgttgtgg tcgtgatatt 660

tttggccaga aaagccatgt taccaatggt ctgggtattg aatggctgca gcgtcatctg 720

gaagatgaat atcgcattca tatcatcgaa agccattgtc cggaagcact gcatattgat 780

accaccctga tgccgctggc accgggtaaa attctggtta atccggaatt tgtggacgtg 840

aataaactgc cgaaaattct gaaaagctgg gatattctgg ttgcaccgta tccgaatcat 900

attccgcaga atcagctgcg tctggttagc gaatgggcag gtctgaatgt tctgatgctg 960

gatgaagaac gtgtgatcgt ggaaaaaaat caagagcaga tgatcaaagc cctgaaagat 1020

tggggtttta aaccgattgt ttgccacttc gaaagctatt atccgtttct gggtagcttt 1080

cattgtgcaa ccctggatgt tcgtcgtcgt ggcaccctgc agagctattt ttga 1134

<210> 22

<211> 334

<212> PRT

<400> 22

Met Thr Thr Ala Asp Leu Ile Leu Ile Asn Asn Trp Tyr Val Val Ala

1 5 10 15

Lys Val Glu Asp Cys Lys Pro Gly Ser Ile Thr Thr Ala Leu Leu Leu

20 25 30

Gly Val Lys Leu Val Leu Trp Arg Ser Arg Glu Gln Asn Ser Pro Ile

35 40 45

Gln Ile Trp Gln Asp Tyr Cys Pro His Arg Gly Val Ala Leu Ser Met

50 55 60

Gly Glu Ile Val Asn Asn Thr Leu Val Cys Pro Tyr His Gly Trp Arg

65 70 75 80

Tyr Asn Gln Ala Gly Lys Cys Val His Ile Pro Ala His Pro Asp Met

85 90 95

Thr Pro Pro Ala Ser Ala Gln Ala Lys Ile Tyr His Cys Gln Glu Arg

100 105 110

Tyr Gly Leu Val Trp Val Cys Leu Gly Asp Pro Val Asn Asp Ile Pro

115 120 125

Ser Leu Pro Glu Trp Asp Asp Pro Asn Tyr His Asn Thr Cys Thr Lys

130 135 140

Ser Tyr Phe Ile Gln Ala Ser Ala Phe Arg Val Met Asp Asn Phe Ile

145 150 155 160

Asp Val Ser His Phe Pro Phe Val His Asp Gly Gly Leu Gly Asp Arg

165 170 175

Asn His Ala Gln Ile Glu Glu Phe Glu Val Lys Val Asp Lys Asp Gly

180 185 190

Ile Ser Ile Gly Asn Leu Lys Leu Gln Met Pro Arg Phe Asn Ser Ser

195 200 205

Asn Glu Asp Asp Ser Trp Thr Leu Tyr Gln Arg Ile Ser His Pro Leu

210 215 220

Cys Gln Tyr Tyr Ile Thr Glu Ser Ser Glu Ile Arg Thr Ala Asp Leu

225 230 235 240

Met Leu Val Thr Pro Ile Asp Glu Asp Asn Ser Leu Val Arg Met Leu

245 250 255

Val Thr Trp Asn Arg Ser Glu Ile Leu Glu Ser Thr Val Leu Glu Glu

260 265 270

Phe Asp Glu Thr Ile Glu Gln Asp Ile Pro Ile Ile His Ser Gln Gln

275 280 285

Pro Ala Arg Leu Pro Leu Leu Pro Ser Lys Gln Ile Asn Met Gln Trp

290 295 300

Leu Ser Gln Glu Ile His Val Pro Ser Asp Arg Cys Thr Val Ala Tyr

305 310 315 320

Arg Arg Trp Leu Lys Glu Leu Gly Val Thr Tyr Gly Val Cys

325 330

<210> 23

<211> 1005

<212> DNA

<400> 23

atgacaactg ctgacctaat cttaattaac aactggtacg tagtcgcaaa ggtggaagat 60

tgtaaaccag gaagtatcac cacggctctt ttattgggag ttaagttggt actatggcgc 120

agtcgtgaac agaattcccc catacagata tggcaagact actgccctca ccgaggtgtg 180

gctctgtcta tgggagaaat tgttaataat actttggttt gtccgtatca cggatggaga 240

tataatcaag caggtaaatg cgtacatatc ccggctcacc ctgacatgac acccccagca 300

agtgcccaag ccaagatcta tcattgccag gagcgatacg gattagtatg ggtgtgctta 360

ggtgatcctg tcaatgatat accttcatta cccgaatggg acgatccgaa ttatcataat 420

acttgtacta aatcttattt tattcaagct agtgcgtttc gtgtaatgga taatttcata 480

gatgtatctc attttccttt tgtccacgac ggtgggttag gtgatcgcaa ccacgcacaa 540

attgaagaat ttgaggtaaa agtagacaaa gatggcatta gcataggtaa ccttaaactc 600

cagatgccaa ggtttaacag cagtaacgaa gatgactcat ggactcttta ccaaaggatt 660

agtcatccct tgtgtcaata ctatattact gaatcctctg aaattcggac tgcggatttg 720

atgctggtaa caccgattga tgaagacaac agcttagtgc gaatgttagt aacgtggaac 780

cgctccgaaa tattagagtc aacggtacta gaggaatttg acgaaacaat agaacaagat 840

attccgatta tacactctca acagccagcg cgtttaccac tgttaccttc aaagcagata 900

aacatgcaat ggttgtcaca ggaaatacat gtaccgtcag atcgatgcac agttgcctat 960

cgtcgatggc taaaggaact gggcgttacc tatggtgttt gttaa 1005

<210> 24

<211> 1005

<212> DNA

<400> 24

atgacgaccg cagatctgat tctgatcaat aattggtatg ttgtggccaa ggtggaagat 60

tgtaaaccgg gtagcattac caccgcactg ctgctgggtg ttaaactggt tctgtggcgt 120

agccgtgaac agaatagccc gattcagatt tggcaggatt attgtccgca tcgtggtgtt 180

gcactgagca tgggtgaaat tgtgaataat accctggttt gtccgtatca tggttggcgt 240

tataatcagg caggtaaatg tgttcatatt ccggcacatc cggatatgac ccctccggca 300

agcgcacagg caaaaatcta tcattgtcaa gaacgttatg gtctggtttg ggtttgtctg 360

ggtgatccgg ttaatgatat tccgagtctg ccggaatggg atgatccgaa ttatcataat 420

acctgcacca agagctactt tatccaggca agcgcatttc gtgtgatgga taactttatt 480

gatgtgagcc attttccgtt tgtgcatgat ggtggtctgg gcgatcgtaa tcatgcacag 540

attgaagaat ttgaggtgaa agtggataaa gacggtatta gcattggcaa tctgaaactg 600

cagatgcctc gttttaatag cagcaatgaa gatgatagct ggaccctgta tcagcgtatt 660

agccatccgc tgtgtcagta ttatatcacc gaaagcagcg aaattcgtac agcagatctg 720

atgctggtta ccccgattga tgaagataat tcactggttc gtatgctggt gacctggaat 780

cgtagcgaaa ttctggaaag caccgttctg gaagaatttg atgaaaccat tgaacaggat 840

atcccgatta ttcatagcca gcagcctgca cgtctgccgc tgctgccgag caagcagatt 900

aatatgcagt ggctgagcca agaaattcat gttccgagcg atcgttgtac cgttgcatat 960

cgtcgttggc tgaaagaact gggcgttacc tatggtgttt gttga 1005

<210> 25

<211> 612

<212> PRT

<400> 25

Met Gln Ile Leu Gly Ile Ser Ala Tyr Tyr His Asp Ser Ala Ala Ala

1 5 10 15

Met Val Ile Asp Gly Glu Ile Val Ala Ala Ala Gln Glu Glu Arg Phe

20 25 30

Ser Arg Arg Lys His Asp Ala Gly Phe Pro Thr Gly Ala Ile Thr Tyr

35 40 45

Cys Leu Lys Gln Val Gly Thr Lys Leu Gln Tyr Ile Asp Gln Ile Val

50 55 60

Phe Tyr Asp Lys Pro Leu Val Lys Phe Glu Arg Leu Leu Glu Thr Tyr

65 70 75 80

Leu Ala Tyr Ala Pro Lys Gly Phe Gly Ser Phe Ile Thr Ala Met Pro

85 90 95

Val Trp Leu Lys Glu Lys Leu Tyr Leu Lys Thr Leu Leu Lys Lys Glu

100 105 110

Leu Ala Leu Leu Gly Glu Cys Lys Ala Ser Gln Leu Pro Pro Leu Leu

115 120 125

Phe Thr Ser His His Gln Ala His Ala Ala Ala Ala Phe Phe Pro Ser

130 135 140

Pro Phe Gln Arg Ala Ala Val Leu Cys Leu Asp Gly Val Gly Glu Trp

145 150 155 160

Ala Thr Thr Ser Val Trp Leu Gly Glu Gly Asn Lys Leu Thr Pro Gln

165 170 175

Trp Glu Ile Asp Phe Pro His Ser Leu Gly Leu Leu Tyr Ser Ala Phe

180 185 190

Thr Tyr Tyr Thr Gly Phe Lys Val Asn Ser Gly Glu Tyr Lys Leu Met

195 200 205

Gly Leu Ala Pro Tyr Gly Glu Pro Lys Tyr Val Asp Gln Ile Leu Lys

210 215 220

His Leu Leu Asp Leu Lys Glu Asp Gly Thr Phe Arg Leu Asn Met Asp

225 230 235 240

Tyr Phe Asn Tyr Thr Val Gly Leu Thr Met Thr Asn His Lys Phe His

245 250 255

Ser Met Phe Gly Gly Pro Pro Arg Gln Ala Glu Gly Lys Ile Ser Gln

260 265 270

Arg Asp Met Asp Leu Ala Ser Ser Ile Gln Lys Val Thr Glu Glu Val

275 280 285

Ile Leu Arg Leu Ala Arg Thr Ile Lys Lys Glu Leu Gly Val Glu Tyr

290 295 300

Leu Cys Leu Ala Gly Gly Val Gly Leu Asn Cys Val Ala Asn Gly Arg

305 310 315 320

Ile Leu Arg Glu Ser Asp Phe Lys Asp Ile Trp Ile Gln Pro Ala Ala

325 330 335

Gly Asp Ala Gly Ser Ala Val Gly Ala Ala Leu Ala Ile Trp His Glu

340 345 350

Tyr His Lys Lys Pro Arg Thr Ser Thr Ala Gly Asp Arg Met Lys Gly

355 360 365

Ser Tyr Leu Gly Pro Ser Phe Ser Glu Ala Glu Ile Leu Gln Phe Leu

370 375 380

Asn Ser Val Asn Ile Pro Tyr His Arg Cys Val Asp Asn Glu Leu Met

385 390 395 400

Ala Arg Leu Ala Glu Ile Leu Asp Gln Gly Asn Val Val Gly Trp Phe

405 410 415

Ser Gly Arg Met Glu Phe Gly Pro Arg Ala Leu Gly Gly Arg Ser Ile

420 425 430

Ile Gly Asp Ser Arg Ser Pro Lys Met Gln Ser Val Met Asn Leu Lys

435 440 445

Ile Lys Tyr Arg Glu Ser Phe Arg Pro Phe Ala Pro Ser Val Leu Ala

450 455 460

Glu Arg Val Ser Asp Tyr Phe Asp Leu Asp Arg Pro Ser Pro Tyr Met

465 470 475 480

Leu Leu Val Ala Gln Val Lys Glu Asn Leu His Ile Pro Met Thr Gln

485 490 495

Glu Gln His Glu Leu Phe Gly Ile Glu Lys Leu Asn Val Pro Arg Ser

500 505 510

Gln Ile Pro Ala Val Thr His Val Asp Tyr Ser Ala Arg Ile Gln Thr

515 520 525

Val His Lys Glu Thr Asn Pro Arg Tyr Tyr Glu Leu Ile Arg His Phe

530 535 540

Glu Ala Arg Thr Gly Cys Ala Val Leu Val Asn Thr Ser Phe Asn Val

545 550 555 560

Arg Gly Glu Pro Ile Val Cys Thr Pro Glu Asp Ala Tyr Arg Cys Phe

565 570 575

Met Arg Thr Glu Met Asp Tyr Leu Val Met Glu Asn Phe Leu Leu Val

580 585 590

Lys Ser Glu Gln Pro Arg Gly Asn Ser Asp Glu Ser Trp Gln Lys Glu

595 600 605

Phe Glu Leu Asp

610

<210> 26

<211> 1839

<212> DNA

<400> 26

atgcagatct taggaatttc agcttactac cacgatagtg ctgccgcgat ggttatcgat 60

ggcgaaattg ttgctgcagc tcaggaagaa cgtttctcaa gacgaaagca cgatgctggg 120

tttccgactg gagcgattac ttactgtcta aaacaagtag gaaccaagtt acaatatatc 180

gatcaaattg ttttttacga caagccatta gtcaaatttg agcggttgct agaaacatat 240

ttagcatatg ccccaaaggg atttggctcg tttattactg ctatgcccgt ttggctcaaa 300

gaaaagcttt acctaaaaac acttttaaaa aaagaattgg cgcttttggg ggagtgcaaa 360

gcttctcaat tgcctcctct actgtttacc tcacatcacc aagcccatgc ggccgctgct 420

ttttttccca gtccttttca gcgtgctgcc gttctgtgct tagatggtgt aggagagtgg 480

gcaactactt ctgtctggtt gggagaagga aataaactca caccacaatg ggaaattgat 540

tttccccatt ccctcggttt gctttactca gcgtttacct actacactgg gttcaaagtt 600

aactcaggtg agtacaaact catgggttta gcaccctacg gggaacccaa atatgtggac 660

caaattctca agcatttgtt ggatctcaaa gaagatggta cttttaggtt gaatatggac 720

tacttcaact acacggtggg gctaaccatg accaatcata agttccatag tatgtttgga 780

ggaccaccac gccaggcgga aggaaaaatc tcccaaagag acatggatct ggcaagttcg 840

atccaaaagg tgactgaaga agtcatactg cgtctggcta gaactatcaa aaaagaactg 900

ggtgtagagt atctatgttt agcaggtggt gtcggtctca attgcgtggc taacggacga 960

attctccgag aaagtgattt caaagatatt tggattcaac ccgcagcagg agatgccggt 1020

agtgcagtgg gagcagcttt agcgatttgg catgaatacc ataagaaacc tcgcacttca 1080

acagcaggcg atcgcatgaa aggttcttat ctgggaccta gctttagcga ggcggagatt 1140

ctccagtttc ttaattctgt taacataccc taccatcgat gcgttgataa cgaacttatg 1200

gctcgtcttg cagaaatttt agaccaggga aatgttgtag gctggttttc tggacgaatg 1260

gagtttggtc cgcgtgcttt gggtggccgt tcgattattg gcgattcacg cagtccaaaa 1320

atgcaatcgg tcatgaacct gaaaattaaa tatcgtgagt ccttccgtcc atttgctcct 1380

tcagtcttgg ctgaacgagt ctccgactac ttcgatcttg atcgtcctag tccttatatg 1440

cttttggtag cacaagtcaa agagaatctg cacattccta tgacacaaga gcaacacgag 1500

ctatttggga tcgagaagct gaatgttcct cgttcccaaa ttcccgcagt cactcacgtt 1560

gattactcag ctcgtattca gacagttcac aaagaaacga atcctcgtta ctacgagtta 1620

attcgtcatt ttgaggcacg aactggttgt gctgtcttgg tcaatacttc gtttaatgtc 1680

cgcggcgaac caattgtttg tactcccgaa gacgcttatc gatgctttat gagaactgaa 1740

atggactatt tggttatgga gaatttcttg ttggtcaaat ctgaacagcc acggggaaat 1800

agtgatgagt catggcaaaa agaattcgag ttagattaa 1839

<210> 27

<211> 1839

<212> DNA

<400> 27

atgcagattc tgggtatcag cgcctattat catgatagcg cagcagcaat ggttattgat 60

ggtgaaattg ttgcagcagc acaagaagaa cgttttagcc gtcgtaaaca tgatgcaggt 120

tttccgaccg gtgcaattac ctattgtctg aaacaggttg gcaccaaact gcagtatatt 180

gatcagatcg tgttctatga taaaccgctg gtgaaatttg aacgtctgct ggaaacctat 240

ctggcctatg caccgaaagg ttttggtagt tttattaccg caatgccggt gtggctgaaa 300

gagaaactgt atctgaaaac cctgctgaaa aaagaactgg cactgctggg tgaatgtaaa 360

gcaagccagc tgcctccgct gctgtttacc agccatcatc aggcacatgc agcagcagca 420

ttttttccga gcccgtttca gcgtgcagca gttctgtgtc tggatggtgt tggtgaatgg 480

gcaaccacca gtgtttggct gggtgaaggt aataaactga caccgcagtg ggaaattgat 540

tttccgcata gcctgggcct gctgtatagc gcatttacct attataccgg ctttaaagtg 600

aacagcggtg agtataaact gatgggtctg gcaccgtatg gtgaaccgaa atatgttgat 660

cagattctga aacatctgct ggatctgaaa gaagatggca cctttcgtct gaacatggat 720

tatttcaatt ataccgttgg tctgaccatg accaaccata aatttcatag catgtttggt 780

ggtccgcctc gtcaggcaga aggtaaaatt agccagcgtg atatggatct ggcaagcagc 840

attcagaaag ttaccgaaga agtgattctg cgtctggcac gtaccattaa gaaagaatta 900

ggtgttgaat acctgtgtct ggcaggcggt gttggtctga attgtgttgc aaatggtcgt 960

attctgcgtg agagcgattt taaagatatt tggattcagc ctgcagccgg tgatgcaggt 1020

agcgcagttg gtgcagcact ggcaatttgg catgaatatc ataaaaaacc gcgtaccagc 1080

accgcaggcg atcgtatgaa aggtagctat ctgggtccga gctttagcga agcagaaatt 1140

ctgcagtttc tgaacagcgt gaatattccg tatcatcgtt gtgtggataa tgaactgatg 1200

gcacgtctgg cggaaattct ggatcagggt aatgttgttg gttggtttag cggtcgtatg 1260

gaatttggtc cgcgtgcact gggtggtcgt agcattattg gtgatagccg tagcccgaaa 1320

atgcagagcg ttatgaatct gaaaatcaaa tatcgcgaaa gcttccgtcc gtttgcaccg 1380

agcgttctgg cagaacgtgt tagcgattat tttgatctgg atcgtccgag cccgtatatg 1440

ctgctggttg cacaggttaa agaaaatctg catattccga tgacccaaga acagcatgaa 1500

ctgtttggta tcgaaaaact gaatgttccg cgtagccaga ttccggcagt tacccatgtt 1560

gattatagcg cacgtattca gaccgttcat aaagaaacca atccgcgtta ttatgaactg 1620

atccgtcatt ttgaagcacg taccggttgt gcagttctgg ttaataccag ctttaatgtt 1680

cgtggtgaac cgattgtgtg tacaccggaa gatgcatatc gttgttttat gcgtaccgag 1740

atggattacc tggtgatgga aaattttctg ctggtgaaaa gcgaacagcc tcgtggtaat 1800

agtgatgaaa gctggcagaa agaatttgag ctggattga 1839

<210> 28

<211> 147

<212> PRT

<400> 28

Met Ser Glu Phe Phe Pro Gln Lys Ser Gly Lys Leu Lys Met Glu Gln

1 5 10 15

Ile Lys Glu Leu Asp Lys Lys Gly Leu Arg Glu Phe Gly Leu Ile Gly

20 25 30

Gly Ser Ile Val Ala Val Leu Phe Gly Phe Leu Leu Pro Val Ile Arg

35 40 45

His His Ser Leu Ser Val Ile Pro Trp Val Val Ala Gly Phe Leu Trp

50 55 60

Ile Trp Ala Ile Ile Ala Pro Thr Thr Leu Ser Phe Ile Tyr Gln Ile

65 70 75 80

Trp Met Arg Ile Gly Leu Val Leu Gly Trp Ile Gln Thr Arg Ile Ile

85 90 95

Leu Gly Val Leu Phe Tyr Ile Met Ile Thr Pro Ile Gly Phe Ile Arg

100 105 110

Arg Leu Leu Asn Gln Asp Pro Met Thr Arg Ile Phe Glu Pro Glu Leu

115 120 125

Pro Thr Tyr Arg Gln Leu Ser Lys Ser Arg Thr Thr Gln Ser Met Glu

130 135 140

Lys Pro Phe

145

<210> 29

<211> 405

<212> DNA

<400> 29

atggaacaga taaaagaact tgacaaaaaa ggattgcgtg agtttggact gattggcggt 60

tctatagtgg cggttttatt cggcttttta ctgccagtta tacgccatca ttccttatca 120

gttatccctt gggttgttgc tggatttctc tggatttggg caataatcgc acctacgact 180

ttaagtttta tttaccaaat atggatgagg attggacttg ttttaggatg gatacaaaca 240

cgaattattt tgggagtttt attttatata atgatcacac caataggatt cataagacgg 300

ctgttgaatc aagatccaat gacgcgaatc ttcgagccag agttgccaac ttatcgccaa 360

ttgagtaagt caagaactac acaaagtatg gagaaaccat tctaa 405

<210> 30

<211> 405

<212> DNA

<400> 30

atggaacaaa ttaaagaact ggataagaaa ggcctgcgtg aatttggtct gattggtggt 60

agcattgttg ccgttctgtt tggttttctg ctgccggtta ttcgtcatca tagcctgagc 120

gttattccgt gggttgttgc aggttttctg tggatttggg caattattgc accgaccacc 180

ctgagcttta tctatcagat ttggatgcgt attggtctgg tgctgggttg gattcagacc 240

cgtattattc tgggtgttct gttctatatt atgattaccc cgatcggttt tattcgtcgt 300

ctgctgaatc aggatccgat gacccgtatt tttgaaccgg aactgccgac ctatcgtcag 360

ctgagcaaaa gccgtaccac ccagagcatg gaaaaaccgt tctga 405

<210> 31

<211> 54

<212> PRT

<400> 31

Met Leu Lys Asp Thr Trp Asp Phe Ile Lys Asp Ile Ala Gly Phe Ile

1 5 10 15

Lys Glu Gln Lys Asn Tyr Leu Leu Ile Pro Leu Ile Ile Thr Leu Val

20 25 30

Ser Leu Gly Ala Leu Ile Val Phe Ala Gln Ser Ser Ala Ile Ala Pro

35 40 45

Phe Ile Tyr Thr Leu Phe

50

<210> 32

<211> 165

<212> DNA

<400> 32

atgctaaaag acacttggga ttttattaaa gacattgccg gatttattaa agaacaaaaa 60

aactatttgt tgattcccct aattatcacc ctggtatcct tgggggcgct gattgtcttt 120

gctcaatctt ctgcgatcgc acctttcatt tacactcttt tttaa 165

<210> 33

<211> 165

<212> DNA

<400> 33

atgttaaaag acacctggga ttttatcaag gatatcgcag gctttatcaa agaacagaaa 60

aactatctgc tgattccgct gattattacc ctggttagcc tgggtgcact gattgttttt 120

gcacagagca gcgcaattgc accgtttatc tataccctgt tttga 165

<210> 34

<211> 432

<212> PRT

<400> 34

Met Ser Asn Phe Lys Gly Ser Val Lys Ile Ala Leu Met Gly Ile Leu

1 5 10 15

Ile Phe Cys Gly Leu Ile Phe Gly Val Ala Phe Val Glu Ile Gly Leu

20 25 30

Arg Ile Ala Gly Ile Glu His Ile Ala Phe His Ser Ile Asp Glu His

35 40 45

Arg Gly Trp Val Gly Arg Pro His Val Ser Gly Trp Tyr Arg Thr Glu

50 55 60

Gly Glu Ala His Ile Gln Met Asn Ser Asp Gly Phe Arg Asp Arg Glu

65 70 75 80

His Ile Lys Val Lys Pro Glu Asn Thr Phe Arg Ile Ala Leu Leu Gly

85 90 95

Asp Ser Phe Val Glu Ser Met Gln Val Pro Leu Glu Gln Asn Leu Ala

100 105 110

Ala Val Ile Glu Gly Glu Ile Ser Ser Cys Ile Ala Leu Ala Gly Arg

115 120 125

Lys Ala Glu Val Ile Asn Phe Gly Val Thr Gly Tyr Gly Thr Asp Gln

130 135 140

Glu Leu Ile Thr Leu Arg Glu Lys Val Trp Asp Tyr Ser Pro Asp Ile

145 150 155 160

Val Val Leu Asp Phe Tyr Thr Gly Asn Asp Ile Val Asp Asn Ser Arg

165 170 175

Ala Leu Ser Gln Lys Phe Tyr Pro Asn Glu Leu Gly Ser Leu Lys Pro

180 185 190

Phe Phe Ile Leu Arg Asp Gly Asn Leu Val Val Asp Ala Ser Phe Ile

195 200 205

Asn Thr Asp Asn Tyr Arg Ser Lys Leu Thr Trp Trp Gly Lys Thr Tyr

210 215 220

Met Lys Ile Lys Asp His Ser Arg Ile Leu Gln Val Leu Asn Met Val

225 230 235 240

Arg Asp Ala Leu Asn Asn Ser Ser Arg Gly Phe Ser Ser Gln Ala Ile

245 250 255

Glu Glu Pro Leu Phe Ser Asp Gly Lys Gln Asp Thr Lys Leu Ser Gly

260 265 270

Phe Phe Asp Ile Tyr Lys Pro Pro Thr Asp Pro Glu Trp Gln Gln Ala

275 280 285

Trp Gln Val Thr Glu Lys Leu Ile Ser Ser Met Gln His Glu Val Thr

290 295 300

Ala Lys Lys Ala Asp Phe Leu Val Val Thr Phe Gly Gly Pro Phe Gln

305 310 315 320

Arg Glu Pro Leu Val Arg Gln Lys Glu Met Gln Glu Leu Gly Leu Thr

325 330 335

Asp Trp Phe Tyr Pro Glu Lys Arg Ile Thr Arg Leu Gly Glu Asp Glu

340 345 350

Gly Phe Ser Val Leu Asn Leu Ser Pro Asn Leu Gln Val Tyr Ser Glu

355 360 365

Gln Asn Asn Ala Cys Leu Tyr Gly Phe Asp Asp Thr Gln Gly Cys Val

370 375 380

Gly His Trp Asn Ala Leu Gly His Gln Val Ala Gly Lys Met Ile Ala

385 390 395 400

Ser Lys Ile Cys Gln Gln Gln Met Arg Glu Ser Ile Leu Pro His Lys

405 410 415

His Asp Pro Ser Ser Gln Ser Ser Pro Ile Thr Gln Ser Val Ile Gln

420 425 430

<210> 35

<211> 1299

<212> DNA

<400> 35

atgagtaact tcaagggttc ggtaaagata gcattgatgg gaatattgat tttttgtggg 60

ctaatctttg gcgtagcatt tgttgaaatt gggttacgta ttgccgggat cgaacacata 120

gcattccata gcattgatga acacaggggg tgggtagggc gacctcatgt ttccgggtgg 180

tatagaaccg aaggtgaagc tcacatccaa atgaatagtg atggctttcg agatcgagaa 240

cacatcaagg tcaaaccaga aaataccttc aggatagcgc tgttgggaga ttcctttgta 300

gagtccatgc aagtaccgtt ggagcaaaat ttggcagcag ttatagaagg agaaatcagt 360

agttgtatag ctttagctgg acgaaaggcg gaagtgatta attttggagt gactggttat 420

ggaacagacc aagaactaat tactctacgg gagaaagttt gggactattc acctgatata 480

gtagtgctag atttttatac tggcaacgac attgttgata actcccgtgc gctgagtcag 540

aaattctatc ctaatgaact aggttcacta aagccgtttt ttatacttag agatggtaat 600

ctggtggttg atgcttcgtt tatcaatacg gataattatc gctcaaagct gacatggtgg 660

ggcaaaactt atatgaaaat aaaagaccac tcacggattt tacaggtttt aaacatggta 720

cgggatgctc ttaacaactc tagtagaggg ttttcttctc aagctataga ggaaccgtta 780

tttagtgatg gaaaacagga tacaaaattg agcgggtttt ttgatatcta caaaccacct 840

actgaccctg aatggcaaca ggcatggcaa gtcacagaga aactgattag ctcaatgcaa 900

cacgaggtga ctgcgaagaa agcagatttt ttagttgtta cttttggcgg tccctttcaa 960

cgagaacctt tagtgcgtca aaaagaaatg caagaattgg gtctgactga ttggttttac 1020

ccagagaagc gaattacacg tttgggtgag gatgaggggt tcagtgtact caatctcagc 1080

ccaaatttgc aggtttattc tgagcagaac aatgcttgcc tatatgggtt tgatgatact 1140

caaggctgtg tagggcattg gaatgcttta ggacatcagg tagcaggaaa aatgattgca 1200

tcgaagattt gtcaacagca gatgagagaa agtatattgc ctcataagca cgacccttca 1260

agccaaagct cacctattac ccaatcagtg atccaataa 1299

<210> 36

<211> 1299

<212> DNA

<400> 36

atgagcaact tcaaaggcag cgttaaaatt gcactgatgg gcattctgat tttttgcggt 60

ctgatttttg gtgtggcctt tgttgaaatt ggtctgcgta ttgcaggcat tgaacatatt 120

gcctttcata gcattgatga acatcgtggt tgggttggtc gtccgcatgt tagcggttgg 180

tatcgtaccg aaggtgaagc acatattcag atgaatagtg atggttttcg tgatcgcgaa 240

cacattaaag tgaaaccgga aaataccttt cgtattgccc tgctgggtga tagctttgtt 300

gaaagcatgc aggttccgct ggaacagaat ctggcagcag ttattgaagg cgaaattagc 360

agctgtattg cactggcagg tcgtaaagcc gaagttatta actttggtgt taccggttat 420

ggcaccgatc aagaactgat taccctgcgt gaaaaagtgt gggattatag tccggatatt 480

gttgtgctgg atttctatac cggtaacgat attgttgata atagccgtgc actgtcccag 540

aaattctatc cgaatgaact gggtagcctg aaaccgtttt ttatcctgcg tgatggtaat 600

ctggttgttg atgcaagctt tatcaacacc gataactatc gtagcaaact gacctggtgg 660

ggtaaaacct atatgaaaat caaagatcat agccgcattc tgcaggtcct gaatatggtt 720

cgtgatgcac tgaataatag cagccgtggt tttagcagcc aggcaattga agaaccgctg 780

tttagtgatg gtaaacagga taccaaactg agcggcttct tcgatatcta taaaccgcct 840

accgatccgg aatggcagca ggcctggcag gttaccgaaa aactgattag tagcatgcag 900

catgaagtga ccgccaaaaa agccgatttt ctggttgtta cctttggcgg tccgtttcag 960

cgcgaaccgc tggttcgtca gaaagaaatg caagaactgg gtctgaccga ttggttttat 1020

ccggaaaaac gtattacccg tctgggtgaa gatgaaggtt ttagcgtgct gaatctgagc 1080

ccgaatctgc aggtttatag cgaacagaat aatgcctgtc tgtatggttt tgatgatacc 1140

cagggttgtg ttggtcattg gaatgcactg ggtcatcagg ttgcaggtaa aatgattgca 1200

agcaaaattt gtcagcagca gatgcgtgaa agcattctgc cgcataaaca tgatccgagc 1260

agccagagca gcccgattac ccagagcgtt attcagtaa 1299

<210> 37

<211> 482

<212> PRT

<400> 37

Met Thr Asn Thr Glu Arg Gly Leu Ala Glu Ile Thr Ser Thr Gly Tyr

1 5 10 15

Lys Ser Glu Leu Arg Ser Glu Ala Arg Val Ser Leu Gln Leu Ala Ile

20 25 30

Pro Leu Val Leu Val Glu Ile Cys Gly Thr Ser Ile Asn Val Val Asp

35 40 45

Val Val Met Met Gly Leu Leu Gly Thr Gln Val Leu Ala Ala Gly Ala

50 55 60

Leu Gly Ala Ile Ala Phe Leu Ser Val Ser Asn Thr Cys Tyr Asn Met

65 70 75 80

Leu Leu Ser Gly Val Ala Lys Ala Ser Glu Ala Phe Gly Ala Asn Lys

85 90 95

Ile Asp Gln Val Ser Arg Ile Ala Ser Gly Gln Ile Trp Leu Ala Leu

100 105 110

Thr Leu Ser Leu Pro Ala Met Leu Leu Leu Trp Tyr Met Asp Thr Ile

115 120 125

Leu Val Leu Phe Gly Gln Val Glu Ser Asn Thr Leu Ile Ala Lys Thr

130 135 140

Tyr Leu His Ser Ile Val Trp Gly Phe Pro Ala Ala Val Gly Ile Leu

145 150 155 160

Ile Leu Arg Gly Ile Ala Ser Ala Val Asn Val Pro Gln Leu Val Thr

165 170 175

Val Thr Met Leu Val Gly Leu Val Leu Asn Ala Pro Ala Asn Tyr Val

180 185 190

Leu Met Phe Gly Lys Phe Gly Leu Pro Glu Leu Gly Leu Ala Gly Ile

195 200 205

Gly Trp Ala Ser Thr Leu Val Phe Trp Ile Ser Phe Leu Val Gly Val

210 215 220

Val Leu Leu Ile Phe Ser Pro Lys Val Arg Asp Tyr Lys Leu Phe Arg

225 230 235 240

Tyr Leu His Gln Phe Asp Arg Gln Thr Val Val Glu Ile Phe Gln Thr

245 250 255

Gly Trp Pro Met Gly Phe Leu Leu Gly Val Glu Ser Val Val Leu Ser

260 265 270

Leu Thr Ala Trp Leu Thr Gly Tyr Leu Gly Thr Val Thr Leu Ala Ala

275 280 285

His Glu Ile Ala Ile Gln Thr Ala Glu Leu Ala Ile Val Ile Pro Leu

290 295 300

Gly Ile Gly Asn Val Ala Val Thr Arg Val Gly Gln Thr Ile Gly Glu

305 310 315 320

Lys Asn Pro Leu Gly Ala Arg Arg Ala Ala Leu Ile Gly Ile Met Ile

325 330 335

Gly Gly Ile Tyr Ala Ser Leu Val Ala Val Ile Phe Trp Leu Phe Pro

340 345 350

Tyr Gln Ile Ala Gly Leu Tyr Leu Lys Ile Asn Asp Pro Glu Ser Met

355 360 365

Glu Ala Val Lys Thr Ala Thr Asn Phe Leu Phe Leu Ala Gly Leu Phe

370 375 380

Gln Phe Phe His Ser Val Gln Ile Ile Val Val Gly Val Leu Ile Gly

385 390 395 400

Leu Gln Asp Thr Phe Ile Pro Leu Leu Met Asn Leu Val Gly Trp Gly

405 410 415

Leu Gly Leu Ala Val Ser Tyr Tyr Met Gly Ile Ile Leu Cys Trp Gly

420 425 430

Gly Met Gly Ile Trp Leu Gly Leu Val Leu Ser Pro Leu Leu Ser Gly

435 440 445

Leu Ile Leu Met Val Arg Phe Tyr Gln Glu Ile Ala Asn Arg Ile Ala

450 455 460

Asn Ser Asp Asp Gly Gln Glu Ser Ile Ser Ile Asp Asn Val Glu Glu

465 470 475 480

Leu Ser

<210> 38

<211> 1449

<212> DNA

<400> 38

atgacaaata ccgaaagagg attagcagaa ataacatcaa caggatataa gtcagagctt 60

agatcggagg cacgagttag cctccaactg gcaattccct tagtccttgt cgaaatatgc 120

ggaacgagta ttaatgtggt ggatgtagtc atgatgggct tacttggtac tcaagttttg 180

gctgctggtg ccttgggtgc gatcgctttt ttatctgtat cgaatacttg ttataatatg 240

cttttgtcgg gggtagcaaa ggcatctgag gcttttgggg caaacaaaat agatcaggtt 300

agtcgtattg cttctgggca aatatggctg gcactcacct tgtctttgcc tgcaatgctt 360

ttgctttggt atatggatac tatattggtg ctatttggtc aagttgaaag caacacatta 420

attgcaaaaa cgtatttaca ctcaattgtg tggggatttc cggcggcagt tggtattttg 480

atattaagag gcattgcctc tgctgtgaac gtcccccaat tggtaactgt gacgatgcta 540

gtagggctgg tcttgaatgc cccggccaat tatgtattaa tgttcggtaa atttggtctt 600

cctgaacttg gtttagctgg aataggctgg gcaagtactt tggttttttg gattagtttt 660

ctagtggggg ttgtcttgct gattttctcc ccaaaagtta gagattataa acttttccgc 720

tacttgcatc agtttgatcg acagacggtt gtggaaattt ttcaaactgg atggcctatg 780

ggttttctac tgggagtgga atcagtagta ttgagcctca ccgcttggtt aacaggctat 840

ttgggaacag taacattagc agctcatgag atcgcgatcc aaacagcaga actggcgata 900

gtgataccac tcggaatcgg gaatgttgcc gtcacgagag taggtcagac tataggagaa 960

aaaaaccctt tgggtgctag aagggcagca ttgattggga ttatgattgg tggcatttat 1020

gccagtcttg tggcagtcat tttctggttg tttccatatc agattgcggg actttattta 1080

aaaataaacg atccagagag tatggaagca gttaagacag caactaattt tctcttcttg 1140

gcgggattat tccaattttt tcatagcgtt caaataattg ttgttggggt tttaataggg 1200

ttgcaggata cgtttatccc attgttaatg aatttggtag gctggggtct tggcttggca 1260

gtaagctatt acatgggaat cattttatgt tggggaggta tgggtatctg gttaggtctg 1320

gttttgagtc cactcctgtc cggacttatt ttaatggttc gtttttatca agagattgcc 1380

aataggattg ccaatagtga tgatgggcaa gagagtatat ctattgacaa cgttgaagaa 1440

ctctcctga 1449

<210> 39

<211> 1449

<212> DNA

<400> 39

atgaccaata ccgaacgtgg tctggccgaa attaccagca ccggttataa aagcgaactg 60

cgtagcgaag cccgtgttag cctgcagctg gcaattcctc tggttctggt tgaaatttgt 120

ggcaccagca ttaatgttgt tgatgttgtg atgatgggtt tactgggtac acaagtgtta 180

gcagcgggtg ccctgggagc aattgccttc ctgagcgtta gcaatacctg ctataatatg 240

ctgctgagtg gtgttgcaaa agcaagcgaa gcctttggag ccaataaaat cgatcaggtt 300

tcacgtattg cctcaggcca gatttggtta gccctgaccc tgtcattacc agccatgctg 360

ttactgtggt atatggatac catcctggtt ctgtttggtc aggttgaaag caataccctg 420

attgcgaaaa catacctgca ttcaattgtg tggggctttc ctgccgcagt tggtatcctg 480

attctgcgtg gcatagcaag tgcagttaac gttcctcagc tggttaccgt gaccatgctg 540

gttggcctgg tgctgaatgc accggctaat tatgtgctga tgttcggcaa attcggttta 600

ccggaattag gcctggctgg cattggctgg gccagcacac tggtgttttg gattagtttt 660

ctggttggtg ttgtgctgct gatattttca ccgaaagttc gcgactacaa actgttccgc 720

tatttacatc agtttgatcg tcagaccgtg gttgagattt ttcagacggg ctggcctatg 780

ggcttcctgc tgggtgtgga aagcgttgtt ctgagcctga ccgcatggct gaccggctat 840

ctgggtacag tgaccttagc agcccatgaa attgcaatcc agactgccga actggcgatt 900

gtgattccgt taggtattgg caatgttgcc gttacccgtg tgggccagac aatcggcgaa 960

aaaaacccgc tgggagcacg ccgtgcagcc ctgattggca ttatgattgg tggcatttat 1020

gcgagcctgg ttgcagtgat tttttggtta ttcccttatc aaatcgcagg cctgtacctg 1080

aaaattaacg atccggaatc aatggaagca gttaaaaccg caacaaactt tctgttttta 1140

gctggcctgt tccagttttt tcatagcgtg cagattattg ttgtgggtgt tctgattggc 1200

ctgcaggata cctttatccc tctgctgatg aatctggtgg gctggggact gggcctggcg 1260

gtttcctatt atatgggtat tatcctgtgc tggggtggca tgggcatctg gttaggtctg 1320

gtactgtcac cgctgctgtc aggcctgatc ctgatggtgc gcttttatca agaaattgcc 1380

aatcgcattg cgaatagcga cgatggccaa gaaagcatta gcattgataa tgttgaagaa 1440

ctgagctaa 1449

<210> 40

<211> 276

<212> PRT

<400> 40

Met Lys Thr Asn Lys His Ile Ala Met Trp Ala Cys Pro Arg Ser Arg

1 5 10 15

Ser Thr Val Ile Thr Arg Ala Phe Glu Asn Leu Asp Gly Cys Val Val

20 25 30

Tyr Asp Glu Pro Leu Glu Ala Pro Asn Val Leu Met Thr Thr Tyr Thr

35 40 45

Met Ser Asn Ser Arg Thr Leu Ala Glu Glu Asp Leu Lys Gln Leu Ile

50 55 60

Leu Gln Asn Asn Val Glu Thr Asp Leu Lys Lys Val Ile Glu Gln Leu

65 70 75 80

Thr Gly Asp Leu Pro Asp Gly Lys Leu Phe Ser Phe Gln Lys Met Ile

85 90 95

Thr Gly Asp Tyr Arg Ser Glu Phe Gly Ile Asp Trp Ala Lys Lys Leu

100 105 110

Thr Asn Phe Phe Leu Ile Arg His Pro Gln Asp Ile Ile Phe Ser Phe

115 120 125

Asp Ile Ala Glu Arg Lys Thr Gly Ile Thr Glu Pro Phe Thr Gln Gln

130 135 140

Asn Leu Gly Met Lys Thr Leu Tyr Glu Val Phe Gln Gln Ile Glu Val

145 150 155 160

Ile Thr Gly Gln Thr Pro Leu Val Ile His Ser Asp Asp Ile Ile Lys

165 170 175

Asn Pro Pro Ser Ala Leu Lys Trp Leu Cys Lys Asn Leu Gly Leu Ala

180 185 190

Phe Asp Glu Lys Met Leu Thr Trp Lys Ala Asn Leu Glu Asp Ser Asn

195 200 205

Leu Lys Tyr Thr Lys Leu Tyr Ala Asn Ser Ala Ser Gly Ser Ser Glu

210 215 220

Pro Trp Phe Glu Thr Leu Arg Ser Thr Lys Thr Phe Leu Ala Tyr Glu

225 230 235 240

Lys Lys Glu Lys Lys Leu Pro Ala Arg Leu Ile Pro Leu Leu Asp Glu

245 250 255

Ser Ile Pro Tyr Tyr Glu Lys Leu Leu Gln His Cys His Ile Phe Glu

260 265 270

Trp Ser Glu His

275

<210> 41

<211> 831

<212> DNA

<400> 41

atgaaaacaa acaaacatat agctatgtgg gcttgtccta gaagtcgttc tactgtaatt 60

acccgtgctt ttgagaactt agatgggtgt gttgtttatg atgagcctct agaggctccg 120

aatgtcttga tgacaactta cacgatgagt aacagtcgta cgttagcaga agaagactta 180

aagcaattaa tactgcaaaa taatgtagaa acagacctca agaaagttat agaacaattg 240

actggagatt taccggacgg aaaattattc tcatttcaaa aaatgataac aggtgactat 300

agatctgaat ttggaataga ttgggcaaaa aagctaacta acttcttttt aataaggcat 360

ccccaagata ttattttttc tttcgatata gcggagagaa agacaggtat cacagaacca 420

ttcacacaac aaaatcttgg catgaaaaca ctttatgaag ttttccaaca aattgaagtt 480

attacagggc aaacaccttt agttattcac tcagatgata taattaaaaa ccctccttct 540

gctttgaaat ggctgtgtaa aaacttaggg cttgcatttg atgaaaagat gctgacatgg 600

aaagcaaatc tagaagactc caatttaaag tatacaaaat tatatgctaa ttctgcgtct 660

ggcagttcag aaccttggtt tgaaacttta agatcgacca aaacatttct cgcctatgaa 720

aagaaggaga aaaaattacc agctcggtta atacctctac tagatgaatc tattccttac 780

tatgaaaaac tcttacagca ttgtcatatt tttgaatggt cagaacactg a 831

<210> 42

<211> 257

<212> PRT

<400> 42

Met Ser Phe Gln Lys Phe Val Gln Glu Ala Ala Tyr Lys Val Ala Pro

1 5 10 15

Phe Lys Pro Asn Arg Phe Ala Lys Ile Ser Glu Arg Glu Asp Lys Cys

20 25 30

Ala Ile Pro Val Pro Ala Trp Arg Ala Leu Leu Ala Asn Arg Asp Leu

35 40 45

Phe Thr Trp Lys Gly Ile Pro Phe Leu Lys Gly Cys Thr Glu Ile Ala

50 55 60

Leu Tyr Ser Met Leu Leu Tyr Glu Leu Arg Pro Lys Thr Ile Ile Glu

65 70 75 80

Ile Gly Ala Leu Ser Gly Gly Ser Ala Ile Trp Leu Ala Asp His Leu

85 90 95

Glu Leu Phe Gln Ile Glu Gly Cys Val Tyr Cys Ile Asp Ile Asp Leu

100 105 110

Ser Leu Leu Asp Glu Lys Ala Lys Thr Asp Ser Arg Val His Phe Leu

115 120 125

Glu Gly Asp Cys Asn Asn Met Gly Ala Ile Met Ser Ser Glu Leu Leu

130 135 140

Ser Gly Leu Ala His Pro Trp Leu Ile Val Glu Asp Ala His Ala Asn

145 150 155 160

Ala Val Gly Val Val Glu Tyr Phe His Glu Asn Gly Leu Lys Ser Gly

165 170 175

Asp Tyr Leu Ile Val Glu Asp Thr Asn Lys Thr Met Trp Glu Leu Asp

180 185 190

Arg Glu Glu Leu Asp Arg Asp Asp Leu Asp Glu Gln Glu Leu Ile Glu

195 200 205

Lys Gly Glu Gln Lys Leu Ala Glu Leu Lys Ser Trp Leu Met Leu His

210 215 220

Glu Asn Glu Tyr Leu Ile Asp Thr Tyr Tyr Gln Asp Met Tyr Gly Tyr

225 230 235 240

Asn Gly Ser Arg Asn Trp Asn Ser Ile Leu Lys Arg Val Glu Lys Asn

245 250 255

Phe

<210> 43

<211> 774

<212> DNA

<400> 43

atgagcttcc aaaaatttgt tcaagaagcc gcctataaag ttgcaccttt caaacctaat 60

cggtttgcca aaatttctga aagagaagat aaatgtgcta ttccagtgcc agcttggaga 120

gcgctcttgg caaaccgcga tttgttcact tggaaaggga tacccttcct gaaagggtgc 180

accgaaatag ctctttattc aatgctcctg tatgagcttc gcccgaaaac aataatcgaa 240

ataggagcat taagcggtgg cagcgcgatt tggctagccg atcacttaga actgttccaa 300

atagaaggtt gtgtctactg tatcgatatc gatctttccc tactcgacga gaaagcaaaa 360

actgactctc gcgttcattt tttagagggg gattgtaaca atatgggtgc aataatgtcg 420

tcggaactgc tttctgggct tgctcatccc tggttgatcg tagaagatgc ccatgctaat 480

gcggtgggag tagttgaata ttttcacgaa aacggtctaa aaagtggaga ctacttgatt 540

gtcgaagata ccaacaaaac tatgtgggag ttggacaggg aggagttgga cagggatgat 600

ttggatgagc aagaattaat agaaaaagga gagcagaaat tagcggagtt aaaaagctgg 660

ttaatgctcc acgaaaatga gtacctcatc gatacgtact atcaagatat gtacggttac 720

aacggctcta gaaactggaa ttctatcctg aaaagagtag aaaaaaattt ttag 774

<210> 44

<211> 774

<212> DNA

<400> 44

atgtcatttc agaaatttgt gcaagaagca gcctataaag tcgcaccgtt taaaccgaat 60

cgttttgcca aaattagcga gcgtgaagat aaatgtgcaa ttccggttcc ggcatggcgt 120

gcactgctgg ccaatcgtga cctgtttacc tggaaaggta ttccgtttct gaaaggttgt 180

accgaaattg cactgtatag catgctgctg tatgaactgc gtccgaaaac gattattgaa 240

attggtgcgc tgagcggtgg tagcgcaatt tggctggcag atcatctgga actgtttcag 300

attgaaggtt gcgtgtattg cattgatatt gatctgtctc tgctggacga aaaagcaaaa 360

accgatagcc gtgttcattt tctggaaggt gattgcaata atatgggtgc aattatgtca 420

agcgagctgc tgagtggtct ggcacatcct tggctgattg ttgaagatgc acatgcaaat 480

gccgttggtg tggttgaata ttttcacgaa aacggtctga aaagtggcga ttacctgatc 540

gtggaagata ccaataaaac aatgtgggaa ctggatcgcg aagaactgga ccgtgatgac 600

ctggatgaac aagaactgat cgaaaaaggt gagcagaaat tagcagaact gaaaagctgg 660

ctgatgctgc atgagaatga atatctgata gatacctact atcaggatat gtatggctat 720

aatggtagcc gtaattggaa cagcattctg aaacgtgtgg aaaagaactt ttaa 774

<210> 45

<211> 108

<212> PRT

<400> 45

Met Ile Glu Leu Val Ser His Lys Leu Cys Ile Asn Cys Asn Val Cys

1 5 10 15

Val Gln Val Cys Pro Thr Asn Val Phe Asp Ala Val Pro Asn Gln Pro

20 25 30

Pro Ala Ile Ala Arg Gln Glu Asp Cys Gln Thr Cys Phe Ile Cys Glu

35 40 45

Ala Tyr Cys Pro Ala Asp Ala Leu Tyr Val Ala Pro Gln Ser His Thr

50 55 60

Asn Val Ala Val Asn Glu Asp Asp Leu Ile Asp Ser Gly Ile Met Gly

65 70 75 80

Glu Tyr Arg Arg Ile Leu Gly Trp Gly Tyr Gly Arg Lys Asn Asn Ser

85 90 95

Glu Leu Asp Thr Asp His Lys Leu Arg Leu Phe Glu

100 105

<210> 46

<211> 327

<212> DNA

<400> 46

atgatcgagc ttgtcagcca taaactctgt attaattgta atgtttgcgt ccaagtatgc 60

cctaccaatg tctttgatgc agttcccaac caaccgcctg cgatcgcccg acaggaagac 120

tgtcaaactt gtttcatctg tgaagcatat tgtcctgcgg atgcgctcta tgttgcgccg 180

caatctcata ccaatgttgc agtcaacgag gatgatttaa ttgacagtgg cattatgggt 240

gaatatcgtc gcatcttagg ttggggatat ggcagaaaaa acaatagcga attggatacc 300

gatcataaac tacggctatt tgaataa 327

<210> 47

<211> 327

<212> DNA

<400> 47

atgattgaac tggtgagcca taagctgtgc attaattgta atgtttgtgt tcaggtgtgc 60

ccgaccaatg tttttgatgc agtgccgaat cagcctccgg caattgcacg ccaagaagat 120

tgtcagacct gttttatttg tgaagcatat tgtcctgcag atgcgctgta tgttgcaccg 180

cagagccata ccaatgttgc agttaacgaa gatgatttaa tcgacagcgg cattatgggt 240

gaatatcgtc gcattctggg ttggggctat ggtcgtaaaa acaatagcga actggatacc 300

gaccataaac tgcgtctgtt tgaatga 327

<210> 48

<211> 550

<212> PRT

<400> 48

Met Asn Leu Thr Leu Asn Lys Glu Glu Lys Gln Leu Leu Thr Ala Tyr

1 5 10 15

Ser Gly Thr Glu Leu Gln Leu Thr Ala Asp Val Leu Val Ile Gly Gly

20 25 30

Gly Pro Ala Ala Ala Trp Ala Ala Trp Ala Ala Gly Ala Gln Gly Val

35 40 45

Lys Val Ile Ile Val Asp Lys Gly Phe Leu Gly Thr Ser Gly Ala Ala

50 55 60

Ala Ala Ser Gly Asn Ser Val Met Ala Pro Ser Pro Glu Asn Trp Glu

65 70 75 80

Lys Asp Val Ser Glu Cys Tyr Ser Lys Gly Asn Asn Leu Ala Asn Leu

85 90 95

Arg Trp Ile Glu Arg Val Ile Glu Lys Ala Trp Leu Ser Leu Pro Leu

100 105 110

Val Glu Asp Trp Gly Tyr Arg Phe Pro Lys Glu Asn Gly Glu Ser Val

115 120 125

Arg Gln Ser Tyr Tyr Gly Pro Glu Tyr Met Arg Val Leu Arg Lys Asn

130 135 140

Leu Leu Arg Val Gly Val Gln Ile Phe Asp Gln Ser Pro Ala Leu Glu

145 150 155 160

Leu Leu Leu Ala Gln Asp Gly Ser Val Ala Gly Ala Arg Gly Val Gln

165 170 175

Arg Gln Asn His Arg Thr Tyr Thr Val Arg Ala Gly Ala Val Val Leu

180 185 190

Ala Asn Gly Gly Cys Ala Phe Leu Ser Lys Ala Leu Gly Cys Asn Thr

195 200 205

Asn Thr Gly Asp Gly Leu Leu Met Ala Val Glu Ala Gly Gly Glu Leu

210 215 220

Ser Ser Met Glu Ala Ser Ser His Tyr Thr Ile Ser Thr Ala Phe Asn

225 230 235 240

Ala Thr Val Thr Arg Ala Ala Pro Phe Tyr Trp Ala Ser Tyr Thr Asp

245 250 255

Glu Ala Gly Asn Asp Leu Gly Gly Tyr Ile Asn Gly Arg Arg Asp Pro

260 265 270

Ser Phe Leu Pro Asn Ala Leu Leu Lys Gly Pro Val Tyr Ala Arg Leu

275 280 285

Asp Arg Ala Thr Pro Glu Ile Gln Ala Leu Val Glu Lys Ser His Phe

290 295 300

Ile Ala Phe Leu Pro Tyr Lys Lys Ala Gly Ile Asp Pro Tyr Thr Glu

305 310 315 320

Arg Val Pro Val Thr Leu Val Leu Glu Gly Thr Val Arg Gly Thr Gly

325 330 335

Gly Ile Arg Ile Val Asn Asp Ser Cys Gly Thr Lys Val Pro Gly Leu

340 345 350

Tyr Ala Ala Gly Asp Ala Ala Ser Arg Glu Phe Leu Ala Gly Ile Ala

355 360 365

Ser Gly Gly Asp Gly Pro Asn Ala Ala Trp Ala Ile Ser Thr Gly Gln

370 375 380

Trp Ala Gly Glu Gly Ala Ala Ala Phe Ala Lys Ser Leu Gly Ala His

385 390 395 400

Val His Glu Arg Val Val Arg Pro Ala Gly Gln Ala Gly Leu Arg Ser

405 410 415

Gln Tyr Pro Gly Ser Glu Thr Phe Asp Ser Glu Ala Val Val Arg Gly

420 425 430

Val Gln Ala Glu Met Phe Pro Leu Glu Lys Asn Tyr Leu Arg Cys Glu

435 440 445

Gln Gly Leu Leu Asp Ser Leu Ala Lys Leu Glu Met Leu Trp Gln Gln

450 455 460

Val Gln Gly Asn Pro Lys Gln Asp Thr Val Arg Asp Leu Glu Phe Ser

465 470 475 480

Arg Arg Ala Ala Ala Leu Val Ser Val Ala Arg Trp Ala Tyr Phe Ser

485 490 495

Ala Leu His Arg Lys Glu Thr Arg Ser Glu His Ile Arg Ile Asp Tyr

500 505 510

Pro Glu Thr Asp Pro Asn Gln Leu Tyr Tyr Gln Ala Thr Gly Gly Leu

515 520 525

Glu Arg Leu Trp Val Arg Arg Asp Trp Val Lys Asp Ala Ser Ala Thr

530 535 540

Pro Pro Val Leu Thr Thr

545 550

<210> 49

<211> 1653

<212> DNA

<400> 49

atgaacttga ctttaaacaa ggaggaaaag caattgctta cagcctatag cggcactgaa 60

ctacaattaa ctgctgacgt gctggtaatt ggtggtggtc ctgccgccgc atgggcagca 120

tgggcggctg gagcccaagg tgtcaaagtc atcattgttg ataaaggttt tctaggtacg 180

agcggtgcag ctgctgccag tggcaatagc gtcatggcac cttctccaga gaattgggag 240

aaagatgtat ccgaatgtta cagcaaagga aataacctcg ctaacttacg ttggattgaa 300

cgtgtaattg aaaaagcttg gctgagtttg cccttagtgg aagattgggg ctatcgtttc 360

cccaaagaaa atggggaatc cgtgcgccag agttattatg gtccggaata tatgcgggta 420

cttcgcaaga acctgttgcg tgtgggtgtg caaattttcg accaaagtcc ggctctagaa 480

ctgttattag cccaggacgg ctccgtggct ggagctagag gtgtacagag gcaaaatcat 540

cgcacctata ccgttcgcgc tggtgcagta gttctagcga atggcggttg tgcattccta 600

agtaaagctt taggttgcaa taccaataca ggcgatggac tgctgatggc ggtggaagct 660

ggcggcgaac tctccagtat ggaagcttcc agtcactata ccatctcgac cgctttcaat 720

gccacagtga caagggctgc tcccttttac tgggctagtt acaccgatga ggcaggtaac 780

gatcttggtg gctatatcaa tggtcgtcgc gatccatcgt tcctgcccaa tgccctcctg 840

aaaggtcccg tttatgctcg tttggatcga gccacacctg aaatccaagc attggttgaa 900

aagtctcact tcatcgcctt tctaccctat aaaaaagctg gcattgaccc ttatacagaa 960

cgagtacctg taacactggt tttagaaggt acagtccgtg gtacaggtgg aattcggatt 1020

gtgaatgata gttgtggtac aaaagttcct ggactgtatg ccgccggaga tgcagcatcg 1080

cgggagtttt tagctgggat agcttctggg ggtgatggtc ctaatgctgc ttgggcaatc 1140

tctacaggac aatgggcagg ggaaggtgca gccgcctttg ccaagagttt gggcgctcat 1200

gtccatgaac gggttgtgcg tccagcaggt caagccggat tacgttccca gtaccctggt 1260

tccgaaacat tcgatagcga ggcagttgtc cgcggtgtac aagccgagat gttcccatta 1320

gagaagaatt acttgcgctg tgagcaggga cttttggatt ccctcgccaa attagaaatg 1380

ctgtggcagc aagtacaagg gaacccgaaa caagatacag tgcgcgatct ggaattttct 1440

cgtcgagcgg ctgctcttgt gtctgtagca cgatgggcat attttagcgc tttacatcgc 1500

aaggaaacgc gtagcgaaca tattcgcata gactatcctg aaaccgatcc aaatcagctt 1560

tattaccaag ccacgggcgg cttagaaagg ctttgggtga gacgggattg ggtgaaggat 1620

gcgagcgcta caccaccagt attaaccact taa 1653

<210> 50

<211> 1653

<212> DNA

<400> 50

atgaacctga ccctgaacaa agaagaaaaa cagctgctga cggcatatag cggcaccgaa 60

ctgcagctga cagcagatgt tctggttatt ggtggtggtc cggcagccgc atgggcagct 120

tgggcagcag gcgcacaggg tgtgaaagtt attattgtgg ataaaggttt tctgggcacc 180

agcggtgccg cagccgcaag cggtaatagc gttatggcac cgtcaccgga aaattgggaa 240

aaagatgtga gcgaatgtta cagcaaaggt aataatctgg caaatctgcg ttggattgaa 300

cgtgttattg aaaaagcctg gctgtcactg ccgctggttg aagattgggg ttatcgtttt 360

cctaaagaaa atggtgaaag cgtgcgtcag agctattatg gtcctgaata tatgcgtgtt 420

ctgcggaaaa atctgctgcg cgttggtgtt cagatctttg atcagtcacc ggcactggaa 480

ttactgctgg cacaggatgg tagcgttgcc ggtgcacgtg gtgtgcagcg tcagaatcat 540

cgtacatata ccgttcgtgc cggtgccgtt gttctggcca atggtggttg cgcatttctg 600

agtaaagcac tgggttgtaa taccaatacc ggtgatggtc tgttaatggc agttgaagcc 660

ggtggtgaac tgagcagtat ggaagccagc agccattata ccattagcac cgcctttaat 720

gcaaccgtta cccgtgcagc tccgttttat tgggcaagct ataccgatga agctggcaat 780

gatctgggtg gctatattaa cggtcgtcgt gatccgagct ttctgccgaa cgcactgctg 840

aaaggtccgg tttatgcacg tctggatcgt gcaacaccgg aaattcaggc gctggtagaa 900

aaaagccatt ttattgcatt tctgccgtac aagaaagccg gtattgatcc gtataccgaa 960

cgtgttccgg ttaccctggt gctggaaggc accgtgcgtg gcaccggtgg tattcgcatt 1020

gttaatgatt catgtggcac caaagttccg ggactgtatg cagcgggtga tgcagcaagc 1080

cgtgaatttc tggcaggcat tgccagcggt ggtgatggac cgaatgcagc atgggcaatt 1140

tcaaccggtc agtgggcagg cgaaggtgca gcagcctttg caaaaagtct gggtgcacat 1200

gttcatgaac gcgttgttcg tccggcaggc caggcaggtc tgcgtagtca gtatccgggt 1260

agcgaaacct ttgatagtga agcagttgtt cgtggcgttc aggcagaaat gtttccgctg 1320

gaaaaaaact atctgcgctg tgaacaggga ctgctggata gcctggcaaa actggaaatg 1380

ctgtggcagc aggttcaggg taatccgaaa caggatacag ttcgtgatct ggaattttca 1440

cgtcgtgcgg cagcactggt tagcgtggca cgttgggcat attttagcgc actgcatcgt 1500

aaagaaaccc gtagcgaaca tatccgtatt gattacccgg aaacggatcc gaatcaactg 1560

tattatcagg caaccggtgg cctggaacgt ctgtgggtgc gtcgtgattg ggttaaagat 1620

gcaagcgcca cccctccggt gctgaccacc tga 1653

<210> 51

<211> 249

<212> PRT

<400> 51

Met Ala Gly Lys Leu Asp Gly Lys Val Ala Ile Ile Thr Gly Ala Ser

1 5 10 15

Ser Gly Ile Gly Glu Ala Thr Ala Phe Ala Leu Ala Ala Glu Gly Ala

20 25 30

Lys Val Ala Ile Ala Ala Arg Arg Ala Glu Leu Leu His Ala Leu Ala

35 40 45

Lys Arg Ile Glu Ala Ser Gly Gly Gln Ala Leu Pro Ile Val Thr Asp

50 55 60

Ile Thr Asp Glu Ser Gln Val Asn His Leu Val Gln Lys Thr Lys Val

65 70 75 80

Glu Leu Gly His Val Asp Ile Leu Val Asn Asn Ala Gly Ile Gly Val

85 90 95

Phe Gly Ala Ile Asp Thr Gly Asn Pro Ala Asp Trp Arg Arg Ala Phe

100 105 110

Asp Val Asn Val Leu Gly Val Leu Tyr Ala Ile His Ala Val Leu Pro

115 120 125

Leu Leu Lys Ala Gln Lys Ser Gly His Ile Val Asn Ile Ser Ser Val

130 135 140

Asp Gly Arg Ile Ala Gln Ser Gly Ala Val Val Tyr Ser Ala Ala Lys

145 150 155 160

Ser Gly Val Asn Ala Leu Ser Glu Ala Leu Arg Gln Glu Val Ser Leu

165 170 175

Asp Asn Ile Arg Val Thr Ile Ile Glu Pro Gly Leu Val Asp Thr Pro

180 185 190

Phe Asn Asp Leu Ile Ser Asp Pro Ile Thr Lys Gln Leu Ser Lys Glu

195 200 205

Gln Leu Ser Thr Ile Thr Pro Leu Gln Ser Glu Asp Ile Ala Arg Ala

210 215 220

Ile Ile Tyr Ala Val Thr Gln Pro Asp His Val Asn Val Asn Glu Ile

225 230 235 240

Leu Ile Arg Pro Thr Ala Glu Asp Asn

245

<210> 52

<211> 750

<212> DNA

<400> 52

atggcaggta aattggatgg aaaagtggcg attattactg gagcttcctc tgggattgga 60

gaggctacag catttgcttt agctgcggag ggggcaaaag ttgcgatcgc cgcaagacgt 120

gctgagcttt tgcatgcact agcaaaacgg attgaagcca gtggtggtca agcattgcct 180

attgttacag atattacaga cgaatctcaa gtaaatcatc tagtccaaaa gaccaaggtt 240

gagctaggac atgtagatat tttggtgaat aatgcaggaa ttggtgtgtt tggtgcaatt 300

gatactggaa atcccgcaga ctggaggcga gcattcgatg tgaatgttct gggagtttta 360

tatgctatcc acgcagtttt gcctcttctg aaggcccaaa aatccggtca tatagtcaat 420

atatcttctg tcgatggcag gatagcgcag tccggtgcgg tcgtttatag tgctgccaaa 480

tcaggcgtca atgctctttc agaagcatta cgccaggagg tatctttaga caacattcgc 540

gttaccatca ttgagccagg tttagtcgat acgccattta atgacttaat ttctgacccg 600

atcacgaaac agcttagtaa agaacaactt agtacaataa cacctttaca aagtgaggat 660

attgcaagag ctataattta tgcagtgaca caacccgatc atgtaaatgt aaatgaaatt 720

ttgattcgac cgactgcaga agataattaa 750

<210> 53

<211> 750

<212> DNA

<400> 53

atggcaggta aactggatgg taaggttgca attattaccg gtgcaagcag cggtattggt 60

gaagccaccg catttgcact ggcagcagaa ggtgcaaaag ttgcaattgc agcccgtcgt 120

gcagaactgt tacatgcact ggccaaacgt attgaagcaa gcggtggtca ggcactgccg 180

attgttaccg atatcaccga tgaaagccag gttaatcatc tggttcagaa aaccaaagtt 240

gaactgggtc atgttgatat cctggtgaat aatgcaggta ttggcgtttt tggtgcaatc 300

gataccggta atccggcaga ttggcgtcgt gcatttgatg ttaatgtgct gggtgttctg 360

tatgcaattc atgcagttct gcctttactg aaagcacaga aaagcggtca tattgtgaat 420

attagcagcg tggatggtcg tattgcacag agcggtgcag ttgtttatag cgcagcaaaa 480

agcggtgtta atgccctgag cgaagcactg cgtcaagaag tgagcctgga taatattcgt 540

gtgaccatta ttgaaccggg tctggtagat accccgttta atgatctgat tagtgatccg 600

attaccaaac agctgagcaa agaacagctg tcaaccatta ctccgctgca gagcgaagat 660

attgcacgtg ccattatcta tgcagttacc cagccggatc atgttaacgt taatgaaatt 720

ctgattcgtc cgaccgcaga ggataattga 750

<210> 54

<211> 334

<212> PRT

<400> 54

Met Thr Thr Thr Asp Pro Ile Leu Ile Asn Asn Trp His Val Val Ala

1 5 10 15

Asn Val Glu Asp Cys Lys Pro Gly Ser Ile Thr Arg Ser Arg Leu Leu

20 25 30

Gly Val Lys Leu Val Leu Trp Arg Ser Tyr Glu Gln Asn Ser Pro Ile

35 40 45

Gln Val Trp Leu Asp Tyr Cys Pro His Arg Gly Val Pro Leu Ser Met

50 55 60

Gly Glu Ile Thr Asn Asn Thr Leu Val Cys Pro Tyr His Gly Trp Arg

65 70 75 80

Tyr Asn Glu Ala Gly Lys Cys Ile Gln Ile Pro Ala His Pro Gly Met

85 90 95

Val Pro Pro Ala Ser Ala Glu Ala Arg Thr Tyr His Ser Gln Glu Arg

100 105 110

Tyr Gly Leu Val Trp Val Cys Leu Gly Asp Pro Val Asn Asp Ile Pro

115 120 125

Ser Phe Pro Glu Trp Asp Asp Pro Asn Tyr His Lys Thr Tyr Thr Lys

130 135 140

Ser Tyr Leu Ile Lys Ala Ser Ala Phe Arg Val Met Asp Asn Ser Leu

145 150 155 160

Asp Val Ser His Phe Pro Phe Ile His Asp Gly Trp Leu Gly Asp Arg

165 170 175

Asn Tyr Thr Lys Val Glu Glu Phe Glu Val Lys Leu Asp Lys Asp Gly

180 185 190

Leu Thr Met Gly Lys Tyr Gln Phe Gln Thr Ser Arg Ile Val Ser His

195 200 205

Ile Glu Asp Asp Ser Trp Val Asn Trp Phe Arg Leu Ser His Pro Leu

210 215 220

Cys Gln Tyr Cys Val Ser Glu Ser Pro Glu Met Arg Ile Val Asp Leu

225 230 235 240

Met Thr Ile Thr Pro Ile Asp Glu Glu Asn Ser Val Leu Arg Met Leu

245 250 255

Ile Met Trp Asn Gly Tyr Glu Thr Leu Glu Ser Lys Met Leu Thr Glu

260 265 270

Tyr Asp Glu Thr Ile Glu Gln Asp Ile Arg Ile Leu His Ala Gln Gln

275 280 285

Pro Val Arg Leu Pro Leu Leu Thr Pro Lys Gln Ile Asn Thr Gln Leu

290 295 300

Phe Ser His Glu Ile His Val Pro Ser Asp Arg Cys Thr Leu Ala Tyr

305 310 315 320

Arg Arg Trp Leu Lys Gln Leu Gly Val Thr Tyr Gly Val Cys

325 330

<210> 55

<211> 1005

<212> DNA

<400> 55

atgacaacta ccgacccaat cttaatcaat aactggcacg tagtcgccaa tgtagaagac 60

tgtaaacctg gaagtatcac cagatctcgt ttgttgggag tgaagttggt attatggcgc 120

agttatgaac aaaattcacc catacaggta tggcttgact actgccccca ccgaggtgtt 180

cctctgtcta tgggagaaat tacgaataat actttagttt gtccgtatca cggatggaga 240

tacaatgagg ctggtaaatg catacagatc ccagctcacc ctggcatggt accaccggca 300

agtgctgaag ccaggacata tcactcccag gagcgctatg gcttagtgtg ggtgtgcttg 360

ggcgatcctg ttaatgatat accttcattt cctgaatggg atgatccgaa ttatcacaag 420

acttatacca agtcttactt gattaaagct agtgcgtttc gtgtgatgga taattcctta 480

gacgtgtctc attttccttt tatccatgac ggttggttag gtgatcgcaa ttatacaaaa 540

gtggaagaat ttgaggtgaa attagataaa gatggcctta ctatgggtaa gtatcaattc 600

cagacatcaa ggattgtcag ccatatcgaa gatgactctt gggttaattg gttcaggctt 660

agtcatcctt tatgtcaata ctgcgtttca gaatcccctg aaatgaggat tgtggattta 720

atgacgatca caccgattga tgaggaaaat agtgtattgc gtatgttgat aatgtggaac 780

gggtatgaaa cgttagagtc aaagatgcta actgaatatg acgaaacaat agaacaagat 840

attcggatct tacatgcaca acagccggta cgtttaccac tgttaactcc aaagcagata 900

aatacacaat tgttttcaca cgaaatccac gtaccatcag atagatgcac acttgcctat 960

cgtcgatggc taaagcaact aggtgttact tatggggttt gttaa 1005

<210> 56

<211> 1005

<212> DNA

<400> 56

atgacaacca ccgatccgat cctgattaat aactggcatg ttgtggcaaa tgtcgaggat 60

tgtaaaccgg gtagcattac ccgtagccgt ttactgggtg ttaaactggt tctgtggcgt 120

agctatgaac agaatagccc gattcaggtt tggctggatt attgtccgca tcgtggtgtt 180

ccgctgagca tgggtgaaat taccaataat accctggttt gtccgtatca tggctggcgt 240

tataatgaag caggtaaatg tattcagatt ccggcacatc cgggtatggt tccgcctgca 300

agcgcagaag cacgtaccta tcatagccaa gaacgttatg gtctggtttg ggtttgtctg 360

ggtgatccgg ttaatgatat tccgtcattt ccggaatggg atgatccgaa ttatcacaaa 420

acctacacca aaagctatct gattaaagca agcgcctttc gcgttatgga taattcactg 480

gatgttagcc attttccgtt tattcatgat ggctggctgg gcgatcgtaa ctataccaaa 540

gtggaagaat ttgaagtgaa actggataaa gatggtctga cgatgggcaa atatcagttt 600

cagaccagcc gtattgtgag ccatattgaa gatgatagct gggtgaattg gtttcgtctg 660

agccatccgc tgtgtcagta ttgtgttagc gaaagtccgg aaatgcgtat tgttgatctg 720

atgaccatta cgccgattga tgaagaaaat agcgttctgc gcatgctgat catgtggaat 780

ggttatgaaa ccctggaaag caaaatgctg acagagtatg atgaaacgat cgaacaggat 840

attcgtattc tgcatgccca gcagccggtg cgtctgccgc tgctgacacc gaagcagatt 900

aatacccagc tgtttagcca tgaaattcat gttccgagcg atcgttgtac cctggcatat 960

cgtcgttggc tgaaacaact gggtgtgacc tatggtgttt gttga 1005

<210> 57

<211> 241

<212> PRT

<400> 57

Met Leu Thr Ala Glu Gln Lys Gln Ala Tyr Thr Asn Asp Gly Tyr Phe

1 5 10 15

Thr Val Glu Glu Ala Val Pro Lys Ala Leu Ile Glu Glu Ile Arg His

20 25 30

Glu Val Glu Leu Ile Thr Glu Gln Lys Arg Gly Gly Val Leu Ala Gly

35 40 45

Asp Tyr Glu Trp Trp Ser Glu His Thr Ile Pro Asp Pro Val Arg Tyr

50 55 60

Gln Lys Ile Ile Gln Arg Leu Leu Glu Leu Pro Thr Val Met Gly Pro

65 70 75 80

Val Gln Ala Leu Ile Gly Ser Asp Ile Phe Leu Leu Ile Thr Asp Leu

85 90 95

Ala Ile Ile Arg Ala Gly Thr Gly Tyr Ile Ala Trp His Gln Asp His

100 105 110

Gly Tyr Val Val Glu Val Leu Asn Ala Leu Ala Ser Met Ser Lys Asn

115 120 125

Glu Leu Asn Asp Asp Ala Leu Arg Leu Leu Val Pro Val Ala Asn Gln

130 135 140

Ala Met Val Phe Ile Thr Ile Tyr Leu Gln Asp Thr Asp Asn Thr Met

145 150 155 160

Gly Thr Met Arg Val Ile Pro Ser Ser His Gln Trp Glu His Ser Leu

165 170 175

Asp Ser Ser Ser Ala Asn Ser Leu Asn Ala Glu Ile Cys Leu Ser Leu

180 185 190

Pro Gly Gly Ala Ala Met Phe Tyr Thr Pro Thr Val Trp His Thr Ala

195 200 205

Ala Ala Asn Thr Ser Ile Thr Asp Tyr Arg Met Leu Thr Leu Ile Phe

210 215 220

Thr Lys Asn Asn Ile Lys Pro Leu Leu Val Asp Ala Leu Lys Arg Ile

225 230 235 240

Ile

<210> 58

<211> 726

<212> DNA

<400> 58

atgctcacag cggaacaaaa acaagcttac acaaatgatg gttatttcac agttgaagaa 60

gctgtaccaa aagcgttaat tgaagaaata cggcatgaag tagaacttat taccgaacaa 120

aaacgtgggg gagtattggc gggtgactat gagtggtggt ctgagcatac tatcccagat 180

ccagttaggt atcaaaagat aattcagagg cttttagagc ttccaactgt gatgggacca 240

gtacaggctc taattgggtc tgatatcttc ctattgatca ccgatctagc cataattcgt 300

gcaggtacag gatacattgc ttggcatcaa gaccatggat atgtagttga agtattgaac 360

gcacttgcat ccatgtcaaa aaacgagtta aatgacgacg cgcttcggtt gttggttcca 420

gtagccaatc aagccatggt attcataact atatacttac aggatacaga taatactatg 480

ggtacaatgc gagttatacc aagtagccac caatgggaac actcattaga ttcatcttct 540

gccaattcac taaatgcaga aatatgtctt tcacttccag gaggggcagc aatgttttat 600

acaccaactg tatggcatac cgcagctgcc aacacttcaa ttaccgatta caggatgcta 660

actctgattt ttacaaaaaa caacatcaaa ccactgttgg tggatgcctt gaaaaggata 720

atttag 726

<210> 59

<211> 726

<212> DNA

<400> 59

atgctgaccg cagaacagaa acaggcatat accaatgatg gctattttac cgtggaagaa 60

gcagttccga aagcactgat tgaagaaatt cgccatgaag tggaactgat caccgagcag 120

aaacgtggtg gtgtgctggc aggcgattat gaatggtggt cagaacacac cattccggat 180

ccggttcgtt atcagaaaat tatccagcgt ctgctggaac tgccgaccgt tatgggtccg 240

gttcaggccc tgattggtag cgatattttt ctgttaatta ccgacctggc aattattcgt 300

gcaggcaccg gttatattgc atggcatcag gatcatggct atgttgttga agttctgaac 360

gccctggcaa gcatgagcaa aaatgagctg aatgatgatg cactgcgcct gctggtgccg 420

gttgcaaatc aggcaatggt gtttattacc atctatctgc aggataccga taacaccatg 480

ggcaccatgc gtgtgattcc gagcagccat cagtgggaac atagtctgga tagcagcagc 540

gccaattcac tgaatgcaga aatttgtctg agcctgcctg gtggtgcagc aatgttttat 600

accccgaccg tttggcatac cgcagcagca aataccagca ttaccgatta tcgtatgctg 660

acgctgatct tcaccaaaaa caacattaaa ccgctgctgg ttgatgccct gaaacgtatt 720

atttga 726

<210> 60

<211> 191

<212> PRT

<400> 60

Met Ile Asn Ile Glu Gln Phe Arg Gln Glu Ile Glu Asp Trp Ile Ile

1 5 10 15

Asn Val Val Ser Ile Pro Asn Pro Leu Thr Gly Asn Phe Pro Pro Cys

20 25 30

Pro Tyr Ala Lys Ala Ala Trp Leu Asn Asn Arg Val Ser Val Arg Trp

35 40 45

Phe His Gly Pro Glu Leu Pro Glu Leu Leu Met Glu Gln Ile Arg Thr

50 55 60

Trp Asn Asn Asp Phe Glu Met Val Ile Phe Gly Cys Asp Pro Gln Asn

65 70 75 80

Leu Asp Ala Gln Arg Leu Glu Arg Tyr Ile Thr Lys Ala Asn Tyr Val

85 90 95

Leu Pro Glu Tyr Asp Leu Val Ala Leu Gly Ser His Pro Asp Lys Gln

100 105 110

Tyr Val Gly Asp Asp Ala Glu Asn Val Asn Asn Val Ile Ile Thr His

115 120 125

Pro Lys Tyr Val Leu Ala Ser Val Gln Ser Phe Ser Gln Leu Gln Glu

130 135 140

Ala Ser Asp Glu Leu Leu Arg Leu Gly Tyr Phe Gln Tyr Trp Ser Ala

145 150 155 160

Glu Lys Leu Ala Glu Met Lys Ser Glu Arg Ala Ser His Asn Leu Ser

165 170 175

Ser Ile Gln Arg Lys Asn Ser Tyr Arg Ile Ile Pro Thr Asn His

180 185 190

<210> 61

<211> 576

<212> DNA

<400> 61

atgataaata tcgaacaatt tcgccaagaa atagaggatt ggattatcaa tgttgtcagc 60

attcccaatc ctctaacagg aaattttcca ccctgtcctt acgcgaaggc agcttggtta 120

aataaccgtg ttagtgttcg ttggtttcat ggacctgaac tgccagagct tctaatggaa 180

cagataagaa catggaataa tgactttgaa atggtgattt ttggctgcga ccctcaaaac 240

ctagatgcac agaggttgga aaggtacatt accaaggcga attatgtatt accagaatac 300

gatttggtag ctttaggatc gcatccagac aaacaatatg ttggtgatga cgcggagaat 360

gtgaataacg taatcataac tcaccctaag tatgttttag catcagtaca gtcattcagc 420

cagttacaag aggctagtga tgaattatta agattgggat attttcagta ttggtctgca 480

gaaaaattgg ctgaaatgaa gtcggagcga gcttctcaca acctttcttc tatccagaga 540

aagaacagct ataggataat tcctactaac cattga 576

<210> 62

<211> 576

<212> DNA

<400> 62

atgatcaaca tcgaacagtt tcgccaagaa atcgaagatt ggattattaa cgttgtcagc 60

attccgaacc cgctgaccgg taattttcct ccgtgtccgt atgcaaaagc agcatggctg 120

aataatcgtg ttagcgtgcg ttggtttcat ggtccggaac tgcctgaact gctgatggaa 180

caaattcgta catggaacaa cgatttcgag atggtgattt ttggttgcga tcctcagaat 240

ctggatgcac agcgtctgga acgttatatc accaaagcaa attatgtgct gcccgaatat 300

gacctggttg cactgggtag ccatccggat aaacagtatg ttggtgatga tgccgaaaat 360

gtgaacaacg tgattattac ccatccgaaa tatgttctgg caagcgttca gagctttagc 420

cagctgcaag aggcaagtga tgagctgctg cgtctgggtt atttccagta ttggtcagca 480

gaaaaactgg ccgaaatgaa aagcgaacgt gcaagccata atctgagcag cattcagcgt 540

aaaaatagct atcgtattat cccgaccaac cattga 576

<210> 63

<211> 258

<212> PRT

<400> 63

Met Thr Ile Gln Ile Val Gln His Asn Leu Glu Tyr Ser Phe Val Thr

1 5 10 15

Pro Lys Glu Thr Ser Asp Phe Val Glu Arg Thr Met Ser Val Phe Asp

20 25 30

Gln Ala Tyr Pro Lys Phe Leu Ile His Asp Val Trp Ala Asp Pro Ala

35 40 45

Ser Leu Ala Leu Phe Glu Ile Tyr Pro Glu Phe Gln Phe Gly Leu Val

50 55 60

Glu Ala Thr Thr Gln Leu Met Ile Ala Gln Gly Asn Cys Ile Pro Leu

65 70 75 80

Thr Tyr Glu Ser Arg Phe Asp Glu Leu Pro Asp Glu Gly Cys Asp Trp

85 90 95

Ala Leu Ala Lys Trp Leu Glu Asp Arg Glu Gln Asn Arg Leu Pro Asn

100 105 110

Ala Leu Cys Val Val Ser Ile Ser Ile Leu Pro Glu Tyr Gln Gly Lys

115 120 125

Asn Leu Ser Gln Tyr Leu Ile Gly Tyr Met Lys Glu Leu Ala Gln Tyr

130 135 140

His Gly Leu Asn Ser Leu Ile Met Ala Ala Arg Pro Ser Leu Lys Tyr

145 150 155 160

Leu Tyr Pro Leu Ile Pro Ile Glu Arg Tyr Ile Thr Trp Arg Asp Lys

165 170 175

Asn Gly Leu Ile Phe Asp Pro Trp Leu Arg Val Asn Val Lys His Gly

180 185 190

Ala Lys Ile Ala Gly Ile Cys Phe Lys Ser Thr Thr Ile Asn Asp Thr

195 200 205

Ile Asp Gly Trp Glu Asp Arg Val Gly Met Arg Phe Pro Glu Thr Gly

210 215 220

Asp Tyr Ile Ile Pro Lys Gly Leu Val Pro Val Lys Ile Asp Tyr Pro

225 230 235 240

Asn Asn Met Gly Ile Tyr Ile Glu Pro Asn Ile Trp Leu Tyr Tyr Asp

245 250 255

Leu Asp

<210> 64

<211> 777

<212> DNA

<400> 64

atgaccattc aaattgtaca gcataattta gagtatagct ttgtaacccc aaaagaaact 60

tctgattttg tggaaaggac gatgagtgtc tttgatcaag catacccaaa atttttgata 120

catgatgtct gggcagatcc agcttcctta gctctatttg aaatttatcc agaattccag 180

tttgggttag tagaagctac cacacagctt atgatagcgc aaggaaactg tatcccttta 240

acttatgaaa gccgttttga tgagttaccg gacgaaggtt gtgactgggc tttagccaag 300

tggcttgaag accgagaaca gaaccgcctg cctaatgcgt tatgtgtagt atcgatttca 360

atcctaccag agtatcaagg caaaaacttg agtcagtatc tgattggata catgaaagaa 420

cttgctcaat accacggtct taattctttg atcatggctg cacgtccaag cctaaaatat 480

ctttacccac ttatacccat agagcggtat attacctggc gagataaaaa tggtcttata 540

tttgaccctt ggttacgagt taatgtcaaa catggggcta aaattgcagg gatctgtttt 600

aaatccacaa caattaatga tactattgac ggttgggaag atagagttgg gatgcgtttt 660

ccagaaactg gtgactatat tattcccaaa ggcttagtac ctgtcaaaat tgactatccc 720

aacaatatgg gaatatacat cgagcctaat atatggttat actatgacct agattaa 777

<210> 65

<211> 777

<212> DNA

<400> 65

atgaccatcc agattgtgca gcataacctg gaatatagct ttgtgacccc gaaagaaacc 60

agcgattttg ttgaacgtac catgagcgtt tttgatcagg catatccgaa atttctgatc 120

catgatgttt gggcagatcc ggcaagcctg gccctgtttg aaatttatcc ggaatttcag 180

tttggtctgg tggaagcaac cacccagctg atgattgcac agggtaattg tattccgctg 240

acctatgaaa gccgttttga tgaactgccg gatgaaggtt gtgattgggc actggcaaaa 300

tggctggaag atcgcgaaca gaatcgtctg ccgaatgccc tgtgtgttgt gagcattagc 360

atcctgccgg aatatcaggg taaaaatctg agccagtatc tgatcggcta tatgaaagaa 420

ctggcacagt atcatggtct gaatagcctg attatggcag cacgtccgag cctgaaatat 480

ctgtatccgc tgattccgat tgaacgctat attacctggc gtgataaaaa cggcctgatt 540

tttgatccgt ggctgcgtgt taatgttaaa catggcgcaa aaattgccgg tatctgcttt 600

aaaagcacca ccattaatga taccattgat ggttgggagg atcgtgttgg tatgcgtttt 660

ccggaaaccg gtgattatat cattccgaaa ggtctggttc cggtgaaaat tgattatccg 720

aataacatgg gcatctacat cgaaccgaat atctggctgt attatgatct ggactga 777

<210> 66

<211> 258

<212> PRT

<400> 66

Met Val Ile Lys Asn Leu Cys Pro Asp Gly Val Thr Pro Ile Trp Asn

1 5 10 15

Lys Ser Gln Met Glu Ser Ser Leu Leu Glu Glu Cys Leu Pro Ala Trp

20 25 30

Val Arg Thr Ser Tyr Ser Thr Phe Val Glu Thr Ile Ser Asp Ser Ala

35 40 45

Phe Pro Cys Phe Trp Gly Thr Ile Gly Glu Gln Lys Gly Met Ile Arg

50 55 60

Tyr Leu Ile Val Ser Ser Leu Thr Asp Pro Ile Leu Val Glu His Thr

65 70 75 80

Leu Glu Gly Ile Tyr Lys Tyr Ile Asp Glu Val Asn Glu Asn Glu Leu

85 90 95

Leu Gln His Glu Asn Ala Asp Leu Leu Thr Leu Val Ile Phe Phe Pro

100 105 110

Pro Glu Pro Thr Val Leu Thr Val Glu Glu Tyr Ala Gly Gln Ala Phe

115 120 125

Asp Phe Leu Asn Ala Leu His Ser Leu Asp Ala Val Ser Cys Pro Cys

130 135 140

His Trp Ser Ala Asp Pro Gln Ser Ala Asn Trp Ser Tyr Ser Leu Gly

145 150 155 160

Gly Cys Ala Leu Phe Val Ser Val Ser Thr Pro Ala Asn Gln Lys Arg

165 170 175

Arg Ser Arg His Leu Gly Ser Gly Met Thr Phe Val Ile Thr Pro Val

180 185 190

Glu Val Leu Leu Asn Lys His Gly Gly Glu Asn Ser Ser Ile Phe Arg

195 200 205

Arg Val Arg Gln Tyr Asp Gly Ile Pro Pro His Pro Asn Leu Leu Ile

210 215 220

Met Pro Gly Asn Gly Lys Val Gly Asn Glu Leu Thr Val Gln Val Leu

225 230 235 240

Pro Asp Asn Asn Asp Ser Glu Ile Ser Phe Asp Phe Gln Tyr Lys Phe

245 250 255

Lys Asp

<210> 67

<211> 777

<212> DNA

<400> 67

atggtaatca agaatttatg tcctgacgga gttacaccaa tctggaacaa aagccagatg 60

gaatcctctc ttctagagga gtgccttcct gcttgggtac gcactagcta ctcaacattt 120

gttgaaacaa tcagcgattc tgccttccct tgcttctggg gaactatcgg ggaacagaag 180

ggaatgatta gatacctgat agtctcatct ttaactgacc cgatcttggt tgagcatacg 240

cttgagggta tctacaaata cattgatgaa gttaatgaaa acgaattgct tcagcacgaa 300

aatgcggatc ttctgacact tgtcatcttt ttcccacctg aaccaacagt tcttacagta 360

gaggaatatg caggtcaagc atttgatttt ttgaatgcgt tacatagcct tgatgcggtg 420

tcttgtccct gccattggtc tgccgatccg cagtctgcta actggtctta ttctctagga 480

gggtgtgcct tatttgttag tgtttccact ccagcaaatc aaaagcggcg atcgcgccac 540

cttgggtcag gaatgacttt tgtcatcaca ccagttgaag tcctcttgaa taaacatggt 600

ggcgagaatt cgagcatttt tcgccgcgtc cgagagtacg acggcattcc acctcaccct 660

aacttattaa ttatgcctgg gaatgggaaa gtcggtaatg aattgacagt gcaagtactt 720

ccagataata acgatagtga gatctcattt gacttccagt ataaatttaa ggattag 777

<210> 68

<211> 777

<212> DNA

<400> 68

atggtgatta aaaacctgtg tccggatggt gttaccccga tttggaataa aagccagatg 60

gaaagcagcc tgctggaaga atgtctgcct gcatgggttc gtaccagcta tagcaccttt 120

gttgaaacca ttagcgatag cgcatttccg tgtttttggg gcaccattgg tgaacagaaa 180

ggtatgattc gttatctgat tgttagcagc ctgaccgatc cgattctggt tgaacatacc 240

ctggaaggta tctacaaata tatcgatgaa gtgaacgaaa acgaactgct gcagcatgaa 300

aatgcagatc tgctgaccct ggttatcttt tttccgcctg aaccgaccgt tctgaccgtt 360

gaagaatatg caggtcaggc atttgatttt ctgaatgcac tgcatagcct ggatgcagtt 420

agctgtccgt gtcattggag cgcagatccg cagagcgcaa attggagcta tagcctgggt 480

ggttgtgcac tgtttgttag cgttagcaca ccggcaaatc agaaacgtcg tagccgtcat 540

ctgggtagcg gtatgacctt tgttattaca ccggttgaag tgctgctgaa taaacatggt 600

ggtgaaaaca gcagcatttt tcgtcgtgtt cgtgaatatg atggtattcc gcctcatccg 660

aatctgctga ttatgcctgg taatggtaaa gtgggtaatg aactgaccgt gcaggttctg 720

ccggataata atgatagcga aatcagcttc gattttcagt ataaattcaa agattga 777

<210> 69

<211> 408

<212> PRT

<400> 69

Met Lys Arg Leu Thr Leu Leu Ile Ile Ala Gly Ile Leu Ser Val Ser

1 5 10 15

Thr Phe Leu Cys Ile Thr Pro Val Ala Leu Ala Asn Ile Thr Asp Tyr

20 25 30

Tyr Leu Lys Asn Glu Lys Leu Ser Gly Gln Phe Ser Val Pro Val Asn

35 40 45

Leu Ser Val Gly Val Arg Phe Ala His Arg Ser Ser Tyr Ala Thr Ala

50 55 60

Ile Asn Phe Pro Thr Gly Leu Asp Ala Asp Ser Val Ala Val Gly Asp

65 70 75 80

Phe Asn Ser Asp Ser Lys Leu Asp Leu Ala Val Thr Asn Trp Phe Asp

85 90 95

Asn Asn Val Ser Val Leu Leu Gly Asn Gly Asn Gly Ser Phe Gly Ala

100 105 110

Ala Thr Asn Phe Pro Val Gly Thr Asn Pro Val Phe Val Val Thr Gly

115 120 125

Asp Val Asn Gly Asp Ser Lys Leu Asp Leu Ala Val Ala Asn Phe Ser

130 135 140

Ser Asn Asn Val Ser Val Leu Leu Gly Asn Gly Asn Gly Ser Phe Gly

145 150 155 160

Ala Ala Thr Asn Phe Ser Val Gly Thr Asn Pro Tyr Ser Val Ala Ile

165 170 175

Gly Asp Val Asn Asn Asp Ser Glu Leu Asp Leu Ala Phe Thr Asn Trp

180 185 190

Phe Asp Asn Lys Val Leu Val Leu Leu Gly Asn Gly Asn Gly Ser Phe

195 200 205

Gly Ala Ala Ser Ser Phe Pro Val Asp Thr Tyr Ser Ile Ser Val Ala

210 215 220

Ile Ala Asp Phe Asn Ser Asp Ser Lys Leu Asp Leu Ala Ile Thr Asn

225 230 235 240

Trp Val Ser Asn Asn Val Ser Val Leu Leu Gly Asn Gly Asn Gly Ser

245 250 255

Phe Gly Ala Ala Thr Asn Phe Pro Val Gly Thr Asn Pro Ile Phe Val

260 265 270

Ala Thr Gly Asp Val Asn Gly Asp Ser Lys Leu Asp Leu Ala Val Ala

275 280 285

Asn Thr Ser Ser Asn Asn Val Ser Val Leu Leu Gly Asn Gly Asn Gly

290 295 300

Ser Phe Gly Ala Ala Thr Asn Phe Pro Ala Gly Thr Asn Pro Tyr Ser

305 310 315 320

Val Ala Ile Arg Asp Val Asn Gly Asp Ser Lys Leu Asp Leu Ala Val

325 330 335

Thr Asn Tyr Ser Ser Asn Asn Val Ser Val Leu Pro Gly Asn Gly Asn

340 345 350

Gly Ser Phe Gly Ile Ala Thr Asn Phe Pro Val Gly Thr Asn Pro Glu

355 360 365

Ser Ile Ala Ile Ala Asp Phe Asn Gly Asp Ser Lys Leu Asp Leu Ala

370 375 380

Val Thr Asn Ser Gly Asn Asn Asn Val Ser Ile Leu Leu Asn Asn Phe

385 390 395 400

Gln Gly Leu Pro Lys Asn Lys Ile

405

<210> 70

<211> 1227

<212> DNA

<400> 70

gtgaaaaggc tcactttact aattatagcg gggatattat ctgttagtac atttttatgt 60

ataactcctg ttgcattagc aaatataact gactattatc tgaagaatga aaagctttct 120

gggcaattta gtgttccggt taatttgtcc gtaggagtga gatttgccca caggagtagt 180

tatgctactg ctattaactt cccaactggt cttgatgctg actctgtagc agttggggat 240

ttcaatagcg atagtaagct cgacctggct gttacaaatt ggttcgacaa taacgtctcg 300

gtcttactgg gaaatggtaa tgggtctttt ggcgcagcca ctaactttcc agtcggtact 360

aatcccgtct ttgtagtgac tggggatgta aatggcgaca gcaagcttga cctggctgtt 420

gcaaatttta gtagcaataa cgtctcggtc ttactaggaa atggtaatgg gtcttttggc 480

gcagccacta acttttcagt tggtactaac ccttattctg tagccattgg agatgtgaat 540

aacgatagtg agcttgacct tgcttttaca aattggttcg acaataaggt cttggtttta 600

ctgggaaatg gtaatgggtc ttttggcgca gccagcagct tccctgtcga tacttattcg 660

atttccgtag cgattgcgga ttttaatagc gacagtaagc tcgaccttgc tattacaaat 720

tgggtcagca ataacgtctc ggtcttactg ggaaatggta atgggtcttt tggcgcagcc 780

actaactttc cagtcggtac taatcccata tttgtagcaa ctggggatgt aaatggcgac 840

agcaagcttg acctggctgt tgcaaatact agcagcaata acgtctcggt cttactggga 900

aatggtaatg ggtcttttgg cgcagccact aactttccag ccggtactaa tccctactct 960

gtagcgatta gagatgtgaa tggcgacagt aaacttgacc tggctgttac aaattatagt 1020

agcaataacg tctcggtctt accaggaaat ggtaatgggt cttttggcat agctactaac 1080

tttccagtcg gtactaatcc tgaatctata gcaattgcgg atttcaacgg cgacagcaag 1140

cttgacctgg ctgtcacaaa ttctggcaac aacaacgtct cgatcttgtt gaataatttt 1200

cagggacttc caaaaaataa gatatag 1227

<210> 71

<211> 1227

<212> DNA

<400> 71

atgaaacgtc tgacgctgct gatcattgca ggtattctgt cagttagcac ctttctgtgt 60

attacaccgg ttgcactggc caatattacc gattattatc tgaaaaacga gaaactgagc 120

ggtcagttta gcgttccggt gaatctgtct gttggtgttc gttttgcaca tcgtagcagc 180

tatgcaaccg caattaactt tccgaccggt ctggatgcag atagcgttgc agttggtgat 240

tttaacagcg atagcaaact ggatctggcc gttaccaatt ggtttgataa caatgttagc 300

gtgctgctgg gtaatggcaa tggcagcttt ggtgcagcaa ccaattttcc ggttggcacc 360

aatccggttt ttgttgttac cggtgatgtt aatggtgaca gtaaactgga tttagccgtg 420

gcaaatttta gcagcaataa tgtttcagtt ctgctgggaa acggtaatgg ttcttttggc 480

gcagccacaa actttagcgt tggtacaaat ccgtatagcg tggccattgg tgatgtgaat 540

aatgatagtg aactggacct ggcatttacg aactggttcg ataataaagt tctggtgctg 600

ttaggcaatg gtaatggctc gtttggtgcc gcaagctcat ttccggtgga tacctatagc 660

attagcgttg cgattgcaga tttcaactca gattctaaat tagacctggc gatcaccaat 720

tgggtgtcaa ataatgtgag tgtgttactg gggaatggta acggtagttt tggagctgcg 780

acaaattttc ctgtgggtac aaacccgatt tttgtggcaa ccggtgacgt gaatggcgat 840

tctaagctgg acttagcagt tgcaaatacc agctctaata acgttagcgt tctgttaggt 900

aacgggaacg gctcattcgg tgctgccacg aattttccag caggcaccaa cccgtatagt 960

gttgcaattc gcgacgttaa cggtgatagc aaattagatt tagcggtgac caactatagc 1020

agcaacaacg tgagtgttct gccaggcaac ggtaacggat catttggtat tgcgaccaac 1080

tttccagtag gtacgaatcc ggaaagcatt gcaattgccg attttaatgg ggattccaag 1140

ttagatctgg cagtgacaaa tagcggtaac aataatgtaa gcatactgct gaataacttt 1200

cagggtctgc cgaaaaacaa gatttga 1227

<210> 72

<211> 200

<212> PRT

<400> 72

Met Lys Ser Thr Asn Ile His Tyr Thr Lys His Leu Ile Ser Pro Tyr

1 5 10 15

Asp Arg Tyr Leu Lys Asn Gly His Lys Ser Gly Ile Leu Trp Phe Thr

20 25 30

Gly Leu Ser Gly Ala Gly Lys Thr Thr Leu Ala Leu Lys Leu Glu Gln

35 40 45

Thr Leu Phe Glu Lys Gly Trp Ser Thr Phe Val Leu Asp Gly Asp Ser

50 55 60

Val Arg His Gly Leu Cys Ser Asp Leu Gly Phe Ser Ala Ser Asp Arg

65 70 75 80

Ser Glu Asn Ile Arg Arg Leu Gly Glu Val Ala Lys Leu Phe Ala Glu

85 90 95

Ser Gly Cys Leu Val Ile Thr Ala Phe Ile Ser Pro Tyr Arg Asn Asp

100 105 110

Arg Glu Gln Val Arg Arg Leu Ala Gly Asp Leu Phe His Glu Val Tyr

115 120 125

Ile Ala Thr Pro Leu Glu Leu Cys Glu Gln Arg Asp Pro Lys Gly Leu

130 135 140

Tyr Leu Lys Ala Arg Ser Gly Glu Ile Asp Gly Phe Thr Gly Ile Ser

145 150 155 160

Ala Pro Tyr Glu Pro Pro Asn Ser Pro Asp Leu Trp Val Glu Thr Ser

165 170 175

Glu Leu Thr Val Glu Glu Ser Leu Glu Gln Leu Leu Lys Tyr Val Glu

180 185 190

Asn Lys Phe Thr Ile Phe Lys Gln

195 200

<210> 73

<211> 603

<212> DNA

<400> 73

atgaaatcaa ctaatattca ctatacaaaa catcttatat ctccatatga tcgttatcta 60

aagaatggtc ataaaagcgg gattctatgg tttactggac tgtccggggc tggtaaaaca 120

acattggctt taaaattaga gcagactttg ttcgagaaag gatggtctac ctttgtttta 180

gatggtgata gtgttcgtca tggactgtgt tccgatttag gattttctgc tagtgatcgc 240

tcagaaaata tccgtcgttt gggtgaggtt gccaaactct ttgcggagtc aggatgccta 300

gtgatcactg ccttcatctc accctacagg aatgaccgag aacaggtgcg tagactagct 360

ggagatctat ttcatgaagt atacattgca actccactgg aactttgtga gcagcgtgat 420

ccgaaaggtc tttatctaaa agcacgcagt ggggaaatag atggatttac gggaatcagc 480

gccccttatg aaccacccaa tagcccagat ttatgggtgg aaacatccga actcaccgtc 540

gaggaaagcc tagaacaact actcaaatac gtggaaaaca aattcacaat tttcaaacaa 600

tag 603

<210> 74

<211> 221

<212> PRT

<400> 74

Met Lys Ala Val Val Lys Tyr Thr Ile Phe Glu Lys Pro Gln Pro Ile

1 5 10 15

Arg Ala Ile Lys Arg Leu Glu Arg Asp Val Leu Arg Met Gly Ala Leu

20 25 30

Val Glu Gln Ser Phe Arg Leu Ser His Gln Ala Leu Phe Asn Arg Asp

35 40 45

Leu Thr Ala Ala Glu Gln Ile Arg Arg Leu Asp Lys Lys Ile Asp Arg

50 55 60

Phe Tyr Arg Gln Ile Glu Val Asp Cys Ala Thr Ile Met Ser Ser Gln

65 70 75 80

Ala Pro Thr Asp Gln Glu Ser Arg Cys Leu Ser Ser Phe Met Gln Leu

85 90 95

Val Arg Asp Leu Glu Arg Ile Gly Asp Tyr Ala Lys Asp Leu Ala Glu

100 105 110

Ile Ala Met Lys Ile Phe Pro Tyr Pro Pro His Pro Thr Leu Gly Glu

115 120 125

Val Ala Ile Met Ser Asp His Ala Gln Ser Met Leu Ala Thr Ser Leu

130 135 140

Val Ala Leu Ala Asp Leu Asp Glu Ile Ser Gly Arg Arg Ile Lys Leu

145 150 155 160

Leu Asp Asp Thr Val Asp Asp Ala Tyr Lys Lys Leu Tyr Arg Asn Leu

165 170 175

Ala Gln Gln Lys Asp Val Pro Gly Val Val Glu Pro Ile Leu Leu Leu

180 185 190

Thr Leu Ala Ile Gln Cys Leu Glu Arg Met Ala Asp His Ala Thr Asn

195 200 205

Ile Gly Gln Arg Val Ala Tyr Ile Val Thr Gly Gln Arg

210 215 220

<210> 75

<211> 666

<212> DNA

<400> 75

atgaaagctg ttgtgaaata tacaattttt gaaaaacctc aacctatacg tgccattaaa 60

agactggaac gagatgtttt gcgtatgggt gctttagtag agcagtcatt ccgtctgagt 120

caccaagctc tattcaatcg ggatttaaca gcagctgagc aaatacggag attagacaaa 180

aaaattgatc gcttctacag acaaatagaa gtcgattgtg ccacaattat gagcagtcaa 240

gctcccacag accaagaatc tcggtgttta agctcattca tgcaattagt tagagacttg 300

gaacgtattg gggactatgc caaagatttg gcagaaatag caatgaaaat atttccctat 360

cccccccatc ctactttggg ggaggttgcc attatgtccg atcatgccca atctatgttg 420

gctaccagcc tagtagcttt agcggattta gacgagatta gtggtagaag gattaaatta 480

ttagatgata cagtagatga tgcttacaaa aagttatatc gtaatttggc gcagcagaaa 540

gatgttcccg gggtagtgga gcccatttta ctattaacat tagcaattca gtgtttagag 600

agaatggcag atcatgctac taatattggt caaagggtag catacattgt tacagggcaa 660

agatag 666

<210> 76

<211> 450

<212> PRT

<400> 76

Met Phe Leu Leu Gly Phe Leu Leu Gly Leu Ala Val Gly Phe Gly Phe

1 5 10 15

Trp Leu Trp Gln Gln Phe Gln Leu Asn Ser His Leu Glu Gln Leu Thr

20 25 30

Gln Pro Leu Asn Pro His Ala Glu Lys Ile Leu Leu Pro Leu Leu Ala

35 40 45

Gly Leu His Arg Lys Ile Ser Thr Val Arg Asp Glu Gln Gln Asn Leu

50 55 60

Arg Leu Ser Leu Lys Ala Tyr Glu Gln Leu Leu Asp Ala Ala Pro Leu

65 70 75 80

Gly Tyr Leu Gln Val Asp Glu Glu Asn Gln Leu Leu Trp Cys Asn Gln

85 90 95

Cys Ala Arg Glu Met Leu Tyr Leu Gln Arg Trp Gln Pro Gly Gln Val

100 105 110

Arg Leu Leu Leu Glu Leu Val Arg Ser Tyr Glu Leu Asp Gln Leu Ile

115 120 125

Glu Gln Thr Arg Asp Trp Gln Lys Pro Gln Met Gln Glu Trp Ile Phe

130 135 140

His Pro Ser Arg Asp His Gly Gln Gly Ile Leu Gly Leu Lys Pro Leu

145 150 155 160

Ser Leu Ala Ala Asn Ser Phe Pro Leu Pro Gly Gly Gln Val Gly Val

165 170 175

Phe Leu Glu Ser His Gln Gln Phe Val Asp Ile His Gln Gln Arg Asp

180 185 190

Arg Ser Phe Ser Asp Leu Ala His Glu Leu Arg Thr Pro Leu Thr Ser

195 200 205

Ile Arg Leu Val Ala Glu Thr Leu Gln Thr Arg Leu Asp Pro Pro Leu

210 215 220

Asn Arg Trp Val Ile Arg Leu Met Gln Glu Val Asp Arg Leu Ile Asn

225 230 235 240

Leu Val Gln Asn Trp Leu Asp Leu Thr Gln Met Glu Ile Thr Ser Ser

245 250 255

Ile Gln Leu Asn Leu Glu Met Leu Glu Val Arg Ser Leu Ile Phe Ser

260 265 270

Val Trp Glu Asn Leu Glu Pro Leu Ala Ala Asn Gln His Leu Ser Ile

275 280 285

Ser Tyr Ser Gly Pro Glu Lys Val Tyr Ile Cys Ala Asp Lys Ser Arg

290 295 300

Ile Tyr Gln Val Phe Leu Asn Leu Leu Asp Asn Cys Ile Lys Tyr Ser

305 310 315 320

Asn Leu Asn Gly Thr Ile Phe Ile Glu Met Asn Pro Val Cys Gly Glu

325 330 335

Lys Ser Ile Asn Gly Val Asp Pro Glu Ala Asp Thr Ile Leu Asn Gln

340 345 350

Val Ser Asn Gln Ile Leu Glu Ile Asn Ile Ile Asp Ser Gly Val Gly

355 360 365

Phe Ala Pro Met Asp Leu Pro His Val Phe Gln Arg Phe Tyr Arg Gly

370 375 380

Asp Lys Ala Arg His Arg Glu Ser Arg Ser Glu Asn Glu Thr Val Glu

385 390 395 400

Ile Thr Gly Ser Gly Leu Gly Leu Ser Ile Val Arg Gln Ile Ile Ile

405 410 415

Ala His Gly Gly Lys Ile Arg Ala Met Asn His Pro Asp Thr Gly Gly

420 425 430

Ala Trp Ile Gln Ile His Leu Pro Gln Val Val Gln His Asp Gly Gly

435 440 445

Tyr Phe

450

<210> 77

<211> 1353

<212> DNA

<400> 77

atgttcttat tgggatttct tctgggtttg gcagtcggtt ttggtttttg gctttggcaa 60

caatttcaac ttaacagtca tttggagcag ttaacccaac ccttaaaccc tcacgctgaa 120

aagatattat tacccctatt agctggatta catcgtaaaa tatctaccgt tagagatgag 180

caacaaaact tacgcttgtc actcaaagct tatgaacagt tgctggatgc tgcgcctttg 240

ggatatttac aagtagatga agaaaaccaa ctactatggt gtaatcagtg cgcgcgggaa 300

atgctgtatt tacaaagatg gcaaccgggt caagtgcgcc tgctactgga attagtgaga 360

tcctatgagc tggatcagtt aattgagcaa acccgggatt ggcaaaaacc gcaaatgcaa 420

gagtggattt ttcacccttc ccgagatcat ggtcagggta ttttaggatt aaagccattg 480

tctttagcag ctaacagttt tcccctaccg gggggacaag tgggtgtgtt tctagaaagt 540

caccaacaat ttgtagacat tcatcagcaa cgtgaccgct ctttttcaga cctggcccat 600

gaactgagaa cacctctgac ttccattcgt ctggtcgcag aaaccctgca aactcgctta 660

gatccccctc taaaccgttg ggtcatccgc ttgatgcagg aggttgacag actaattaat 720

ttagtccaaa attggttaga cctgacccag atggaaataa cctcctccat acaactgaat 780

ttggaaatgc tagaagtccg ctccctaatt ttttcagtct gggagaattt agagccccta 840

gccgctaatc agcatcttag tatttcttac tccggcccgg aaaaggtcta tatatgtgct 900

gataagtcca gaatttatca agtgtttctt aatctgttag ataactgtat taaatacagc 960

aacctgaacg gtactatttt cattgaaatg aatccagttt gtggggagaa gtctattaat 1020

ggggttgatc cagaagcaga tacaatatta aaccaagtat caaatcagat tttagaaatt 1080

aacattattg attccggggt tggatttgct cccatggatc taccccatgt ctttcaaaga 1140

ttttatcggg gggacaaagc tagacaccgc gagtcccgct ctgagaatga aacagtagaa 1200

attactggta gtggtttagg gttatccatt gtccgccaaa taattatagc tcatggtggc 1260

aaaatcaggg ccatgaacca tcctgatacc ggtggtgctt ggatacaaat tcatcttccc 1320

caggtggttc aacatgatgg cggatatttc tga 1353

<210> 78

<211> 240

<212> PRT

<400> 78

Val Asn Gln Ser Ile Val Trp Gln Arg Ala Pro Glu Asn Phe Gln Leu

1 5 10 15

Cys Ala Gln Glu Val His Ile Trp Lys Ile Asn Leu Lys Val Ser Pro

20 25 30

Ser Glu Val Glu Leu Cys Arg Arg Ile Leu Ser Gly Asp Glu Ile Ala

35 40 45

Arg Ala Glu Arg Phe Ser Phe Pro Glu His Gln Glu Arg Phe Ile Val

50 55 60

Gly Arg Ala Phe Leu Arg Lys Ile Leu Ser Arg Tyr Leu Asn Val Glu

65 70 75 80

Ala Gln Ala Ile Glu Phe Glu Tyr Glu Glu Arg Gly Lys Pro Leu Leu

85 90 95

Gly Phe Lys Phe Lys Tyr Ser Gly Ile Cys Phe Asn Leu Ser His Ser

100 105 110

Gln Glu Leu Ala Leu Cys Gly Val Thr His Gln Arg Ser Ile Gly Val

115 120 125

Asp Leu Glu Gly Val Arg His Thr Ser Asp Ile Glu Asn Leu Ala Asn

130 135 140

Arg Phe Phe Ser Val Lys Glu Tyr Gly Val Ile Lys Ser Val Pro Pro

145 150 155 160

Glu Gln Gln Gln Gln Val Phe Phe Arg Tyr Trp Thr Cys Lys Glu Ala

165 170 175

Tyr Leu Lys Ala Ile Gly Lys Gly Leu Ser Glu Leu Ser Gln Ile Glu

180 185 190

Ile Glu Leu Thr Pro Asn Lys Ser Ala Arg Leu Arg Val Leu Gly Asp

195 200 205

Trp Gln Leu Lys Glu Leu Val Pro Ala Asp Asn Phe Ala Ala Ala Val

210 215 220

Val Ile Ala Ser His Asn His Leu Asp Arg Phe Glu Phe Trp Glu Pro

225 230 235 240

<210> 79

<211> 723

<212> DNA

<400> 79

gtgaatcagt ctattgtttg gcaacgggca cctgaaaatt tccagttgtg cgctcaggaa 60

gtacatatct ggaagattaa cctgaaagta tcaccatcag aggtggaact ttgtcgcagg 120

attttatctg gtgatgaaat agctcgtgcg gaaagatttt cttttccgga acatcaagag 180

cgttttattg ttggtcgtgc ctttcttaga aaaatactat caagatattt aaacgtagaa 240

gcacaagcaa tagagtttga gtatgaagag agaggaaaac cactgttagg gttcaagttt 300

aagtactctg gaatatgttt taatttatcc cattctcagg aattagcttt atgcggtgtg 360

actcatcaaa gatccattgg agtagatcta gaaggtgttc gtcacacatc agatatagaa 420

aacctagcca accgcttttt ttcagttaaa gaatatgggg taattaaatc agtacccccg 480

gaacaacaac agcaggtatt tttccgttat tggacttgta aagaggccta tttaaaagct 540

attggaaaag gtttgtctga gttatctcaa atagaaatag aattaacgcc aaataaatct 600

gctaggttgc gtgtattggg agattggcag ttaaaagaac tagtaccagc agataatttt 660

gcagcagcag ttgttatagc tagccataat catttagaca ggtttgagtt ttgggaacct 720

taa 723

<210> 80

<211> 723

<212> DNA

<400> 80

atgaatcaat caatcgtgtg gcagcgtgcg ccggaaaact tccaactgtg tgctcaagaa 60

gtgcatatct ggaaaatcaa cctgaaagtg agcccgtctg aagtggaact gtgccgtcgc 120

attctgagtg gcgatgaaat cgcgcgtgcc gaacgctttt ccttcccgga acatcaggaa 180

cgttttattg tgggtcgtgc attcctgcgc aaaatcctga gccgctatct gaacgttgaa 240

gcacaggcta ttgaatttga atacgaagaa cgtggcaaac cgctgctggg tttcaaattc 300

aaatactctg gcatctgctt caatctgagt cattcccagg aactggcgct gtgtggtgtt 360

acccaccaac gttcaattgg cgtcgatctg gaaggtgtgc gccacacgtc ggacatcgaa 420

aacctggcca atcgtttctt tagcgtcaaa gaatacggcg tgattaaaag cgtgccgccg 480

gaacagcaac agcaagtgtt tttccgctat tggacctgta aagaagcgta cctgaaagcc 540

atcggcaaag gtctgtcaga actgtcgcag attgaaatcg aactgacgcc gaacaaatca 600

gcgcgtctgc gcgttctggg tgattggcaa ctgaaagaac tggtcccggc agacaatttt 660

gctgcagcag ttgtcattgc gagtcataat catctggacc gttttgaatt ttgggaaccg 720

tga 723

<210> 81

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>primer

<400> 81

gggctttcat atgttacaaa agattaa 27

<210> 82

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>primer

<400> 82

aaagtatgcg gccgcatgct tgagtat 27

<210> 83

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>primer

<400> 83

ggcatccatg ggcaagattt acggaa 26

<210> 84

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>primer

<400> 84

ggcatctcga gttataaaag cgcttcg 27

<210> 85

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>primer

<400> 85

ggttaagatc tgaaattaat acgactc 27

<210> 86

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>primer

<400> 86

ttttaagatc ttttcagcaa aaaaccc 27

<210> 87

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>primer

<400> 87

atatccatgg gacctggtga tcgcaaagga 30

<210> 88

<211> 29

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>primer

<400> 88

tatctcgaga gtgttgattt cgttggctg 29

<210> 89

<211> 675

<212> DNA

<213>bacillus subtilis (Bacillus subtilis)

<400> 89

atgaagattt acggaattta tatggaccgc ccgctttcac aggaagaaaa tgaacggttc 60

atgactttca tatcacctga aaaacgggag aaatgccgga gattttatca taaagaagat 120

gctcaccgca ccctgctggg agatgtgctc gttcgctcag tcataagcag gcagtatcag 180

ttggacaaat ccgatatccg ctttagcacg caggaatacg ggaagccgtg catccctgat 240

cttcccgacg ctcatttcaa catttctcac tccggccgct gggtcattgg tgcgtttgat 300

tcacagccga tcggcataga tatcgaaaaa acgaaaccga tcagccttga gatcgccaag 360

cgcttctttt caaaaacaga gtacagcgac cttttagcaa aagacaagga cgagcagaca 420

gactattttt atcatctatg gtcaatgaaa gaaagcttta tcaaacagga aggcaaaggc 480

ttatcgcttc cgcttgattc cttttcagtg cgcctgcatc aggacggaca agtatccatt 540

gagcttccgg acagccattc cccatgctat atcaaaacgt atgaggtcga tcccggctac 600

aaaatggctg tatgcgccgc acaccctgat ttccccgagg atatcacaat ggtctcgtac 660

gaagagcttt tataa 675

<210> 90

<211> 224

<212> PRT

<213>bacillus subtilis (Bacillus subtilis)

<400> 90

Met Lys Ile Tyr Gly Ile Tyr Met Asp Arg Pro Leu Ser Gln Glu Glu

1 5 10 15

Asn Glu Arg Phe Met Thr Phe Ile Ser Pro Glu Lys Arg Glu Lys Cys

20 25 30

Arg Arg Phe Tyr His Lys Glu Asp Ala His Arg Thr Leu Leu Gly Asp

35 40 45

Val Leu Val Arg Ser Val Ile Ser Arg Gln Tyr Gln Leu Asp Lys Ser

50 55 60

Asp Ile Arg Phe Ser Thr Gln Glu Tyr Gly Lys Pro Cys Ile Pro Asp

65 70 75 80

Leu Pro Asp Ala His Phe Asn Ile Ser His Ser Gly Arg Trp Val Ile

85 90 95

Gly Ala Phe Asp Ser Gln Pro Ile Gly Ile Asp Ile Glu Lys Thr Lys

100 105 110

Pro Ile Ser Leu Glu Ile Ala Lys Arg Phe Phe Ser Lys Thr Glu Tyr

115 120 125

Ser Asp Leu Leu Ala Lys Asp Lys Asp Glu Gln Thr Asp Tyr Phe Tyr

130 135 140

His Leu Trp Ser Met Lys Glu Ser Phe Ile Lys Gln Glu Gly Lys Gly

145 150 155 160

Leu Ser Leu Pro Leu Asp Ser Phe Ser Val Arg Leu His Gln Asp Gly

165 170 175

Gln Val Ser Ile Glu Leu Pro Asp Ser His Ser Pro Cys Tyr Ile Lys

180 185 190

Thr Tyr Glu Val Asp Pro Gly Tyr Lys Met Ala Val Cys Ala Ala His

195 200 205

Pro Asp Phe Pro Glu Asp Ile Thr Met Val Ser Tyr Glu Glu Leu Leu

210 215 220

<210> 91

<211> 7035

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>sequence of the sxt1 segment after being integrated into E coli lac operon

<400> 91

gtttcatctg tggtgcaacg ggcgctgggt cggttacggc caggacagtc agtggagatg 60

cccaagggca cttcgggtcg aggaacccga cctgcattgg gacgcggcca cggagagcgc 120

gggcaaacgc cggcactata gccagtggag tttgtaaaac gctatttcag agcttggaga 180

gtgtctaaga aagccgggcg atgccaaccc atcccttctt cggctacgtt cgtaatcaag 240

ccacttcctt tttgcattga cgcagggtgt cggaaggcaa ctcgccgaac gcgctcctat 300

agttttcagc gaagcgtccc aaatgtaaga agccgtagtc tagggctatc tcagttatac 360

tacgcacatt ggcactggga tcgttcaagc aggcgcggat gctttcgagc ttgcggttgc 420

ggatgtagtt cttcggcgtg gtgccggcat gcttctcgaa caaattgtag agcgagcgtg 480

gactcatcat cgccagctcc gctaaccgct caaggctgat attccgtttg agattctcct 540

caatgaattg aacgactcgc tcgaaagacg ggttaccttt gctgaaaatt tcacggctga 600

cattgctgcc cagcatttcg agcagcttgg aagcgatgat ccccgcatag tgctcttgga 660

cccgaggcat cgactttgta tgttccgctt cgtcacaaac taacccgagt agattgataa 720

agccatcgag ttgctggaga ttgtgtcgcg cggcgaaacg gataccctcc ctcggcttgt 780

gccaattgtt gtcactgcat gcccgatcaa ggaccactga gggcaattta acgataaatt 840

tctcgcaatc ttctgaatag gtcaggtcgg cttggtcatc cggattgagc agcaatagtt 900

cgcccggcgc aaaatagtgc tcctggccat ggccacgcca caggcaatgg cctttgagta 960

ttatttgcag atgataacag gtctctaatc caggcgagat taccctcacg ctaccgccgt 1020

agctgattcg acacaggtcg aggcatccga agattctgtg gtgcagcctg cctgccgggg 1080

gcccgccctt gggcaggcga atagagtgcg taccgacata ctggttaaca taatcggaga 1140

ctgcataggg ctcggcgtgg acgaagatct gacttttctc gttcaataag caaaaatcca 1200

tagttcacgg ttctcttatt ttaatgtggg ctgcttggtg tgatgtagaa aggcgccaag 1260

tcgatgaaaa tgcaggaatt aattcgcaga tcctggcgga tgagagaaga ttttcagcct 1320

gatacagatt aaatcagaac gcagaagcgg tctgataaaa cagaatttgc ctggcggcag 1380

tagcgcggtg gtcccacctg accccatgcc gaactcagaa gtgaaacgcc gtagcgccga 1440

tggtagtgtg gggtctcccc atgcgagagt agggaactgc caggcatcaa ataaaacgaa 1500

aggctcagtc gaaagactgg gcctttcgtt ttatctgttg tttgtcggtg aacgctctcc 1560

tgagtaggac aaatccgccg ggagcggatt tgaacgttgc gaagcaacgg cccggagggt 1620

ggcgggcagg acgcccgcca taaactgcca ggcatcaaat taagcagaag gccatcctga 1680

cggatggcct ttttgcgtag atcccagcct tgcaagaagc ggatacagga gtgcaaaaaa 1740

tggctatctc tagaaaggcc taccccttag gctttatgca acagaaacaa taataatgga 1800

gtcatgaaca tgctgcagaa aatcaatcgt tatacccatg gttttgttgc cgttccggtt 1860

attctggcat gtcgtgaaaa aggtgttttt gaactgctgg cagatgaaag tccgctgagc 1920

ctgaatcaga tggttgaaca tctgggtgcc aatagcggtc attttcaggt tgcactgcgt 1980

atgctggaaa gtctgcattg gctgagccgt aataaagaac tgaaatatag cctgaccgca 2040

gaagcagcaa ttcataacaa aattagcgaa gatatcctgc agctgtataa tctgccgatt 2100

cagagctatc tggaaggtaa acagggcaat ctgctgggtc gttggattga acgtagctgt 2160

cagctgtgga atctggataa tccgctgatg gcagattttc tggatggtct gctggttatt 2220

ccgctgctgc tggcactgca taaacataac ctgctggccg attctgaaga taaaccgctg 2280

ctgagcagcc tgagcagtac cgttcaagaa gaactgggta aactgtttct gcatctgggt 2340

tgggcagatc tgacagcagg tcgtctgacc attaccgaac tgggtcgctt tatgggtgaa 2400

cgtgcactga ataccgcaat tgttgcaagc tataccccga tgctgagtcg tattcatgat 2460

gttctgtttg gtaattgcct gagcgttttt cagcgtgatg caagcggtca tgaacgtcat 2520

attgatcgta ccctgaatgt tattggtagc ggttttcagc accagaaata ctttgcagat 2580

ctggaagaaa gcattctgag cgtgtttaat cagctgccgc tggaagaaca gccgaaatac 2640

attaccgata tgggttgtgg tgatggcacc ctgctgaaac gtgtttggga aaccattcag 2700

tttaaaagcg cacgtggtaa agcactggaa cagtatccgc tgcgtctgat tggtgttgat 2760

tataatgaag caagcctgaa agcaaccacc cgtaccctgg caagcctgcc gcatctggtt 2820

ctgcagggtg atattggtaa tccggaacaa atggttcgta gcctggaagc acatggcatt 2880

catgatccgg aaaatattct gcatattcgc agctttctgg atcacgatcg tctgtttatt 2940

ccgcctcaga aacgtaatga actgaaagaa cgtgcccatc tgccgtatca gagtgtttgt 3000

gttgatgatc agggtgaact gattcctccg catgttatgg ttcagagcct ggtggaacac 3060

ctggaacgtt ggagccaggt tgttaataaa catggtctga tgattctgga agtgcattgt 3120

ctggaaccgc gtgttgttta tcagtttctg gataaaagcg aaaacctgca ctttgatgca 3180

tttcagggtt ttagccagca gtatctggtt gaagccgaag tttttctgat gagcgcagca 3240

caggttggtc tgtttccgaa actggaactg agcaaacgtt atccgaaaac ctttccgttt 3300

acccgtatta ccctgaacta tttcgaaaaa cgtccgtaca aaatcagcca tgcatatctg 3360

agcgatctgc ctgcactggt tgacctggaa gttaaatgtt ggcctgagaa tctgcgtgca 3420

agcacccatg aaattcgtcg tcgtctggaa ctgaatccgc agggtaacct ggttctgatt 3480

attgaagatc agattatcgg tgccatttac agccagacca ttacaagcac cgaagccctg 3540

gaaaatgtta aatatgcaca ggttccgacc ctgcatacac cgcagggttc agtgattcag 3600

ctgctggccc tgaacattct gccggaattt caggcacgtg gtctgggcaa tgaactgcgt 3660

gattttatgc tgtattattg caccctgaaa ggtggtattg aaagcgttgt tggtgttacc 3720

cgttgtcgca attatgtgaa ttatagccag atgccgatga tggaatatct gaaactgcat 3780

aatgaacagc gtcaactgct ggatccgatt gttggttttc atgttagcgg tggtgcagaa 3840

attcgtggca ttattgcaaa ttatcgtccg gaagatacag ataatctggg tatgggtatt 3900

ctgatcgaat ataacctgcg tgatagcgca ctgcattcac cgggtgatcg taaaggtccg 3960

tatatcaata gcgcaattgg tagcctggtt ccgaaagcga ccagcgcaac caaagaaaac 4020

aaaaccgttg cggatctggt gaaagaatgt attctgaaag tgatgggtag ccagcgtcag 4080

gcagcatatg caccgcagca gaaactgctg gacatgggtc tggatagcct ggatctgctg 4140

gaactgcaga ccctgctgga agaacgtctg ggtattaatc tgagcggcac cttttttctg 4200

caaaaaaaca ccccgaccgc catcattacc tattttcaga atcaggtcgt gcaagagaaa 4260

cagagtgatc tggcaccgcc tgttgatagc gccaatgaaa tcaatacact ggaaaacgtt 4320

gtgaatcagc agaaaattcc gcaggttaca cgtgttgtta ccgaacagca gggacgtaaa 4380

gttctgattg atggtcattg ggttattgat tttgccagct gtaattatct gggcctggac 4440

ctgcatccga aagttaaaga agcaattcct ccggcactgg ataaatgggg cacccatccg 4500

agctggaccc gtctggttgc aagtccggca atttatgagg aactggaaga ggaactgtca 4560

aaactgctgg gtgtgccgga tgttctggtt tttccggcag ttacactgct gcagattggt 4620

attctgcctc tgctgaccgg taataatggt gtgatttttg gcgatattgc agcccatcgt 4680

tgtatttatg aagcatgttg tctggcccag cataaaggtg cacagtttat tcagtatcgt 4740

cataacgacc tgaatgatct ggccgaaaaa ctggccaaat atccgcctga acaggttaaa 4800

atcattgtga tcgatggtgt gtatagcatg agtgccgatt tcccggacct gcctgcatat 4860

gttcatctgg caaaagaata taacgccctg atctatatgg atgatgcaca tggctttggc 4920

attctgggtg aaaatccgag cagcgatatg ccgtatggtt ataaaggtaa tggcatggtg 4980

aactactttg atctgcgttt tgccgaagat aacatcattt atgttgcagg tctgagcaaa 5040

gcctatagca gctatgcagc atttctgacc tgtggtgatc gtcgtattaa aaccaatttt 5100

cgtaatgcat ggaccgcgat ttttagcggt ccgagtccgg ttgcaagcct ggccagcgca 5160

ctggcaggtc tgcaggttaa tcgtcaagaa ggtgaacagc tgcgcaaaca aatctatcat 5220

ctgacacata aactggttac ccaggctcgt gccattggtt ttgaagttga taattatggt 5280

tatgtgccga ttgtgggtgt tctggtgggt gatgcacagc atatgattga tgtgtgccaa 5340

ctgctgtggg aatatggtat cctgattacc cctgcaattt ttccgattgt gccgctgaat 5400

aaatcagcac tgcgttttag cattaccgca gcaaataccg aagaagaaat tgatcaggcc 5460

atcaaaagtc tgaaagcagt ttgggacctg ctgcaaaaac gtaaagccct gccgtgtaaa 5520

caagaagaaa atatcctgaa acattgagaa ggagatatac atatgaccca tgttgccctg 5580

gaacaggcaa ttgcaaaagt tccgcgtagc attcagagcg aactgcgtac cattctggca 5640

cagcatgcag ttattgatag cagcgttgtg gcaagctgga ttgatcgtct gggcaccaat 5700

attagtaccc tgatgatcca gctgctgccg gttgcagcaa cctatgcacg tgttccgatt 5760

agccagtttt atgttggtgc cattgcactg ggcaaaccgc agagtaaaaa tcagctgggt 5820

agcggcaccc tgtattttgg tgcagatatg gaatttgttg gtcaggcact gagctttagc 5880

gttcatgcag aacagagcgc caccattaat gcctggctgc atggcgaaac cggactgcag 5940

gcactggcaa tccatgaagc accgtgtggt tattgtcgcc agtttctgta tgaaatggca 6000

accgtgaatc agaattttgt gctgctggtg aaaagcaatg aaagccagcc ggaacagacc 6060

tataccagca acaaactgcc gcattttctg cctgaaccgt ttggtccagc cgatctgggt 6120

ctgaccggtg gcctgatgca gaccgtgttt cacgatctgg aaacctatag caccgatgat 6180

gttgttctgg cagcactgag tgcagcaaat cagagttatg caccgtatac caaaaacttt 6240

gccggtgttg cactgaaaga tagtcatggt aacattttta caggtcgcta tgccgaaaac 6300

gcagcattta atagcagcat gagcccgatg gaaagcgcac tgacctttat gaatatgaat 6360

cgttattcac agagcctgtt cgatatttgt gatgcagttc tggtagaagt ggaaaccggt 6420

attagtcagc gtccggttac cgaagccttt ctgagtagca ttgcaccgaa agtgaaactg 6480

cgctatgcac cggcaacccc gagcagtaac aaactgtgag aaggagatat acatatgttt 6540

cagaccaaaa gctattatag cgtcgttggc ctggaaaccg aactgattaa aggtaaattc 6600

ttcatgagca acgaactgac caatgaacag gtgtttaaac tggtgtgcat ggaagtgatt 6660

gaaaaaatgg gttttgcaca ctttccgcct attatcctgg tttatgaaat gaccaattcc 6720

ggctttgttg attggtgcga gcagatggtt tttgtggatg ataaaggcaa actggatgag 6780

ggcgaaaaat ttctgctgga ttggatgcgt cgtaatgtgg gtaattttga tctgattcgc 6840

gaactgatgc cggtggcaga acgcctggaa atgaaaatgc gtagctaact cggtaccaaa 6900

ttccagaaaa gaggcctccc gaaagggggg ccttttttcg ttttggtccc gaagttccta 6960

ttctctagaa agtataggaa cttcgaccgc ctgtctattt ctcttacggt tccaacatcc 7020

atataggccg caatt 7035

<210> 92

<211> 12758

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>it is integrated into the sequence of the sxt3 segment version 1 in Escherichia coli xylose operon

<400> 92

ttgcatttcc ttgagcctta tccgacttgt cagtcggata aggcttttta ctttgtctca 60

ggcagttgag ctacgagcct gaagcgttgt tggtgcgttt tatcatgcct ggcgggtagg 120

tcggataagg cgttcacgcc gcatccgaca accacgcagc gttacctgat gtgacgccga 180

caattctcat catcgctaca acatgacctc gctatttaca tcgcgatact cttttggcgt 240

cgtgtcatat gcttttttaa aaacagagta gaaatattgc agcgatggat aaccgcacat 300

ttgcgatatc tcattgatcg acaaggtggt tgaaatcagc agactgcgcg ctttctccag 360

cttctcggca tgaatcatgg catggatggt ttcacccacc tcttctttaa aacgcttctc 420

aagattggag cgcgagatcc cgaccgcatc cagtacctga tccactttaa tccctttaca 480

ggcgtgatta cgaatgtaat gcatggcctg aataacggcg ggatcggtca gcgagcgata 540

atctgttgag cgccgttcaa tgacgcgaac tggtgggacc aaaattcgct gtagcggcat 600

ttcttcttta tctaataatc gatgcaacag ttttgccgcc tgatagccca tttgccgcgc 660

gccctgagcg accgaagaaa gggcgacacg cgacagatag cgggtcagtt cttcgttatc 720

gatgccaatc acgcataatt tttccggtac gggaatatgt agatgttcac atacttgcag 780

aatatgccgc gctcgggcgt cagtaacggc aataatcccg gtttgcggtg gtagcgtttg 840

tagccagtct gccagccgat tttgcgcgtg ttgccagttc tctggcgcgg tttctaaccc 900

ctgataaacc actccgcgat acttttcttc ggcgacaagc tgacgaaatg catattcgcg 960

ctcagtggcc caacgtttgc cgcttgattc cggaagacca taaaaagcaa agcggttaac 1020

gcctttctct tttaaatgca aaaatgcgct ttcaaccagc gcatagttat cggtggcaat 1080

gtaatgaacg ggtgggtaac tttctgcaag gtgatacgag ccgccaaccc caacaatggg 1140

gacgtcgaca tcagccagcg cttgctcgat ctgtttgtcg tcgaagtcgg caatgacgcc 1200

atctcctaac cagtccttga ttttatcaat gcgggcgcgg aaatcttctt caatgaaaat 1260

atcccattcc gattgtgacg cctgtaaata ttcccctacg ccttctacta cctgccggtc 1320

ataggcttta ttggcattga acagtaatgt gatgcggtga cgtttagtaa acatggttct 1380

tttcctgctg aatcatgcaa aaactcaaaa ccggtaatac gtaaccggct ttgagaaaat 1440

ttttatcaaa atcaagaacg gcgtttggtt gcggagtcca tccatactgc cagcaacaga 1500

atcgcacctt taacgatata ctgccagaag gtcggtacat ccatcatact catgccgtta 1560

tccagtgaag ccatgataaa tgcccccatt actgctccgg caacgcttcc cacaccgcca 1620

gccaggctgg tgccgccaat cacgcatgct gcaattgcgt ccagttcggc gatatttccc 1680

gcagaaggtg aaccagcgcc aagtcgagaa ctaaggatta atccggcgat ggctaccatt 1740

aatccgttaa tcgcgaacac ggcaagtttg gtgcgttcaa cgttaatccc ggagagacgt 1800

gctgcttcca gattgccgcc gatggcataa atgcgtcgtc caaatgccgt ccgcgtttcc 1860

ataaacattc cgccgagtaa cagcaacgtc agcagcagaa caggagtggg aacgccacgg 1920

taatcattca acagccagat tgcgcctaat acgatgatag cggttaaagc ctggcgaccg 1980

actactgcgg tagaggccgg agactgcaaa cccaaagcct gacggcgcat tcttccgcgc 2040

cattgccaac caacaaaagc cattaagcca agcgcgccaa tgatgaagcc agtgctggca 2100

ggtagatagc tttgcccaat ttgtgacatc gcggcgctgg tgggggaaac agtcgtgccg 2160

ttggtgatgc caatgagtat gccgcgaaat gccaacatgc ccgcgagggt gacaataaat 2220

gaagggactt tgcggtacgc gacccaccat ccgttccagg caccgagaag cagtcccaga 2280

accaacgtca caatgatggt aagtggcaaa ggccagccta accagacgtc acaaatcgcc 2340

gcgacgccac ctaatagccc catcattgag ccgacggaaa ggtcgatttc agcagaaatt 2400

atgacgaaca ccattcctac cgcgaggatg ccggtaatcg cggtctggcg taacaggttg 2460

gagacgttac gggcgcttaa gtaggcacca tcggtggtcc aggtaaagaa cagcatgatt 2520

gcgatgatag ctgcaatcat cacgaagacc tgcaaattca gtgatttcag cccggagaag 2580

ctaccggatg tcggtacggc caatttcact tcagacggat tgcttttcga catgatgttc 2640

gctcctcaat gcggcttcca tcacctgctc ctgagtcagg ttatgattta tcaggttggc 2700

ttttagtttc ccttcatgca tcaccagtac acgatcgcta aggccgagca cttcaggtaa 2760

ttcggaagag atgacaataa cggcaatacc ctgctggacg agttggttaa ttaatttgta 2820

gatctcgtat ttcgcgccaa tatcgatacc cctggtgggt tcatcaagaa tgagaatgcg 2880

cgggttaagt aacagacagc gagcgaggat cgctttttgc tgattgccgc cgctcaaacg 2940

tccaatagca aggtcggggg acgacgtttt aactttgagt tgctggattg attccagaat 3000

acatttttgc tctgccgcgt catcaagctg gctaatgcca ccggtaaatt tattgagtcg 3060

gcgagggtaa tatttttacc aaccgccatt accggaacga tgccgtcgcg ctttctgtct 3120

tcgggtacca tcgcaatccc ctgggcgatg gcttgctgac agttacgaat atctacctgt 3180

ttgccatcaa tataaatttt tccttcccat tgtccgggcc acacgccaaa caggcactga 3240

atggtctcgg tacgtccggc accaacgagt ccggcaatac ccagtatttc gccacgtttc 3300

agggaaaacg agacatcatt aactcgttta atatgacgat tgaccggatg ccatgccgtc 3360

agatgttcaa tacgtaatat ttcatctccg gtggtatgtg gttcattagg gtaaagcgcg 3420

gttaactctc gcccgaccat catggtgata atatcgtctt cactcattcc ggcagcatca 3480

cgcgtaccaa tgtgctgtcc gtcgcgaata acgcaaatcg tatcggaaat cgctttgact 3540

tcgttgagtt tgtgcgaaat ataaatacag gcgataccgt gctgttgtag atcgcgaata 3600

atatccagta aaaccgacgt ttcctgctca gttaatgagg ctgtcggttc atcgagaatt 3660

aacaagcgca cctgtttatt aagtgccttg gcaatttcaa ccagttgttg ttgcccaagc 3720

cctaaatcgc caacgcgggt atcaggtgaa atggataaac tgacctgtgc gagcagcttc 3780

tgacagcgta gcgtcatcag gtcataatcc ataatgccat tgtgggttat ttcgttaccc 3840

aggaagatat tttccagcac ggtcaattct ttcaccaggg ccaattcctg atgaatgatg 3900

gcgatacctt tgcgttcggt atcgcggatg tgactcgcct gaatctcttc tcccgcaaaa 3960

ataatttcgc cttcgtagga gccatgggga taaataccac acagcacttt catcagcgtt 4020

gatttaccag acccattttc cccacaaagt gagacgattt cgccagcatt caaccgcaag 4080

cagacgttat caatcgcctt cacactgccg aaggttttgg taatgttctt catttcaagt 4140

agataaggca taacgactcc acctaagcca attcattcac gcggcatgga gagaaatcac 4200

gcccccgctc cgcgccgggc gtaacgctta cagctcgctc tctttgtgga atccgtcttt 4260

aattaccgta tctttgatgt tgtttttatt cacatcgatc ggtgtcagga ggcgggaggg 4320

gacatctttc aggccattat tcagtgaggt ccagccttgc aagaagcgga tacaggagtg 4380

caaaaaatgg ctatctctag aaaggcctac cccttaggct ttatgcaaca gaaacaataa 4440

taatggagtc atgaacatat ggtgattaaa aacctgtgtc cggatggtgt taccccgatt 4500

tggaataaaa gccagatgga aagcagcctg ctggaagaat gtctgcctgc atgggttcgt 4560

accagctata gcacctttgt tgaaaccatt agcgatagcg catttccgtg tttttggggc 4620

accattggtg aacagaaagg tatgattcgt tatctgattg ttagcagcct gaccgatccg 4680

attctggttg aacataccct ggaaggtatc tacaaatata tcgatgaagt gaacgaaaac 4740

gaactgctgc agcatgaaaa tgcagatctg ctgaccctgg ttatcttttt tccgcctgaa 4800

ccgaccgttc tgaccgttga agaatatgca ggtcaggcat ttgattttct gaatgcactg 4860

catagcctgg atgcagttag ctgtccgtgt cattggagcg cagatccgca gagcgcaaat 4920

tggagctata gcctgggtgg ttgtgcactg tttgttagcg ttagcacacc ggcaaatcag 4980

aaacgtcgta gccgtcatct gggtagcggt atgacctttg ttattacacc ggttgaagtg 5040

ctgctgaata aacatggtgg tgaaaacagc agcatttttc gtcgtgttcg tgaatatgat 5100

ggtattccgc ctcatccgaa tctgctgatt atgcctggta atggtaaagt gggtaatgaa 5160

ctgaccgtgc aggttctgcc ggataataat gatagcgaaa tcagcttcga ttttcagtat 5220

aaattcaaag attgagaagg agatatacat atgaccatcc agattgtgca gcataacctg 5280

gaatatagct ttgtgacccc gaaagaaacc agcgattttg ttgaacgtac catgagcgtt 5340

tttgatcagg catatccgaa atttctgatc catgatgttt gggcagatcc ggcaagcctg 5400

gccctgtttg aaatttatcc ggaatttcag tttggtctgg tggaagcaac cacccagctg 5460

atgattgcac agggtaattg tattccgctg acctatgaaa gccgttttga tgaactgccg 5520

gatgaaggtt gtgattgggc actggcaaaa tggctggaag atcgcgaaca gaatcgtctg 5580

ccgaatgccc tgtgtgttgt gagcattagc atcctgccgg aatatcaggg taaaaatctg 5640

agccagtatc tgatcggcta tatgaaagaa ctggcacagt atcatggtct gaatagcctg 5700

attatggcag cacgtccgag cctgaaatat ctgtatccgc tgattccgat tgaacgctat 5760

attacctggc gtgataaaaa cggcctgatt tttgatccgt ggctgcgtgt taatgttaaa 5820

catggcgcaa aaattgccgg tatctgcttt aaaagcacca ccattaatga taccattgat 5880

ggttgggagg atcgtgttgg tatgcgtttt ccggaaaccg gtgattatat cattccgaaa 5940

ggtctggttc cggtgaaaat tgattatccg aataacatgg gcatctacat cgaaccgaat 6000

atctggctgt attatgatct ggactgagaa ggagatatac atatgatcaa catcgaacag 6060

tttcgccaag aaatcgaaga ttggattatt aacgttgtca gcattccgaa cccgctgacc 6120

ggtaattttc ctccgtgtcc gtatgcaaaa gcagcatggc tgaataatcg tgttagcgtg 6180

cgttggtttc atggtccgga actgcctgaa ctgctgatgg aacaaattcg tacatggaac 6240

aacgatttcg agatggtgat ttttggttgc gatcctcaga atctggatgc acagcgtctg 6300

gaacgttata tcaccaaagc aaattatgtg ctgcccgaat atgacctggt tgcactgggt 6360

agccatccgg ataaacagta tgttggtgat gatgccgaaa atgtgaacaa cgtgattatt 6420

acccatccga aatatgttct ggcaagcgtt cagagcttta gccagctgca agaggcaagt 6480

gatgagctgc tgcgtctggg ttatttccag tattggtcag cagaaaaact ggccgaaatg 6540

aaaagcgaac gtgcaagcca taatctgagc agcattcagc gtaaaaatag ctatcgtatt 6600

atcccgacca accattgaga aggagatata catatgctga ccgcagaaca gaaacaggca 6660

tataccaatg atggctattt taccgtggaa gaagcagttc cgaaagcact gattgaagaa 6720

attcgccatg aagtggaact gatcaccgag cagaaacgtg gtggtgtgct ggcaggcgat 6780

tatgaatggt ggtcagaaca caccattccg gatccggttc gttatcagaa aattatccag 6840

cgtctgctgg aactgccgac cgttatgggt ccggttcagg ccctgattgg tagcgatatt 6900

tttctgttaa ttaccgacct ggcaattatt cgtgcaggca ccggttatat tgcatggcat 6960

caggatcatg gctatgttgt tgaagttctg aacgccctgg caagcatgag caaaaatgag 7020

ctgaatgatg atgcactgcg cctgctggtg ccggttgcaa atcaggcaat ggtgtttatt 7080

accatctatc tgcaggatac cgataacacc atgggcacca tgcgtgtgat tccgagcagc 7140

catcagtggg aacatagtct ggatagcagc agcgccaatt cactgaatgc agaaatttgt 7200

ctgagcctgc ctggtggtgc agcaatgttt tataccccga ccgtttggca taccgcagca 7260

gcaaatacca gcattaccga ttatcgtatg ctgacgctga tcttcaccaa aaacaacatt 7320

aaaccgctgc tggttgatgc cctgaaacgt attatttgag aaggagatat acatatgaca 7380

accaccgatc cgatcctgat taataactgg catgttgtgg caaatgtcga ggattgtaaa 7440

ccgggtagca ttacccgtag ccgtttactg ggtgttaaac tggttctgtg gcgtagctat 7500

gaacagaata gcccgattca ggtttggctg gattattgtc cgcatcgtgg tgttccgctg 7560

agcatgggtg aaattaccaa taataccctg gtttgtccgt atcatggctg gcgttataat 7620

gaagcaggta aatgtattca gattccggca catccgggta tggttccgcc tgcaagcgca 7680

gaagcacgta cctatcatag ccaagaacgt tatggtctgg tttgggtttg tctgggtgat 7740

ccggttaatg atattccgtc atttccggaa tgggatgatc cgaattatca caaaacctac 7800

accaaaagct atctgattaa agcaagcgcc tttcgcgtta tggataattc actggatgtt 7860

agccattttc cgtttattca tgatggctgg ctgggcgatc gtaactatac caaagtggaa 7920

gaatttgaag tgaaactgga taaagatggt ctgacgatgg gcaaatatca gtttcagacc 7980

agccgtattg tgagccatat tgaagatgat agctgggtga attggtttcg tctgagccat 8040

ccgctgtgtc agtattgtgt tagcgaaagt ccggaaatgc gtattgttga tctgatgacc 8100

attacgccga ttgatgaaga aaatagcgtt ctgcgcatgc tgatcatgtg gaatggttat 8160

gaaaccctgg aaagcaaaat gctgacagag tatgatgaaa cgatcgaaca ggatattcgt 8220

attctgcatg cccagcagcc ggtgcgtctg ccgctgctga caccgaagca gattaatacc 8280

cagctgttta gccatgaaat tcatgttccg agcgatcgtt gtaccctggc atatcgtcgt 8340

tggctgaaac aactgggtgt gacctatggt gtttgttgag aaggagatat acatatggca 8400

ggtaaactgg atggtaaggt tgcaattatt accggtgcaa gcagcggtat tggtgaagcc 8460

accgcatttg cactggcagc agaaggtgca aaagttgcaa ttgcagcccg tcgtgcagaa 8520

ctgttacatg cactggccaa acgtattgaa gcaagcggtg gtcaggcact gccgattgtt 8580

accgatatca ccgatgaaag ccaggttaat catctggttc agaaaaccaa agttgaactg 8640

ggtcatgttg atatcctggt gaataatgca ggtattggcg tttttggtgc aatcgatacc 8700

ggtaatccgg cagattggcg tcgtgcattt gatgttaatg tgctgggtgt tctgtatgca 8760

attcatgcag ttctgccttt actgaaagca cagaaaagcg gtcatattgt gaatattagc 8820

agcgtggatg gtcgtattgc acagagcggt gcagttgttt atagcgcagc aaaaagcggt 8880

gttaatgccc tgagcgaagc actgcgtcaa gaagtgagcc tggataatat tcgtgtgacc 8940

attattgaac cgggtctggt agataccccg tttaatgatc tgattagtga tccgattacc 9000

aaacagctga gcaaagaaca gctgtcaacc attactccgc tgcagagcga agatattgca 9060

cgtgccatta tctatgcagt tacccagccg gatcatgtta acgttaatga aattctgatt 9120

cgtccgaccg cagaggataa ttgagaagga gatatacata tgaacctgac cctgaacaaa 9180

gaagaaaaac agctgctgac ggcatatagc ggcaccgaac tgcagctgac agcagatgtt 9240

ctggttattg gtggtggtcc ggcagccgca tgggcagctt gggcagcagg cgcacagggt 9300

gtgaaagtta ttattgtgga taaaggtttt ctgggcacca gcggtgccgc agccgcaagc 9360

ggtaatagcg ttatggcacc gtcaccggaa aattgggaaa aagatgtgag cgaatgttac 9420

agcaaaggta ataatctggc aaatctgcgt tggattgaac gtgttattga aaaagcctgg 9480

ctgtcactgc cgctggttga agattggggt tatcgttttc ctaaagaaaa tggtgaaagc 9540

gtgcgtcaga gctattatgg tcctgaatat atgcgtgttc tgcggaaaaa tctgctgcgc 9600

gttggtgttc agatctttga tcagtcaccg gcactggaat tactgctggc acaggatggt 9660

agcgttgccg gtgcacgtgg tgtgcagcgt cagaatcatc gtacatatac cgttcgtgcc 9720

ggtgccgttg ttctggccaa tggtggttgc gcatttctga gtaaagcact gggttgtaat 9780

accaataccg gtgatggtct gttaatggca gttgaagccg gtggtgaact gagcagtatg 9840

gaagccagca gccattatac cattagcacc gcctttaatg caaccgttac ccgtgcagct 9900

ccgttttatt gggcaagcta taccgatgaa gctggcaatg atctgggtgg ctatattaac 9960

ggtcgtcgtg atccgagctt tctgccgaac gcactgctga aaggtccggt ttatgcacgt 10020

ctggatcgtg caacaccgga aattcaggcg ctggtagaaa aaagccattt tattgcattt 10080

ctgccgtaca agaaagccgg tattgatccg tataccgaac gtgttccggt taccctggtg 10140

ctggaaggca ccgtgcgtgg caccggtggt attcgcattg ttaatgattc atgtggcacc 10200

aaagttccgg gactgtatgc agcgggtgat gcagcaagcc gtgaatttct ggcaggcatt 10260

gccagcggtg gtgatggacc gaatgcagca tgggcaattt caaccggtca gtgggcaggc 10320

gaaggtgcag cagcctttgc aaaaagtctg ggtgcacatg ttcatgaacg cgttgttcgt 10380

ccggcaggcc aggcaggtct gcgtagtcag tatccgggta gcgaaacctt tgatagtgaa 10440

gcagttgttc gtggcgttca ggcagaaatg tttccgctgg aaaaaaacta tctgcgctgt 10500

gaacagggac tgctggatag cctggcaaaa ctggaaatgc tgtggcagca ggttcagggt 10560

aatccgaaac aggatacagt tcgtgatctg gaattttcac gtcgtgcggc agcactggtt 10620

agcgtggcac gttgggcata ttttagcgca ctgcatcgta aagaaacccg tagcgaacat 10680

atccgtattg attacccgga aacggatccg aatcaactgt attatcaggc aaccggtggc 10740

ctggaacgtc tgtgggtgcg tcgtgattgg gttaaagatg caagcgccac ccctccggtg 10800

ctgaccacct gagaaggaga tatacatatg attgaactgg tgagccataa gctgtgcatt 10860

aattgtaatg tttgtgttca ggtgtgcccg accaatgttt ttgatgcagt gccgaatcag 10920

cctccggcaa ttgcacgcca agaagattgt cagacctgtt ttatttgtga agcatattgt 10980

cctgcagatg cgctgtatgt tgcaccgcag agccatacca atgttgcagt taacgaagat 11040

gatttaatcg acagcggcat tatgggtgaa tatcgtcgca ttctgggttg gggctatggt 11100

cgtaaaaaca atagcgaact ggataccgac cataaactgc gtctgtttga atgagaagga 11160

gatatacata tgtcatttca gaaatttgtg caagaagcag cctataaagt cgcaccgttt 11220

aaaccgaatc gttttgccaa aattagcgag cgtgaagata aatgtgcaat tccggttccg 11280

gcatggcgtg cactgctggc caatcgtgac ctgtttacct ggaaaggtat tccgtttctg 11340

aaaggttgta ccgaaattgc actgtatagc atgctgctgt atgaactgcg tccgaaaacg 11400

attattgaaa ttggtgcgct gagcggtggt agcgcaattt ggctggcaga tcatctggaa 11460

ctgtttcaga ttgaaggttg cgtgtattgc attgatattg atctgtctct gctggacgaa 11520

aaagcaaaaa ccgatagccg tgttcatttt ctggaaggtg attgcaataa tatgggtgca 11580

attatgtcaa gcgagctgct gagtggtctg gcacatcctt ggctgattgt tgaagatgca 11640

catgcaaatg ccgttggtgt ggttgaatat tttcacgaaa acggtctgaa aagtggcgat 11700

tacctgatcg tggaagatac caataaaaca atgtgggaac tggatcgcga agaactggac 11760

cgtgatgacc tggatgaaca agaactgatc gaaaaaggtg agcagaaatt agcagaactg 11820

aaaagctggc tgatgctgca tgagaatgaa tatctgatag atacctacta tcaggatatg 11880

tatggctata atggtagccg taattggaac agcattctga aacgtgtgga aaagaacttt 11940

taatctaact aaaaacaccc taacgggtgt tttttctttt ctggtctccc cgaagttcct 12000

attctctaga aagtatagga acttcgctgg attgggccgc gaaattaacc ggcctgagca 12060

atgtcccagc tttaatcgct gcagctcaac aggctgatga aagtgccgag ccagtttggt 12120

ttctgcctta tctttccggc gagcgtacgc cacacaataa tccccaggcg aagggggttt 12180

tctttggttt gactcatcaa catggcccca atgaactggc gcgagcagtg ctggaaggcg 12240

tgggttatgc gctggcagat ggcatggatg tcgtgcatgc ctgcggtatt aaaccgcaaa 12300

gtgttacgtt gattgggggc ggggcgcgta gtgagtactg gcgtcagatg ctggcggata 12360

tcagcggtca gcagctcgat taccgtacgg gaggggatgt ggggccagca ctgggcgcag 12420

caaggctggc gcagatcgcg gcgaatccag agaaatcgct cattgaattg ttgccgcaac 12480

taccgttaga acagtcgcat ctaccagatg cgcagcgtta tgccgcttat cagccacgac 12540

gagaaacgtt ccgtcgcctc tatcagcaac ttctgccatt aatggcgtaa acgttatccc 12600

ctgcctgacc gggtggggga taattcacat ctatatatct cagtaattaa ttaatattta 12660

gtatgaattt attctgaaaa tcatttgtta atggcatttt tcagttttgt ctttcgttgg 12720

ttactcgtaa tgtatcgctg gtagatatgg agatcgtt 12758

<210> 93

<211> 7185

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>it is integrated into the sequence of the sxt3 segment version 2 in Escherichia coli xylose operon

<400> 93

ggtgtcagga ggcgggaggg gacatctttc aggccattat tcagtgaggt ccagccttgc 60

aagaagcgga tacaggagtg caaaaaatgg ctatctctag aaaggcctac cccttaggct 120

ttatgcaaca gaaacaataa taatggagtc atgaacatat ggtgattaaa aacctgtgtc 180

cggatggtgt taccccgatt tggaataaaa gccagatgga aagcagcctg ctggaagaat 240

gtctgcctgc atgggttcgt accagctata gcacctttgt tgaaaccatt agcgatagcg 300

catttccgtg tttttggggc accattggtg aacagaaagg tatgattcgt tatctgattg 360

ttagcagcct gaccgatccg attctggttg aacataccct ggaaggtatc tacaaatata 420

tcgatgaagt gaacgaaaac gaactgctgc agcatgaaaa tgcagatctg ctgaccctgg 480

ttatcttttt tccgcctgaa ccgaccgttc tgaccgttga agaatatgca ggtcaggcat 540

ttgattttct gaatgcactg catagcctgg atgcagttag ctgtccgtgt cattggagcg 600

cagatccgca gagcgcaaat tggagctata gcctgggtgg ttgtgcactg tttgttagcg 660

ttagcacacc ggcaaatcag aaacgtcgta gccgtcatct gggtagcggt atgacctttg 720

ttattacacc ggttgaagtg ctgctgaata aacatggtgg tgaaaacagc agcatttttc 780

gtcgtgttcg tgaatatgat ggtattccgc ctcatccgaa tctgctgatt atgcctggta 840

atggtaaagt gggtaatgaa ctgaccgtgc aggttctgcc ggataataat gatagcgaaa 900

tcagcttcga ttttcagtat aaattcaaag attgagaagg agatatacat atgaccatcc 960

agattgtgca gcataacctg gaatatagct ttgtgacccc gaaagaaacc agcgattttg 1020

ttgaacgtac catgagcgtt tttgatcagg catatccgaa atttctgatc catgatgttt 1080

gggcagatcc ggcaagcctg gccctgtttg aaatttatcc ggaatttcag tttggtctgg 1140

tggaagcaac cacccagctg atgattgcac agggtaattg tattccgctg acctatgaaa 1200

gccgttttga tgaactgccg gatgaaggtt gtgattgggc actggcaaaa tggctggaag 1260

atcgcgaaca gaatcgtctg ccgaatgccc tgtgtgttgt gagcattagc atcctgccgg 1320

aatatcaggg taaaaatctg agccagtatc tgatcggcta tatgaaagaa ctggcacagt 1380

atcatggtct gaatagcctg attatggcag cacgtccgag cctgaaatat ctgtatccgc 1440

tgattccgat tgaacgctat attacctggc gtgataaaaa cggcctgatt tttgatccgt 1500

ggctgcgtgt taatgttaaa catggcgcaa aaattgccgg tatctgcttt aaaagcacca 1560

ccattaatga taccattgat ggttgggagg atcgtgttgg tatgcgtttt ccggaaaccg 1620

gtgattatat cattccgaaa ggtctggttc cggtgaaaat tgattatccg aataacatgg 1680

gcatctacat cgaaccgaat atctggctgt attatgatct ggactgagaa ggagatatac 1740

atatgctgac cgcagaacag aaacaggcat ataccaatga tggctatttt accgtggaag 1800

aagcagttcc gaaagcactg attgaagaaa ttcgccatga agtggaactg atcaccgagc 1860

agaaacgtgg tggtgtgctg gcaggcgatt atgaatggtg gtcagaacac accattccgg 1920

atccggttcg ttatcagaaa attatccagc gtctgctgga actgccgacc gttatgggtc 1980

cggttcaggc cctgattggt agcgatattt ttctgttaat taccgacctg gcaattattc 2040

gtgcaggcac cggttatatt gcatggcatc aggatcatgg ctatgttgtt gaagttctga 2100

acgccctggc aagcatgagc aaaaatgagc tgaatgatga tgcactgcgc ctgctggtgc 2160

cggttgcaaa tcaggcaatg gtgtttatta ccatctatct gcaggatacc gataacacca 2220

tgggcaccat gcgtgtgatt ccgagcagcc atcagtggga acatagtctg gatagcagca 2280

gcgccaattc actgaatgca gaaatttgtc tgagcctgcc tggtggtgca gcaatgtttt 2340

ataccccgac cgtttggcat accgcagcag caaataccag cattaccgat tatcgtatgc 2400

tgacgctgat cttcaccaaa aacaacatta aaccgctgct ggttgatgcc ctgaaacgta 2460

ttatttgaga aggagatata catatgacaa ccaccgatcc gatcctgatt aataactggc 2520

atgttgtggc aaatgtcgag gattgtaaac cgggtagcat tacccgtagc cgtttactgg 2580

gtgttaaact ggttctgtgg cgtagctatg aacagaatag cccgattcag gtttggctgg 2640

attattgtcc gcatcgtggt gttccgctga gcatgggtga aattaccaat aataccctgg 2700

tttgtccgta tcatggctgg cgttataatg aagcaggtaa atgtattcag attccggcac 2760

atccgggtat ggttccgcct gcaagcgcag aagcacgtac ctatcatagc caagaacgtt 2820

atggtctggt ttgggtttgt ctgggtgatc cggttaatga tattccgtca tttccggaat 2880

gggatgatcc gaattatcac aaaacctaca ccaaaagcta tctgattaaa gcaagcgcct 2940

ttcgcgttat ggataattca ctggatgtta gccattttcc gtttattcat gatggctggc 3000

tgggcgatcg taactatacc aaagtggaag aatttgaagt gaaactggat aaagatggtc 3060

tgacgatggg caaatatcag tttcagacca gccgtattgt gagccatatt gaagatgata 3120

gctgggtgaa ttggtttcgt ctgagccatc cgctgtgtca gtattgtgtt agcgaaagtc 3180

cggaaatgcg tattgttgat ctgatgacca ttacgccgat tgatgaagaa aatagcgttc 3240

tgcgcatgct gatcatgtgg aatggttatg aaaccctgga aagcaaaatg ctgacagagt 3300

atgatgaaac gatcgaacag gatattcgta ttctgcatgc ccagcagccg gtgcgtctgc 3360

cgctgctgac accgaagcag attaataccc agctgtttag ccatgaaatt catgttccga 3420

gcgatcgttg taccctggca tatcgtcgtt ggctgaaaca actgggtgtg acctatggtg 3480

tttgttgaga aggagatata catatggcag gtaaactgga tggtaaggtt gcaattatta 3540

ccggtgcaag cagcggtatt ggtgaagcca ccgcatttgc actggcagca gaaggtgcaa 3600

aagttgcaat tgcagcccgt cgtgcagaac tgttacatgc actggccaaa cgtattgaag 3660

caagcggtgg tcaggcactg ccgattgtta ccgatatcac cgatgaaagc caggttaatc 3720

atctggttca gaaaaccaaa gttgaactgg gtcatgttga tatcctggtg aataatgcag 3780

gtattggcgt ttttggtgca atcgataccg gtaatccggc agattggcgt cgtgcatttg 3840

atgttaatgt gctgggtgtt ctgtatgcaa ttcatgcagt tctgccttta ctgaaagcac 3900

agaaaagcgg tcatattgtg aatattagca gcgtggatgg tcgtattgca cagagcggtg 3960

cagttgttta tagcgcagca aaaagcggtg ttaatgccct gagcgaagca ctgcgtcaag 4020

aagtgagcct ggataatatt cgtgtgacca ttattgaacc gggtctggta gataccccgt 4080

ttaatgatct gattagtgat ccgattacca aacagctgag caaagaacag ctgtcaacca 4140

ttactccgct gcagagcgaa gatattgcac gtgccattat ctatgcagtt acccagccgg 4200

atcatgttaa cgttaatgaa attctgattc gtccgaccgc agaggataat tgagaaggag 4260

atatacatat gaacctgacc ctgaacaaag aagaaaaaca gctgctgacg gcatatagcg 4320

gcaccgaact gcagctgaca gcagatgttc tggttattgg tggtggtccg gcagccgcat 4380

gggcagcttg ggcagcaggc gcacagggtg tgaaagttat tattgtggat aaaggttttc 4440

tgggcaccag cggtgccgca gccgcaagcg gtaatagcgt tatggcaccg tcaccggaaa 4500

attgggaaaa agatgtgagc gaatgttaca gcaaaggtaa taatctggca aatctgcgtt 4560

ggattgaacg tgttattgaa aaagcctggc tgtcactgcc gctggttgaa gattggggtt 4620

atcgttttcc taaagaaaat ggtgaaagcg tgcgtcagag ctattatggt cctgaatata 4680

tgcgtgttct gcggaaaaat ctgctgcgcg ttggtgttca gatctttgat cagtcaccgg 4740

cactggaatt actgctggca caggatggta gcgttgccgg tgcacgtggt gtgcagcgtc 4800

agaatcatcg tacatatacc gttcgtgccg gtgccgttgt tctggccaat ggtggttgcg 4860

catttctgag taaagcactg ggttgtaata ccaataccgg tgatggtctg ttaatggcag 4920

ttgaagccgg tggtgaactg agcagtatgg aagccagcag ccattatacc attagcaccg 4980

cctttaatgc aaccgttacc cgtgcagctc cgttttattg ggcaagctat accgatgaag 5040

ctggcaatga tctgggtggc tatattaacg gtcgtcgtga tccgagcttt ctgccgaacg 5100

cactgctgaa aggtccggtt tatgcacgtc tggatcgtgc aacaccggaa attcaggcgc 5160

tggtagaaaa aagccatttt attgcatttc tgccgtacaa gaaagccggt attgatccgt 5220

ataccgaacg tgttccggtt accctggtgc tggaaggcac cgtgcgtggc accggtggta 5280

ttcgcattgt taatgattca tgtggcacca aagttccggg actgtatgca gcgggtgatg 5340

cagcaagccg tgaatttctg gcaggcattg ccagcggtgg tgatggaccg aatgcagcat 5400

gggcaatttc aaccggtcag tgggcaggcg aaggtgcagc agcctttgca aaaagtctgg 5460

gtgcacatgt tcatgaacgc gttgttcgtc cggcaggcca ggcaggtctg cgtagtcagt 5520

atccgggtag cgaaaccttt gatagtgaag cagttgttcg tggcgttcag gcagaaatgt 5580

ttccgctgga aaaaaactat ctgcgctgtg aacagggact gctggatagc ctggcaaaac 5640

tggaaatgct gtggcagcag gttcagggta atccgaaaca ggatacagtt cgtgatctgg 5700

aattttcacg tcgtgcggca gcactggtta gcgtggcacg ttgggcatat tttagcgcac 5760

tgcatcgtaa agaaacccgt agcgaacata tccgtattga ttacccggaa acggatccga 5820

atcaactgta ttatcaggca accggtggcc tggaacgtct gtgggtgcgt cgtgattggg 5880

ttaaagatgc aagcgccacc cctccggtgc tgaccacctg agaaggagat atacatatga 5940

ttgaactggt gagccataag ctgtgcatta attgtaatgt ttgtgttcag gtgtgcccga 6000

ccaatgtttt tgatgcagtg ccgaatcagc ctccggcaat tgcacgccaa gaagattgtc 6060

agacctgttt tatttgtgaa gcatattgtc ctgcagatgc gctgtatgtt gcaccgcaga 6120

gccataccaa tgttgcagtt aacgaagatg atttaatcga cagcggcatt atgggtgaat 6180

atcgtcgcat tctgggttgg ggctatggtc gtaaaaacaa tagcgaactg gataccgacc 6240

ataaactgcg tctgtttgaa tgagaaggag atatacatat gtcatttcag aaatttgtgc 6300

aagaagcagc ctataaagtc gcaccgttta aaccgaatcg ttttgccaaa attagcgagc 6360

gtgaagataa atgtgcaatt ccggttccgg catggcgtgc actgctggcc aatcgtgacc 6420

tgtttacctg gaaaggtatt ccgtttctga aaggttgtac cgaaattgca ctgtatagca 6480

tgctgctgta tgaactgcgt ccgaaaacga ttattgaaat tggtgcgctg agcggtggta 6540

gcgcaatttg gctggcagat catctggaac tgtttcagat tgaaggttgc gtgtattgca 6600

ttgatattga tctgtctctg ctggacgaaa aagcaaaaac cgatagccgt gttcattttc 6660

tggaaggtga ttgcaataat atgggtgcaa ttatgtcaag cgagctgctg agtggtctgg 6720

cacatccttg gctgattgtt gaagatgcac atgcaaatgc cgttggtgtg gttgaatatt 6780

ttcacgaaaa cggtctgaaa agtggcgatt acctgatcgt ggaagatacc aataaaacaa 6840

tgtgggaact ggatcgcgaa gaactggacc gtgatgacct ggatgaacaa gaactgatcg 6900

aaaaaggtga gcagaaatta gcagaactga aaagctggct gatgctgcat gagaatgaat 6960

atctgataga tacctactat caggatatgt atggctataa tggtagccgt aattggaaca 7020

gcattctgaa acgtgtggaa aagaactttt aatctaacta aaaacaccct aacgggtgtt 7080

ttttcttttc tggtctcccc gaagttccta ttctctagaa agtataggaa cttcgctgga 7140

ttgggccgcg aaattaaccg gcctgagcaa tgtcccagct ttaat 7185

<210> 94

<211> 5599

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>it is integrated into the sequence of the sxt3 segment version 3 in Escherichia coli xylose operon

<400> 94

ggtgtcagga ggcgggaggg gacatctttc aggccattat tcagtgaggt ccagccttgc 60

aagaagcgga tacaggagtg caaaaaatgg ctatctctag aaaggcctac cccttaggct 120

ttatgcaaca gaaacaataa taatggagtc atgaacatgc tgaccgcaga acagaaacag 180

gcatatacca atgatggcta ttttaccgtg gaagaagcag ttccgaaagc actgattgaa 240

gaaattcgcc atgaagtgga actgatcacc gagcagaaac gtggtggtgt gctggcaggc 300

gattatgaat ggtggtcaga acacaccatt ccggatccgg ttcgttatca gaaaattatc 360

cagcgtctgc tggaactgcc gaccgttatg ggtccggttc aggccctgat tggtagcgat 420

atttttctgt taattaccga cctggcaatt attcgtgcag gcaccggtta tattgcatgg 480

catcaggatc atggctatgt tgttgaagtt ctgaacgccc tggcaagcat gagcaaaaat 540

gagctgaatg atgatgcact gcgcctgctg gtgccggttg caaatcaggc aatggtgttt 600

attaccatct atctgcagga taccgataac accatgggca ccatgcgtgt gattccgagc 660

agccatcagt gggaacatag tctggatagc agcagcgcca attcactgaa tgcagaaatt 720

tgtctgagcc tgcctggtgg tgcagcaatg ttttataccc cgaccgtttg gcataccgca 780

gcagcaaata ccagcattac cgattatcgt atgctgacgc tgatcttcac caaaaacaac 840

attaaaccgc tgctggttga tgccctgaaa cgtattattt gagaaggaga tatacatatg 900

acaaccaccg atccgatcct gattaataac tggcatgttg tggcaaatgt cgaggattgt 960

aaaccgggta gcattacccg tagccgttta ctgggtgtta aactggttct gtggcgtagc 1020

tatgaacaga atagcccgat tcaggtttgg ctggattatt gtccgcatcg tggtgttccg 1080

ctgagcatgg gtgaaattac caataatacc ctggtttgtc cgtatcatgg ctggcgttat 1140

aatgaagcag gtaaatgtat tcagattccg gcacatccgg gtatggttcc gcctgcaagc 1200

gcagaagcac gtacctatca tagccaagaa cgttatggtc tggtttgggt ttgtctgggt 1260

gatccggtta atgatattcc gtcatttccg gaatgggatg atccgaatta tcacaaaacc 1320

tacaccaaaa gctatctgat taaagcaagc gcctttcgcg ttatggataa ttcactggat 1380

gttagccatt ttccgtttat tcatgatggc tggctgggcg atcgtaacta taccaaagtg 1440

gaagaatttg aagtgaaact ggataaagat ggtctgacga tgggcaaata tcagtttcag 1500

accagccgta ttgtgagcca tattgaagat gatagctggg tgaattggtt tcgtctgagc 1560

catccgctgt gtcagtattg tgttagcgaa agtccggaaa tgcgtattgt tgatctgatg 1620

accattacgc cgattgatga agaaaatagc gttctgcgca tgctgatcat gtggaatggt 1680

tatgaaaccc tggaaagcaa aatgctgaca gagtatgatg aaacgatcga acaggatatt 1740

cgtattctgc atgcccagca gccggtgcgt ctgccgctgc tgacaccgaa gcagattaat 1800

acccagctgt ttagccatga aattcatgtt ccgagcgatc gttgtaccct ggcatatcgt 1860

cgttggctga aacaactggg tgtgacctat ggtgtttgtt gagaaggaga tatacatatg 1920

gcaggtaaac tggatggtaa ggttgcaatt attaccggtg caagcagcgg tattggtgaa 1980

gccaccgcat ttgcactggc agcagaaggt gcaaaagttg caattgcagc ccgtcgtgca 2040

gaactgttac atgcactggc caaacgtatt gaagcaagcg gtggtcaggc actgccgatt 2100

gttaccgata tcaccgatga aagccaggtt aatcatctgg ttcagaaaac caaagttgaa 2160

ctgggtcatg ttgatatcct ggtgaataat gcaggtattg gcgtttttgg tgcaatcgat 2220

accggtaatc cggcagattg gcgtcgtgca tttgatgtta atgtgctggg tgttctgtat 2280

gcaattcatg cagttctgcc tttactgaaa gcacagaaaa gcggtcatat tgtgaatatt 2340

agcagcgtgg atggtcgtat tgcacagagc ggtgcagttg tttatagcgc agcaaaaagc 2400

ggtgttaatg ccctgagcga agcactgcgt caagaagtga gcctggataa tattcgtgtg 2460

accattattg aaccgggtct ggtagatacc ccgtttaatg atctgattag tgatccgatt 2520

accaaacagc tgagcaaaga acagctgtca accattactc cgctgcagag cgaagatatt 2580

gcacgtgcca ttatctatgc agttacccag ccggatcatg ttaacgttaa tgaaattctg 2640

attcgtccga ccgcagagga taattgagaa ggagatatac atatgaacct gaccctgaac 2700

aaagaagaaa aacagctgct gacggcatat agcggcaccg aactgcagct gacagcagat 2760

gttctggtta ttggtggtgg tccggcagcc gcatgggcag cttgggcagc aggcgcacag 2820

ggtgtgaaag ttattattgt ggataaaggt tttctgggca ccagcggtgc cgcagccgca 2880

agcggtaata gcgttatggc accgtcaccg gaaaattggg aaaaagatgt gagcgaatgt 2940

tacagcaaag gtaataatct ggcaaatctg cgttggattg aacgtgttat tgaaaaagcc 3000

tggctgtcac tgccgctggt tgaagattgg ggttatcgtt ttcctaaaga aaatggtgaa 3060

agcgtgcgtc agagctatta tggtcctgaa tatatgcgtg ttctgcggaa aaatctgctg 3120

cgcgttggtg ttcagatctt tgatcagtca ccggcactgg aattactgct ggcacaggat 3180

ggtagcgttg ccggtgcacg tggtgtgcag cgtcagaatc atcgtacata taccgttcgt 3240

gccggtgccg ttgttctggc caatggtggt tgcgcatttc tgagtaaagc actgggttgt 3300

aataccaata ccggtgatgg tctgttaatg gcagttgaag ccggtggtga actgagcagt 3360

atggaagcca gcagccatta taccattagc accgccttta atgcaaccgt tacccgtgca 3420

gctccgtttt attgggcaag ctataccgat gaagctggca atgatctggg tggctatatt 3480

aacggtcgtc gtgatccgag ctttctgccg aacgcactgc tgaaaggtcc ggtttatgca 3540

cgtctggatc gtgcaacacc ggaaattcag gcgctggtag aaaaaagcca ttttattgca 3600

tttctgccgt acaagaaagc cggtattgat ccgtataccg aacgtgttcc ggttaccctg 3660

gtgctggaag gcaccgtgcg tggcaccggt ggtattcgca ttgttaatga ttcatgtggc 3720

accaaagttc cgggactgta tgcagcgggt gatgcagcaa gccgtgaatt tctggcaggc 3780

attgccagcg gtggtgatgg accgaatgca gcatgggcaa tttcaaccgg tcagtgggca 3840

ggcgaaggtg cagcagcctt tgcaaaaagt ctgggtgcac atgttcatga acgcgttgtt 3900

cgtccggcag gccaggcagg tctgcgtagt cagtatccgg gtagcgaaac ctttgatagt 3960

gaagcagttg ttcgtggcgt tcaggcagaa atgtttccgc tggaaaaaaa ctatctgcgc 4020

tgtgaacagg gactgctgga tagcctggca aaactggaaa tgctgtggca gcaggttcag 4080

ggtaatccga aacaggatac agttcgtgat ctggaatttt cacgtcgtgc ggcagcactg 4140

gttagcgtgg cacgttgggc atattttagc gcactgcatc gtaaagaaac ccgtagcgaa 4200

catatccgta ttgattaccc ggaaacggat ccgaatcaac tgtattatca ggcaaccggt 4260

ggcctggaac gtctgtgggt gcgtcgtgat tgggttaaag atgcaagcgc cacccctccg 4320

gtgctgacca cctgagaagg agatatacat atgattgaac tggtgagcca taagctgtgc 4380

attaattgta atgtttgtgt tcaggtgtgc ccgaccaatg tttttgatgc agtgccgaat 4440

cagcctccgg caattgcacg ccaagaagat tgtcagacct gttttatttg tgaagcatat 4500

tgtcctgcag atgcgctgta tgttgcaccg cagagccata ccaatgttgc agttaacgaa 4560

gatgatttaa tcgacagcgg cattatgggt gaatatcgtc gcattctggg ttggggctat 4620

ggtcgtaaaa acaatagcga actggatacc gaccataaac tgcgtctgtt tgaatgagaa 4680

ggagatatac atatgtcatt tcagaaattt gtgcaagaag cagcctataa agtcgcaccg 4740

tttaaaccga atcgttttgc caaaattagc gagcgtgaag ataaatgtgc aattccggtt 4800

ccggcatggc gtgcactgct ggccaatcgt gacctgttta cctggaaagg tattccgttt 4860

ctgaaaggtt gtaccgaaat tgcactgtat agcatgctgc tgtatgaact gcgtccgaaa 4920

acgattattg aaattggtgc gctgagcggt ggtagcgcaa tttggctggc agatcatctg 4980

gaactgtttc agattgaagg ttgcgtgtat tgcattgata ttgatctgtc tctgctggac 5040

gaaaaagcaa aaaccgatag ccgtgttcat tttctggaag gtgattgcaa taatatgggt 5100

gcaattatgt caagcgagct gctgagtggt ctggcacatc cttggctgat tgttgaagat 5160

gcacatgcaa atgccgttgg tgtggttgaa tattttcacg aaaacggtct gaaaagtggc 5220

gattacctga tcgtggaaga taccaataaa acaatgtggg aactggatcg cgaagaactg 5280

gaccgtgatg acctggatga acaagaactg atcgaaaaag gtgagcagaa attagcagaa 5340

ctgaaaagct ggctgatgct gcatgagaat gaatatctga tagataccta ctatcaggat 5400

atgtatggct ataatggtag ccgtaattgg aacagcattc tgaaacgtgt ggaaaagaac 5460

ttttaatcta actaaaaaca ccctaacggg tgttttttct tttctggtct ccccgaagtt 5520

cctattctct agaaagtata ggaacttcgc tggattgggc cgcgaaatta accggcctga 5580

gcaatgtccc agctttaat 5599

<210> 95

<211> 7064

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>it is integrated into the sequence of the sxt1 segment in E coli lac operon

<400> 95

atgaccatga ttacggattc actggccgtc gttttacaac gtcgtgactg ggaaaaccct 60

ggcgttaccc aacttaatcg ccttgcagca catccccctt tcgccagctg gcgtaatagc 120

gaagaggccc gcaccgatcg cccttcccaa cagttgcgca gcctgaatgg cgaatggcgc 180

tttgcctggt ttccggcacc agaagcggtg ccggaaagct ggctggagtg cgatcttcct 240

gaggccgata ctgtcgtcgt cccctcaaac tggcagatgc acggttacga tgcgcccatc 300

tacaccaacg tgacctatcc cattacggtc aatccgccgt ttgttcccac ggagaatccg 360

acgggttgtt actcgctcac atttaatgtt gatgaaagct ggctacagga aggccagacg 420

cgaattattt ttgatggcgt taactcggcg tttcatctgt ggtgcaacgg gcgctgggtc 480

ggttacggcc aggacagtca gtggagatgc ccaagggcac ttcgggtcga ggaacccgac 540

ctgcattggg acgcggccac ggagagcgcg ggcaaacgcc ggcactatag ccagtggagt 600

ttgtaaaacg ctatttcaga gcttggagag tgtctaagaa agccgggcga tgccaaccca 660

tcccttcttc ggctacgttc gtaatcaagc cacttccttt ttgcattgac gcagggtgtc 720

ggaaggcaac tcgccgaacg cgctcctata gttttcagcg aagcgtccca aatgtaagaa 780

gccgtagtct agggctatct cagttatact acgcacattg gcactgggat cgttcaagca 840

ggcgcggatg ctttcgagct tgcggttgcg gatgtagttc ttcggcgtgg tgccggcatg 900

cttctcgaac aaattgtaga gcgagcgtgg actcatcatc gccagctccg ctaaccgctc 960

aaggctgata ttccgtttga gattctcctc aatgaattga acgactcgct cgaaagacgg 1020

gttacctttg ctgaaaattt cacggctgac attgctgccc agcatttcga gcagcttgga 1080

agcgatgatc cccgcatagt gctcttggac ccgaggcatc gactttgtat gttccgcttc 1140

gtcacaaact aacccgagta gattgataaa gccatcgagt tgctggagat tgtgtcgcgc 1200

ggcgaaacgg ataccctccc tcggcttgtg ccaattgttg tcactgcatg cccgatcaag 1260

gaccactgag ggcaatttaa cgataaattt ctcgcaatct tctgaatagg tcaggtcggc 1320

ttggtcatcc ggattgagca gcaatagttc gcccggcgca aaatagtgct cctggccatg 1380

gccacgccac aggcaatggc ctttgagtat tatttgcaga tgataacagg tctctaatcc 1440

aggcgagatt accctcacgc taccgccgta gctgattcga cacaggtcga ggcatccgaa 1500

gattctgtgg tgcagcctgc ctgccggggg cccgcccttg ggcaggcgaa tagagtgcgt 1560

accgacatac tggttaacat aatcggagac tgcatagggc tcggcgtgga cgaagatctg 1620

acttttctcg ttcaataagc aaaaatccat agttcacggt tctcttattt taatgtgggc 1680

tgcttggtgt gatgtagaaa ggcgccaagt cgatgaaaat gcaggaatta attcgcagat 1740

cctggcggat gagagaagat tttcagcctg atacagatta aatcagaacg cagaagcggt 1800

ctgataaaac agaatttgcc tggcggcagt agcgcggtgg tcccacctga ccccatgccg 1860

aactcagaag tgaaacgccg tagcgccgat ggtagtgtgg ggtctcccca tgcgagagta 1920

gggaactgcc aggcatcaaa taaaacgaaa ggctcagtcg aaagactggg cctttcgttt 1980

tatctgttgt ttgtcggtga acgctctcct gagtaggaca aatccgccgg gagcggattt 2040

gaacgttgcg aagcaacggc ccggagggtg gcgggcagga cgcccgccat aaactgccag 2100

gcatcaaatt aagcagaagg ccatcctgac ggatggcctt tttgcgtaga tcccagcctt 2160

gcaagaagcg gatacaggag tgcaaaaaat ggctatctct agaaaggcct accccttagg 2220

ctttatgcaa cagaaacaat aataatggag tcatgaacat gctgcagaaa atcaatcgtt 2280

atacccatgg ttttgttgcc gttccggtta ttctggcatg tcgtgaaaaa ggtgtttttg 2340

aactgctggc agatgaaagt ccgctgagcc tgaatcagat ggttgaacat ctgggtgcca 2400

atagcggtca ttttcaggtt gcactgcgta tgctggaaag tctgcattgg ctgagccgta 2460

ataaagaact gaaatatagc ctgaccgcag aagcagcaat tcataacaaa attagcgaag 2520

atatcctgca gctgtataat ctgccgattc agagctatct ggaaggtaaa cagggcaatc 2580

tgctgggtcg ttggattgaa cgtagctgtc agctgtggaa tctggataat ccgctgatgg 2640

cagattttct ggatggtctg ctggttattc cgctgctgct ggcactgcat aaacataacc 2700

tgctggccga ttctgaagat aaaccgctgc tgagcagcct gagcagtacc gttcaagaag 2760

aactgggtaa actgtttctg catctgggtt gggcagatct gacagcaggt cgtctgacca 2820

ttaccgaact gggtcgcttt atgggtgaac gtgcactgaa taccgcaatt gttgcaagct 2880

ataccccgat gctgagtcgt attcatgatg ttctgtttgg taattgcctg agcgtttttc 2940

agcgtgatgc aagcggtcat gaacgtcata ttgatcgtac cctgaatgtt attggtagcg 3000

gttttcagca ccagaaatac tttgcagatc tggaagaaag cattctgagc gtgtttaatc 3060

agctgccgct ggaagaacag ccgaaataca ttaccgatat gggttgtggt gatggcaccc 3120

tgctgaaacg tgtttgggaa accattcagt ttaaaagcgc acgtggtaaa gcactggaac 3180

agtatccgct gcgtctgatt ggtgttgatt ataatgaagc aagcctgaaa gcaaccaccc 3240

gtaccctggc aagcctgccg catctggttc tgcagggtga tattggtaat ccggaacaaa 3300

tggttcgtag cctggaagca catggcattc atgatccgga aaatattctg catattcgca 3360

gctttctgga tcacgatcgt ctgtttattc cgcctcagaa acgtaatgaa ctgaaagaac 3420

gtgcccatct gccgtatcag agtgtttgtg ttgatgatca gggtgaactg attcctccgc 3480

atgttatggt tcagagcctg gtggaacacc tggaacgttg gagccaggtt gttaataaac 3540

atggtctgat gattctggaa gtgcattgtc tggaaccgcg tgttgtttat cagtttctgg 3600

ataaaagcga aaacctgcac tttgatgcat ttcagggttt tagccagcag tatctggttg 3660

aagccgaagt ttttctgatg agcgcagcac aggttggtct gtttccgaaa ctggaactga 3720

gcaaacgtta tccgaaaacc tttccgttta cccgtattac cctgaactat ttcgaaaaac 3780

gtccgtacaa aatcagccat gcatatctga gcgatctgcc tgcactggtt gacctggaag 3840

ttaaatgttg gcctgagaat ctgcgtgcaa gcacccatga aattcgtcgt cgtctggaac 3900

tgaatccgca gggtaacctg gttctgatta ttgaagatca gattatcggt gccatttaca 3960

gccagaccat tacaagcacc gaagccctgg aaaatgttaa atatgcacag gttccgaccc 4020

tgcatacacc gcagggttca gtgattcagc tgctggccct gaacattctg ccggaatttc 4080

aggcacgtgg tctgggcaat gaactgcgtg attttatgct gtattattgc accctgaaag 4140

gtggtattga aagcgttgtt ggtgttaccc gttgtcgcaa ttatgtgaat tatagccaga 4200

tgccgatgat ggaatatctg aaactgcata atgaacagcg tcaactgctg gatccgattg 4260

ttggttttca tgttagcggt ggtgcagaaa ttcgtggcat tattgcaaat tatcgtccgg 4320

aagatacaga taatctgggt atgggtattc tgatcgaata taacctgcgt gatagcgcac 4380

tgcattcacc gggtgatcgt aaaggtccgt atatcaatag cgcaattggt agcctggttc 4440

cgaaagcgac cagcgcaacc aaagaaaaca aaaccgttgc ggatctggtg aaagaatgta 4500

ttctgaaagt gatgggtagc cagcgtcagg cagcatatgc accgcagcag aaactgctgg 4560

acatgggtct ggatagcctg gatctgctgg aactgcagac cctgctggaa gaacgtctgg 4620

gtattaatct gagcggcacc ttttttctgc aaaaaaacac cccgaccgcc atcattacct 4680

attttcagaa tcaggtcgtg caagagaaac agagtgatct ggcaccgcct gttgatagcg 4740

ccaatgaaat caatacactg gaaaacgttg tgaatcagca gaaaattccg caggttacac 4800

gtgttgttac cgaacagcag ggacgtaaag ttctgattga tggtcattgg gttattgatt 4860

ttgccagctg taattatctg ggcctggacc tgcatccgaa agttaaagaa gcaattcctc 4920

cggcactgga taaatggggc acccatccga gctggacccg tctggttgca agtccggcaa 4980

tttatgagga actggaagag gaactgtcaa aactgctggg tgtgccggat gttctggttt 5040

ttccggcagt tacactgctg cagattggta ttctgcctct gctgaccggt aataatggtg 5100

tgatttttgg cgatattgca gcccatcgtt gtatttatga agcatgttgt ctggcccagc 5160

ataaaggtgc acagtttatt cagtatcgtc ataacgacct gaatgatctg gccgaaaaac 5220

tggccaaata tccgcctgaa caggttaaaa tcattgtgat cgatggtgtg tatagcatga 5280

gtgccgattt cccggacctg cctgcatatg ttcatctggc aaaagaatat aacgccctga 5340

tctatatgga tgatgcacat ggctttggca ttctgggtga aaatccgagc agcgatatgc 5400

cgtatggtta taaaggtaat ggcatggtga actactttga tctgcgtttt gccgaagata 5460

acatcattta tgttgcaggt ctgagcaaag cctatagcag ctatgcagca tttctgacct 5520

gtggtgatcg tcgtattaaa accaattttc gtaatgcatg gaccgcgatt tttagcggtc 5580

cgagtccggt tgcaagcctg gccagcgcac tggcaggtct gcaggttaat cgtcaagaag 5640

gtgaacagct gcgcaaacaa atctatcatc tgacacataa actggttacc caggctcgtg 5700

ccattggttt tgaagttgat aattatggtt atgtgccgat tgtgggtgtt ctggtgggtg 5760

atgcacagca tatgattgat gtgtgccaac tgctgtggga atatggtatc ctgattaccc 5820

ctgcaatttt tccgattgtg ccgctgaata aatcagcact gcgttttagc attaccgcag 5880

caaataccga agaagaaatt gatcaggcca tcaaaagtct gaaagcagtt tgggacctgc 5940

tgcaaaaacg taaagccctg ccgtgtaaac aagaagaaaa tatcctgaaa cattgagaag 6000

gagatataca tatgacccat gttgccctgg aacaggcaat tgcaaaagtt ccgcgtagca 6060

ttcagagcga actgcgtacc attctggcac agcatgcagt tattgatagc agcgttgtgg 6120

caagctggat tgatcgtctg ggcaccaata ttagtaccct gatgatccag ctgctgccgg 6180

ttgcagcaac ctatgcacgt gttccgatta gccagtttta tgttggtgcc attgcactgg 6240

gcaaaccgca gagtaaaaat cagctgggta gcggcaccct gtattttggt gcagatatgg 6300

aatttgttgg tcaggcactg agctttagcg ttcatgcaga acagagcgcc accattaatg 6360

cctggctgca tggcgaaacc ggactgcagg cactggcaat ccatgaagca ccgtgtggtt 6420

attgtcgcca gtttctgtat gaaatggcaa ccgtgaatca gaattttgtg ctgctggtga 6480

aaagcaatga aagccagccg gaacagacct ataccagcaa caaactgccg cattttctgc 6540

ctgaaccgtt tggtccagcc gatctgggtc tgaccggtgg cctgatgcag accgtgtttc 6600

acgatctgga aacctatagc accgatgatg ttgttctggc agcactgagt gcagcaaatc 6660

agagttatgc accgtatacc aaaaactttg ccggtgttgc actgaaagat agtcatggta 6720

acatttttac aggtcgctat gccgaaaacg cagcatttaa tagcagcatg agcccgatgg 6780

aaagcgcact gacctttatg aatatgaatc gttattcaca gagcctgttc gatatttgtg 6840

atgcagttct ggtagaagtg gaaaccggta ttagtcagcg tccggttacc gaagcctttc 6900

tgagtagcat tgcaccgaaa gtgaaactgc gctatgcacc ggcaaccccg agcagtaaca 6960

aactgtgact cggtaccaaa ttccagaaaa gaggcctccc gaaagggggg ccttttttcg 7020

ttttggtccc gaagttccta ttctctagaa agtataggaa cttc 7064

<210> 96

<211> 4413

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>it is integrated into the sequence of the sxt4 segment in Escherichia coli Melibiose operon

<400> 96

aagcctgccg tcagggcaat atcgagaata cttttatcgg tatcgctcag ccagccttgc 60

aagaagcgga tacaggagtg caaaaaatgg ctatctctag aaaggcctac cccttaggct 120

ttatgcaaca gaaacaataa taatggagtc atgaacatat ggaaaccacg agcaaaaaat 180

tcaaaagcga tctgattctg gaagcacgtg caagcctgaa actgggtatt ccgctggtta 240

ttagccagat gtgtgaaacc ggtatttata ccgcaaatgc agttatgatg ggtctgctgg 300

gcacccaggt tctggcagcc ggtgctctgg gtgcactggc atttctgacc ctgctgtttg 360

catgtcatgg tattctgagc gttggtggta gcctggcagc ggaagcattt ggtgcaaaca 420

aaattgatga agttagccgt attgcaagcg gtcagatttg gctggcagtt accctgagcc 480

tgcctgcaat gctgctgctg tggcatggtg ataccattct gctgttattt ggtcaagaag 540

aaagcaacgt tctgctgacc aaaacctatc tgcatagcat tctgtggggt tttccggcag 600

cactgagtat tctgacactg cgtggtattg ccagcgcact gaatgttccg cgtctgatta 660

ccattaccat gctgacccag ctgattctga ataccgcagc agattatgtt ctgatctttg 720

gtaaatttgg tctgccgcag ctgggtctgg caggtattgg ttgggcaacc gcactgggtt 780

tttgggttag ctttaccctg ggtctgatcc tgctgatttt tagcctgaaa gtgcgtgatt 840

ataaactgtt tcgttatctg caccagttcg acaagcagat ctttgtgaaa atctttcaga 900

ccggttggcc gatgggtttt cagtggggtg cagaaacagc actgtttaat gttaccgcat 960

gggttgcagg ttatctgggc accgttaccc tggcagcaca tgatattggt tttcagacag 1020

cagaactggc aatggttatc ccgctgggtg ttggtaatgt tgcaatgacc cgtgttggtc 1080

agagcattgg tgaaaaaaat ccactgggtg cccgtcgtgt tgcaagcatt ggtattacca 1140

ttgttggtat ttatgccagc attgttgccc tggttttttg gctgtttccg tatcagattg 1200

caggcattta tctgaacatt aataacccgg aaaacattga agccatcaaa aaagccacca 1260

cctttattcc actggcaggt ctgtttcaga tgttttatag cattcagatc attatcgttg 1320

gtgcgctggt tggtctgcgt gatacctttg ttccggttag catgaatctg attgtttggg 1380

gtctgggttt agcaggtagc tattttatgg caattattct gggttggggt ggtattggta 1440

tctggctggc catggttctg agtccgctgc tgagcgcagt tattctgacc gttcgttttt 1500

atcgcgtgat tgataatctg ctggccaaca gtgatgatat gctgcagaat gcaagcgtta 1560

ccaccctggg atgagaagga gatatacata tgaaacgtct gacgctgctg atcattgcag 1620

gtattctgtc agttagcacc tttctgtgta ttacaccggt tgcactggcc aatattaccg 1680

attattatct gaaaaacgag aaactgagcg gtcagtttag cgttccggtg aatctgtctg 1740

ttggtgttcg ttttgcacat cgtagcagct atgcaaccgc aattaacttt ccgaccggtc 1800

tggatgcaga tagcgttgca gttggtgatt ttaacagcga tagcaaactg gatctggccg 1860

ttaccaattg gtttgataac aatgttagcg tgctgctggg taatggcaat ggcagctttg 1920

gtgcagcaac caattttccg gttggcacca atccggtttt tgttgttacc ggtgatgtta 1980

atggtgacag taaactggat ttagccgtgg caaattttag cagcaataat gtttcagttc 2040

tgctgggaaa cggtaatggt tcttttggcg cagccacaaa ctttagcgtt ggtacaaatc 2100

cgtatagcgt ggccattggt gatgtgaata atgatagtga actggacctg gcatttacga 2160

actggttcga taataaagtt ctggtgctgt taggcaatgg taatggctcg tttggtgccg 2220

caagctcatt tccggtggat acctatagca ttagcgttgc gattgcagat ttcaactcag 2280

attctaaatt agacctggcg atcaccaatt gggtgtcaaa taatgtgagt gtgttactgg 2340

ggaatggtaa cggtagtttt ggagctgcga caaattttcc tgtgggtaca aacccgattt 2400

ttgtggcaac cggtgacgtg aatggcgatt ctaagctgga cttagcagtt gcaaatacca 2460

gctctaataa cgttagcgtt ctgttaggta acgggaacgg ctcattcggt gctgccacga 2520

attttccagc aggcaccaac ccgtatagtg ttgcaattcg cgacgttaac ggtgatagca 2580

aattagattt agcggtgacc aactatagca gcaacaacgt gagtgttctg ccaggcaacg 2640

gtaacggatc atttggtatt gcgaccaact ttccagtagg tacgaatccg gaaagcattg 2700

caattgccga ttttaatggg gattccaagt tagatctggc agtgacaaat agcggtaaca 2760

ataatgtaag catactgctg aataactttc agggtctgcc gaaaaacaag atttgagaag 2820

gagatataca tatgaccaat accgaacgtg gtctggccga aattaccagc accggttata 2880

aaagcgaact gcgtagcgaa gcccgtgtta gcctgcagct ggcaattcct ctggttctgg 2940

ttgaaatttg tggcaccagc attaatgttg ttgatgttgt gatgatgggt ttactgggta 3000

cacaagtgtt agcagcgggt gccctgggag caattgcctt cctgagcgtt agcaatacct 3060

gctataatat gctgctgagt ggtgttgcaa aagcaagcga agcctttgga gccaataaaa 3120

tcgatcaggt ttcacgtatt gcctcaggcc agatttggtt agccctgacc ctgtcattac 3180

cagccatgct gttactgtgg tatatggata ccatcctggt tctgtttggt caggttgaaa 3240

gcaataccct gattgcgaaa acatacctgc attcaattgt gtggggcttt cctgccgcag 3300

ttggtatcct gattctgcgt ggcatagcaa gtgcagttaa cgttcctcag ctggttaccg 3360

tgaccatgct ggttggcctg gtgctgaatg caccggctaa ttatgtgctg atgttcggca 3420

aattcggttt accggaatta ggcctggctg gcattggctg ggccagcaca ctggtgtttt 3480

ggattagttt tctggttggt gttgtgctgc tgatattttc accgaaagtt cgcgactaca 3540

aactgttccg ctatttacat cagtttgatc gtcagaccgt ggttgagatt tttcagacgg 3600

gctggcctat gggcttcctg ctgggtgtgg aaagcgttgt tctgagcctg accgcatggc 3660

tgaccggcta tctgggtaca gtgaccttag cagcccatga aattgcaatc cagactgccg 3720

aactggcgat tgtgattccg ttaggtattg gcaatgttgc cgttacccgt gtgggccaga 3780

caatcggcga aaaaaacccg ctgggagcac gccgtgcagc cctgattggc attatgattg 3840

gtggcattta tgcgagcctg gttgcagtga ttttttggtt attcccttat caaatcgcag 3900

gcctgtacct gaaaattaac gatccggaat caatggaagc agttaaaacc gcaacaaact 3960

ttctgttttt agctggcctg ttccagtttt ttcatagcgt gcagattatt gttgtgggtg 4020

ttctgattgg cctgcaggat acctttatcc ctctgctgat gaatctggtg ggctggggac 4080

tgggcctggc ggtttcctat tatatgggta ttatcctgtg ctggggtggc atgggcatct 4140

ggttaggtct ggtactgtca ccgctgctgt caggcctgat cctgatggtg cgcttttatc 4200

aagaaattgc caatcgcatt gcgaatagcg acgatggcca agaaagcatt agcattgata 4260

atgttgaaga actgagctaa tagaccaacc ccttgcggcc tcaatcgggg gggatggggt 4320

tttttgtcga agttcctatt ctctagaaag tataggaact tcgcaaccgt ctgctgaagg 4380

aagccatctg acacttaaag ccatcgttgc gct 4413

<210> 97

<211> 7377

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>it is integrated into the sequence of the sxt2 segment in E. coli. maltose operon

<400> 97

ctgtgaacta aaccgaggtc atgtaaggaa tttcgtgatg ttgcttgcaa ccagccttgc 60

aagaagcgga tacaggagtg caaaaaatgg ctatctctag aaaggcctac cccttaggct 120

ttatgcaaca gaaacaataa taatggagtc atgaacatga ttgataccat tagcgttctg 180

ctgcgtgaat ggaccgttat ttttctgacc ggtctggcat tttggctgtg ggaaattcgt 240

agtccgctgc atcagattga atacaaagcc aaatttttca aagaactggg ttgggcaggt 300

atcagctttg tttttcgtat tgtttatgcc tatgttagcg tggccattat caaactgctg 360

agcagcctgt ttatgggtga aagcgcaaat tttgccggtg ttatgtatgt tccgctgtgg 420

ctgcgtatta ttaccgcata tattctgcag gatctgaccg attatctgct gcatcgtacc 480

atgcatagca atcagtttct gtggctgacc cataaatggc atcatagcac caaacagagt 540

tggtggctga gcggtaataa agatagcttt accggtggtc tgctgtatac cgttaccgca 600

ctgtggtttc cgctgctgga tattccgagc gaagttatga gcgttgttgc agttcatcag 660

gtgattcata acaactggat tcacctgaat gtgaaatgga atagctggct gggtattatc 720

gaatggattt atgttacacc gcgtatccat accctgcatc atctggatac cggtggtcgt 780

aatctgagca gtatgtttac ctttattgat cgtctgtttg gcacctatgt gtttccggaa 840

aactttgata tcgaaaaaag caaaaaccgc ctggatgatc agagcgttac cgttaaaacc 900

attctgggtt tctgagaagg agatatacat atgctgaaag attttaacca gttcctgatt 960

cgtaccctgg catttgtttt tgcctttggc atttttctga caaccggtgt tggtattgca 1020

aaagcagatt atctggtgaa aggtggcaaa attaccaatg ttcagaatac cagcagcaac 1080

ggtgataatt atgcagttag cattagcggt ggttttggtc cgtgtgcaga tcgtgttatt 1140

attctgccga ccagcggtgt tattaatcgt gatattcaca tgcgtggtta tgaagcagca 1200

ctgaccgcac tgagcaatgg ttttctggtt gatatctatg attataccgg tagcagctgt 1260

agcaatggtg gccagctgac cattaccaat cagctgggta aactgattag caattgagaa 1320

ggagatatac atatgaccaa tcagaacaac caagagctgg aaaatgatct gccgattgca 1380

aaacagccgt gtccggttaa tagctataat gaatgggata ccctggaaga agttattgtt 1440

ggtagcgttg aaggtgcaat gctgcctgca ctggaaccga ttaacaaatg gacctttccg 1500

tttgaagaac tggaaagcgc acagaaaatt ctgagcgaac gtggtggtgt tccgtatccg 1560

cctgaaatga ttaccctggc acataaagaa ctgaacgagt ttattcatat cctggaagcc 1620

gaaggtgtta aagttcgtcg tgttaaaccg gttgatttta gcgttccgtt tagcacaccg 1680

gcatggcagg ttggtagcgg tttttgtgca gcaaatccgc gtgatgtttt tctggttatt 1740

ggcaacgaaa ttatcgaagc accgatggca gatcgtaatc gttattttga aacctgggca 1800

tatcgcgaaa tgctgaaaga atattttcag gcaggcgcaa aatggaccgc agcaccgaaa 1860

ccgcagctgt ttgatgcaca gtatgatttc aattttcagt ttccgcagct gggtgaaccg 1920

cctcgttttg ttgttaccga atttgaaccg acctttgatg cagccgattt tgttcgttgt 1980

ggtcgtgata tttttggcca gaaaagccat gttaccaatg gtctgggtat tgaatggctg 2040

cagcgtcatc tggaagatga atatcgcatt catatcatcg aaagccattg tccggaagca 2100

ctgcatattg ataccaccct gatgccgctg gcaccgggta aaattctggt taatccggaa 2160

tttgtggacg tgaataaact gccgaaaatt ctgaaaagct gggatattct ggttgcaccg 2220

tatccgaatc atattccgca gaatcagctg cgtctggtta gcgaatgggc aggtctgaat 2280

gttctgatgc tggatgaaga acgtgtgatc gtggaaaaaa atcaagagca gatgatcaaa 2340

gccctgaaag attggggttt taaaccgatt gtttgccact tcgaaagcta ttatccgttt 2400

ctgggtagct ttcattgtgc aaccctggat gttcgtcgtc gtggcaccct gcagagctat 2460

ttttgagaag gagatataca tatgacgacc gcagatctga ttctgatcaa taattggtat 2520

gttgtggcca aggtggaaga ttgtaaaccg ggtagcatta ccaccgcact gctgctgggt 2580

gttaaactgg ttctgtggcg tagccgtgaa cagaatagcc cgattcagat ttggcaggat 2640

tattgtccgc atcgtggtgt tgcactgagc atgggtgaaa ttgtgaataa taccctggtt 2700

tgtccgtatc atggttggcg ttataatcag gcaggtaaat gtgttcatat tccggcacat 2760

ccggatatga cccctccggc aagcgcacag gcaaaaatct atcattgtca agaacgttat 2820

ggtctggttt gggtttgtct gggtgatccg gttaatgata ttccgagtct gccggaatgg 2880

gatgatccga attatcataa tacctgcacc aagagctact ttatccaggc aagcgcattt 2940

cgtgtgatgg ataactttat tgatgtgagc cattttccgt ttgtgcatga tggtggtctg 3000

ggcgatcgta atcatgcaca gattgaagaa tttgaggtga aagtggataa agacggtatt 3060

agcattggca atctgaaact gcagatgcct cgttttaata gcagcaatga agatgatagc 3120

tggaccctgt atcagcgtat tagccatccg ctgtgtcagt attatatcac cgaaagcagc 3180

gaaattcgta cagcagatct gatgctggtt accccgattg atgaagataa ttcactggtt 3240

cgtatgctgg tgacctggaa tcgtagcgaa attctggaaa gcaccgttct ggaagaattt 3300

gatgaaacca ttgaacagga tatcccgatt attcatagcc agcagcctgc acgtctgccg 3360

ctgctgccga gcaagcagat taatatgcag tggctgagcc aagaaattca tgttccgagc 3420

gatcgttgta ccgttgcata tcgtcgttgg ctgaaagaac tgggcgttac ctatggtgtt 3480

tgttgagaag gagatataca tatgcagatt ctgggtatca gcgcctatta tcatgatagc 3540

gcagcagcaa tggttattga tggtgaaatt gttgcagcag cacaagaaga acgttttagc 3600

cgtcgtaaac atgatgcagg ttttccgacc ggtgcaatta cctattgtct gaaacaggtt 3660

ggcaccaaac tgcagtatat tgatcagatc gtgttctatg ataaaccgct ggtgaaattt 3720

gaacgtctgc tggaaaccta tctggcctat gcaccgaaag gttttggtag ttttattacc 3780

gcaatgccgg tgtggctgaa agagaaactg tatctgaaaa ccctgctgaa aaaagaactg 3840

gcactgctgg gtgaatgtaa agcaagccag ctgcctccgc tgctgtttac cagccatcat 3900

caggcacatg cagcagcagc attttttccg agcccgtttc agcgtgcagc agttctgtgt 3960

ctggatggtg ttggtgaatg ggcaaccacc agtgtttggc tgggtgaagg taataaactg 4020

acaccgcagt gggaaattga ttttccgcat agcctgggcc tgctgtatag cgcatttacc 4080

tattataccg gctttaaagt gaacagcggt gagtataaac tgatgggtct ggcaccgtat 4140

ggtgaaccga aatatgttga tcagattctg aaacatctgc tggatctgaa agaagatggc 4200

acctttcgtc tgaacatgga ttatttcaat tataccgttg gtctgaccat gaccaaccat 4260

aaatttcata gcatgtttgg tggtccgcct cgtcaggcag aaggtaaaat tagccagcgt 4320

gatatggatc tggcaagcag cattcagaaa gttaccgaag aagtgattct gcgtctggca 4380

cgtaccatta agaaagaatt aggtgttgaa tacctgtgtc tggcaggcgg tgttggtctg 4440

aattgtgttg caaatggtcg tattctgcgt gagagcgatt ttaaagatat ttggattcag 4500

cctgcagccg gtgatgcagg tagcgcagtt ggtgcagcac tggcaatttg gcatgaatat 4560

cataaaaaac cgcgtaccag caccgcaggc gatcgtatga aaggtagcta tctgggtccg 4620

agctttagcg aagcagaaat tctgcagttt ctgaacagcg tgaatattcc gtatcatcgt 4680

tgtgtggata atgaactgat ggcacgtctg gcggaaattc tggatcaggg taatgttgtt 4740

ggttggttta gcggtcgtat ggaatttggt ccgcgtgcac tgggtggtcg tagcattatt 4800

ggtgatagcc gtagcccgaa aatgcagagc gttatgaatc tgaaaatcaa atatcgcgaa 4860

agcttccgtc cgtttgcacc gagcgttctg gcagaacgtg ttagcgatta ttttgatctg 4920

gatcgtccga gcccgtatat gctgctggtt gcacaggtta aagaaaatct gcatattccg 4980

atgacccaag aacagcatga actgtttggt atcgaaaaac tgaatgttcc gcgtagccag 5040

attccggcag ttacccatgt tgattatagc gcacgtattc agaccgttca taaagaaacc 5100

aatccgcgtt attatgaact gatccgtcat tttgaagcac gtaccggttg tgcagttctg 5160

gttaatacca gctttaatgt tcgtggtgaa ccgattgtgt gtacaccgga agatgcatat 5220

cgttgtttta tgcgtaccga gatggattac ctggtgatgg aaaattttct gctggtgaaa 5280

agcgaacagc ctcgtggtaa tagtgatgaa agctggcaga aagaatttga gctggattga 5340

gaaggagata tacatatgga acaaattaaa gaactggata agaaaggcct gcgtgaattt 5400

ggtctgattg gtggtagcat tgttgccgtt ctgtttggtt ttctgctgcc ggttattcgt 5460

catcatagcc tgagcgttat tccgtgggtt gttgcaggtt ttctgtggat ttgggcaatt 5520

attgcaccga ccaccctgag ctttatctat cagatttgga tgcgtattgg tctggtgctg 5580

ggttggattc agacccgtat tattctgggt gttctgttct atattatgat taccccgatc 5640

ggttttattc gtcgtctgct gaatcaggat ccgatgaccc gtatttttga accggaactg 5700

ccgacctatc gtcagctgag caaaagccgt accacccaga gcatggaaaa accgttctga 5760

gaaggagata tacatatgtt aaaagacacc tgggatttta tcaaggatat cgcaggcttt 5820

atcaaagaac agaaaaacta tctgctgatt ccgctgatta ttaccctggt tagcctgggt 5880

gcactgattg tttttgcaca gagcagcgca attgcaccgt ttatctatac cctgttttga 5940

gaaggagata tacatatgag caacttcaaa ggcagcgtta aaattgcact gatgggcatt 6000

ctgatttttt gcggtctgat ttttggtgtg gcctttgttg aaattggtct gcgtattgca 6060

ggcattgaac atattgcctt tcatagcatt gatgaacatc gtggttgggt tggtcgtccg 6120

catgttagcg gttggtatcg taccgaaggt gaagcacata ttcagatgaa tagtgatggt 6180

tttcgtgatc gcgaacacat taaagtgaaa ccggaaaata cctttcgtat tgccctgctg 6240

ggtgatagct ttgttgaaag catgcaggtt ccgctggaac agaatctggc agcagttatt 6300

gaaggcgaaa ttagcagctg tattgcactg gcaggtcgta aagccgaagt tattaacttt 6360

ggtgttaccg gttatggcac cgatcaagaa ctgattaccc tgcgtgaaaa agtgtgggat 6420

tatagtccgg atattgttgt gctggatttc tataccggta acgatattgt tgataatagc 6480

cgtgcactgt cccagaaatt ctatccgaat gaactgggta gcctgaaacc gttttttatc 6540

ctgcgtgatg gtaatctggt tgttgatgca agctttatca acaccgataa ctatcgtagc 6600

aaactgacct ggtggggtaa aacctatatg aaaatcaaag atcatagccg cattctgcag 6660

gtcctgaata tggttcgtga tgcactgaat aatagcagcc gtggttttag cagccaggca 6720

attgaagaac cgctgtttag tgatggtaaa caggatacca aactgagcgg cttcttcgat 6780

atctataaac cgcctaccga tccggaatgg cagcaggcct ggcaggttac cgaaaaactg 6840

attagtagca tgcagcatga agtgaccgcc aaaaaagccg attttctggt tgttaccttt 6900

ggcggtccgt ttcagcgcga accgctggtt cgtcagaaag aaatgcaaga actgggtctg 6960

accgattggt tttatccgga aaaacgtatt acccgtctgg gtgaagatga aggttttagc 7020

gtgctgaatc tgagcccgaa tctgcaggtt tatagcgaac agaataatgc ctgtctgtat 7080

ggttttgatg atacccaggg ttgtgttggt cattggaatg cactgggtca tcaggttgca 7140

ggtaaaatga ttgcaagcaa aatttgtcag cagcagatgc gtgaaagcat tctgccgcat 7200

aaacatgatc cgagcagcca gagcagcccg attacccaga gcgttattca gtaatactct 7260

aaccccatcg gccgtcttag gggttttttg tcgaagttcc tattctctag aaagtatagg 7320

aacttcgacc tgtggggtga ctttgccgcc gctgccgtga tgtctgcatt accgatc 7377

<210> 98

<211> 6062

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>sequence of the sxt2 segment in maltose operon is integrated into after missing sxtL

<400> 98

ctgtgaacta aaccgaggtc atgtaaggaa tttcgtgatg ttgcttgcaa ccagccttgc 60

aagaagcgga tacaggagtg caaaaaatgg ctatctctag aaaggcctac cccttaggct 120

ttatgcaaca gaaacaataa taatggagtc atgaacatga ttgataccat tagcgttctg 180

ctgcgtgaat ggaccgttat ttttctgacc ggtctggcat tttggctgtg ggaaattcgt 240

agtccgctgc atcagattga atacaaagcc aaatttttca aagaactggg ttgggcaggt 300

atcagctttg tttttcgtat tgtttatgcc tatgttagcg tggccattat caaactgctg 360

agcagcctgt ttatgggtga aagcgcaaat tttgccggtg ttatgtatgt tccgctgtgg 420

ctgcgtatta ttaccgcata tattctgcag gatctgaccg attatctgct gcatcgtacc 480

atgcatagca atcagtttct gtggctgacc cataaatggc atcatagcac caaacagagt 540

tggtggctga gcggtaataa agatagcttt accggtggtc tgctgtatac cgttaccgca 600

ctgtggtttc cgctgctgga tattccgagc gaagttatga gcgttgttgc agttcatcag 660

gtgattcata acaactggat tcacctgaat gtgaaatgga atagctggct gggtattatc 720

gaatggattt atgttacacc gcgtatccat accctgcatc atctggatac cggtggtcgt 780

aatctgagca gtatgtttac ctttattgat cgtctgtttg gcacctatgt gtttccggaa 840

aactttgata tcgaaaaaag caaaaaccgc ctggatgatc agagcgttac cgttaaaacc 900

attctgggtt tctgagaagg agatatacat atgctgaaag attttaacca gttcctgatt 960

cgtaccctgg catttgtttt tgcctttggc atttttctga caaccggtgt tggtattgca 1020

aaagcagatt atctggtgaa aggtggcaaa attaccaatg ttcagaatac cagcagcaac 1080

ggtgataatt atgcagttag cattagcggt ggttttggtc cgtgtgcaga tcgtgttatt 1140

attctgccga ccagcggtgt tattaatcgt gatattcaca tgcgtggtta tgaagcagca 1200

ctgaccgcac tgagcaatgg ttttctggtt gatatctatg attataccgg tagcagctgt 1260

agcaatggtg gccagctgac cattaccaat cagctgggta aactgattag caattgagaa 1320

ggagatatac atatgaccaa tcagaacaac caagagctgg aaaatgatct gccgattgca 1380

aaacagccgt gtccggttaa tagctataat gaatgggata ccctggaaga agttattgtt 1440

ggtagcgttg aaggtgcaat gctgcctgca ctggaaccga ttaacaaatg gacctttccg 1500

tttgaagaac tggaaagcgc acagaaaatt ctgagcgaac gtggtggtgt tccgtatccg 1560

cctgaaatga ttaccctggc acataaagaa ctgaacgagt ttattcatat cctggaagcc 1620

gaaggtgtta aagttcgtcg tgttaaaccg gttgatttta gcgttccgtt tagcacaccg 1680

gcatggcagg ttggtagcgg tttttgtgca gcaaatccgc gtgatgtttt tctggttatt 1740

ggcaacgaaa ttatcgaagc accgatggca gatcgtaatc gttattttga aacctgggca 1800

tatcgcgaaa tgctgaaaga atattttcag gcaggcgcaa aatggaccgc agcaccgaaa 1860

ccgcagctgt ttgatgcaca gtatgatttc aattttcagt ttccgcagct gggtgaaccg 1920

cctcgttttg ttgttaccga atttgaaccg acctttgatg cagccgattt tgttcgttgt 1980

ggtcgtgata tttttggcca gaaaagccat gttaccaatg gtctgggtat tgaatggctg 2040

cagcgtcatc tggaagatga atatcgcatt catatcatcg aaagccattg tccggaagca 2100

ctgcatattg ataccaccct gatgccgctg gcaccgggta aaattctggt taatccggaa 2160

tttgtggacg tgaataaact gccgaaaatt ctgaaaagct gggatattct ggttgcaccg 2220

tatccgaatc atattccgca gaatcagctg cgtctggtta gcgaatgggc aggtctgaat 2280

gttctgatgc tggatgaaga acgtgtgatc gtggaaaaaa atcaagagca gatgatcaaa 2340

gccctgaaag attggggttt taaaccgatt gtttgccact tcgaaagcta ttatccgttt 2400

ctgggtagct ttcattgtgc aaccctggat gttcgtcgtc gtggcaccct gcagagctat 2460

ttttgagaag gagatataca tatgacgacc gcagatctga ttctgatcaa taattggtat 2520

gttgtggcca aggtggaaga ttgtaaaccg ggtagcatta ccaccgcact gctgctgggt 2580

gttaaactgg ttctgtggcg tagccgtgaa cagaatagcc cgattcagat ttggcaggat 2640

tattgtccgc atcgtggtgt tgcactgagc atgggtgaaa ttgtgaataa taccctggtt 2700

tgtccgtatc atggttggcg ttataatcag gcaggtaaat gtgttcatat tccggcacat 2760

ccggatatga cccctccggc aagcgcacag gcaaaaatct atcattgtca agaacgttat 2820

ggtctggttt gggtttgtct gggtgatccg gttaatgata ttccgagtct gccggaatgg 2880

gatgatccga attatcataa tacctgcacc aagagctact ttatccaggc aagcgcattt 2940

cgtgtgatgg ataactttat tgatgtgagc cattttccgt ttgtgcatga tggtggtctg 3000

ggcgatcgta atcatgcaca gattgaagaa tttgaggtga aagtggataa agacggtatt 3060

agcattggca atctgaaact gcagatgcct cgttttaata gcagcaatga agatgatagc 3120

tggaccctgt atcagcgtat tagccatccg ctgtgtcagt attatatcac cgaaagcagc 3180

gaaattcgta cagcagatct gatgctggtt accccgattg atgaagataa ttcactggtt 3240

cgtatgctgg tgacctggaa tcgtagcgaa attctggaaa gcaccgttct ggaagaattt 3300

gatgaaacca ttgaacagga tatcccgatt attcatagcc agcagcctgc acgtctgccg 3360

ctgctgccga gcaagcagat taatatgcag tggctgagcc aagaaattca tgttccgagc 3420

gatcgttgta ccgttgcata tcgtcgttgg ctgaaagaac tgggcgttac ctatggtgtt 3480

tgttgagaag gagatataca tatgcagatt ctgggtatca gcgcctatta tcatgatagc 3540

gcagcagcaa tggttattga tggtgaaatt gttgcagcag cacaagaaga acgttttagc 3600

cgtcgtaaac atgatgcagg ttttccgacc ggtgcaatta cctattgtct gaaacaggtt 3660

ggcaccaaac tgcagtatat tgatcagatc gtgttctatg ataaaccgct ggtgaaattt 3720

gaacgtctgc tggaaaccta tctggcctat gcaccgaaag gttttggtag ttttattacc 3780

gcaatgccgg tgtggctgaa agagaaactg tatctgaaaa ccctgctgaa aaaagaactg 3840

gcactgctgg gtgaatgtaa agcaagccag ctgcctccgc tgctgtttac cagccatcat 3900

caggcacatg cagcagcagc attttttccg agcccgtttc agcgtgcagc agttctgtgt 3960

ctggatggtg ttggtgaatg ggcaaccacc agtgtttggc tgggtgaagg taataaactg 4020

acaccgcagt gggaaattga ttttccgcat agcctgggcc tgctgtatag cgcatttacc 4080

tattataccg gctttaaagt gaacagcggt gagtataaac tgatgggtct ggcaccgtat 4140

ggtgaaccga aatatgttga tcagattctg aaacatctgc tggatctgaa agaagatggc 4200

acctttcgtc tgaacatgga ttatttcaat tataccgttg gtctgaccat gaccaaccat 4260

aaatttcata gcatgtttgg tggtccgcct cgtcaggcag aaggtaaaat tagccagcgt 4320

gatatggatc tggcaagcag cattcagaaa gttaccgaag aagtgattct gcgtctggca 4380

cgtaccatta agaaagaatt aggtgttgaa tacctgtgtc tggcaggcgg tgttggtctg 4440

aattgtgttg caaatggtcg tattctgcgt gagagcgatt ttaaagatat ttggattcag 4500

cctgcagccg gtgatgcagg tagcgcagtt ggtgcagcac tggcaatttg gcatgaatat 4560

cataaaaaac cgcgtaccag caccgcaggc gatcgtatga aaggtagcta tctgggtccg 4620

agctttagcg aagcagaaat tctgcagttt ctgaacagcg tgaatattcc gtatcatcgt 4680

tgtgtggata atgaactgat ggcacgtctg gcggaaattc tggatcaggg taatgttgtt 4740

ggttggttta gcggtcgtat ggaatttggt ccgcgtgcac tgggtggtcg tagcattatt 4800

ggtgatagcc gtagcccgaa aatgcagagc gttatgaatc tgaaaatcaa atatcgcgaa 4860

agcttccgtc cgtttgcacc gagcgttctg gcagaacgtg ttagcgatta ttttgatctg 4920

gatcgtccga gcccgtatat gctgctggtt gcacaggtta aagaaaatct gcatattccg 4980

atgacccaag aacagcatga actgtttggt atcgaaaaac tgaatgttcc gcgtagccag 5040

attccggcag ttacccatgt tgattatagc gcacgtattc agaccgttca taaagaaacc 5100

aatccgcgtt attatgaact gatccgtcat tttgaagcac gtaccggttg tgcagttctg 5160

gttaatacca gctttaatgt tcgtggtgaa ccgattgtgt gtacaccgga agatgcatat 5220

cgttgtttta tgcgtaccga gatggattac ctggtgatgg aaaattttct gctggtgaaa 5280

agcgaacagc ctcgtggtaa tagtgatgaa agctggcaga aagaatttga gctggattga 5340

gaaggagata tacatatgga acaaattaaa gaactggata agaaaggcct gcgtgaattt 5400

ggtctgattg gtggtagcat tgttgccgtt ctgtttggtt ttctgctgcc ggttattcgt 5460

catcatagcc tgagcgttat tccgtgggtt gttgcaggtt ttctgtggat ttgggcaatt 5520

attgcaccga ccaccctgag ctttatctat cagatttgga tgcgtattgg tctggtgctg 5580

ggttggattc agacccgtat tattctgggt gttctgttct atattatgat taccccgatc 5640

ggttttattc gtcgtctgct gaatcaggat ccgatgaccc gtatttttga accggaactg 5700

ccgacctatc gtcagctgag caaaagccgt accacccaga gcatggaaaa accgttctga 5760

gaaggagata tacatatgtt aaaagacacc tgggatttta tcaaggatat cgcaggcttt 5820

atcaaagaac agaaaaacta tctgctgatt ccgctgatta ttaccctggt tagcctgggt 5880

gcactgattg tttttgcaca gagcagcgca attgcaccgt ttatctatac cctgttttga 5940

tactctaacc ccatcggccg tcttaggggt tttttgtcga agttcctatt ctctagaaag 6000

tataggaact tcacctgtgg ggtgactttg ccgccgctgc cgtgatgtct gcattaccga 6060

tc 6062

<210> 99

<211> 5462

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>it is integrated into the sequence of the sxt2 segment in maltose operon

<400> 99

ctgtgaacta aaccgaggtc atgtaaggaa tttcgtgatg ttgcttgcaa ccagccttgc 60

aagaagcgga tacaggagtg caaaaaatgg ctatctctag aaaggcctac cccttaggct 120

ttatgcaaca gaaacaataa taatggagtc atgaacatga ttgataccat tagcgttctg 180

ctgcgtgaat ggaccgttat ttttctgacc ggtctggcat tttggctgtg ggaaattcgt 240

agtccgctgc atcagattga atacaaagcc aaatttttca aagaactggg ttgggcaggt 300

atcagctttg tttttcgtat tgtttatgcc tatgttagcg tggccattat caaactgctg 360

agcagcctgt ttatgggtga aagcgcaaat tttgccggtg ttatgtatgt tccgctgtgg 420

ctgcgtatta ttaccgcata tattctgcag gatctgaccg attatctgct gcatcgtacc 480

atgcatagca atcagtttct gtggctgacc cataaatggc atcatagcac caaacagagt 540

tggtggctga gcggtaataa agatagcttt accggtggtc tgctgtatac cgttaccgca 600

ctgtggtttc cgctgctgga tattccgagc gaagttatga gcgttgttgc agttcatcag 660

gtgattcata acaactggat tcacctgaat gtgaaatgga atagctggct gggtattatc 720

gaatggattt atgttacacc gcgtatccat accctgcatc atctggatac cggtggtcgt 780

aatctgagca gtatgtttac ctttattgat cgtctgtttg gcacctatgt gtttccggaa 840

aactttgata tcgaaaaaag caaaaaccgc ctggatgatc agagcgttac cgttaaaacc 900

attctgggtt tctgagaagg agatatacat atgctgaaag attttaacca gttcctgatt 960

cgtaccctgg catttgtttt tgcctttggc atttttctga caaccggtgt tggtattgca 1020

aaagcagatt atctggtgaa aggtggcaaa attaccaatg ttcagaatac cagcagcaac 1080

ggtgataatt atgcagttag cattagcggt ggttttggtc cgtgtgcaga tcgtgttatt 1140

attctgccga ccagcggtgt tattaatcgt gatattcaca tgcgtggtta tgaagcagca 1200

ctgaccgcac tgagcaatgg ttttctggtt gatatctatg attataccgg tagcagctgt 1260

agcaatggtg gccagctgac cattaccaat cagctgggta aactgattag caattgagaa 1320

ggagatatac atatgaccaa tcagaacaac caagagctgg aaaatgatct gccgattgca 1380

aaacagccgt gtccggttaa tagctataat gaatgggata ccctggaaga agttattgtt 1440

ggtagcgttg aaggtgcaat gctgcctgca ctggaaccga ttaacaaatg gacctttccg 1500

tttgaagaac tggaaagcgc acagaaaatt ctgagcgaac gtggtggtgt tccgtatccg 1560

cctgaaatga ttaccctggc acataaagaa ctgaacgagt ttattcatat cctggaagcc 1620

gaaggtgtta aagttcgtcg tgttaaaccg gttgatttta gcgttccgtt tagcacaccg 1680

gcatggcagg ttggtagcgg tttttgtgca gcaaatccgc gtgatgtttt tctggttatt 1740

ggcaacgaaa ttatcgaagc accgatggca gatcgtaatc gttattttga aacctgggca 1800

tatcgcgaaa tgctgaaaga atattttcag gcaggcgcaa aatggaccgc agcaccgaaa 1860

ccgcagctgt ttgatgcaca gtatgatttc aattttcagt ttccgcagct gggtgaaccg 1920

cctcgttttg ttgttaccga atttgaaccg acctttgatg cagccgattt tgttcgttgt 1980

ggtcgtgata tttttggcca gaaaagccat gttaccaatg gtctgggtat tgaatggctg 2040

cagcgtcatc tggaagatga atatcgcatt catatcatcg aaagccattg tccggaagca 2100

ctgcatattg ataccaccct gatgccgctg gcaccgggta aaattctggt taatccggaa 2160

tttgtggacg tgaataaact gccgaaaatt ctgaaaagct gggatattct ggttgcaccg 2220

tatccgaatc atattccgca gaatcagctg cgtctggtta gcgaatgggc aggtctgaat 2280

gttctgatgc tggatgaaga acgtgtgatc gtggaaaaaa atcaagagca gatgatcaaa 2340

gccctgaaag attggggttt taaaccgatt gtttgccact tcgaaagcta ttatccgttt 2400

ctgggtagct ttcattgtgc aaccctggat gttcgtcgtc gtggcaccct gcagagctat 2460

ttttgagaag gagatataca tatgacgacc gcagatctga ttctgatcaa taattggtat 2520

gttgtggcca aggtggaaga ttgtaaaccg ggtagcatta ccaccgcact gctgctgggt 2580

gttaaactgg ttctgtggcg tagccgtgaa cagaatagcc cgattcagat ttggcaggat 2640

tattgtccgc atcgtggtgt tgcactgagc atgggtgaaa ttgtgaataa taccctggtt 2700

tgtccgtatc atggttggcg ttataatcag gcaggtaaat gtgttcatat tccggcacat 2760

ccggatatga cccctccggc aagcgcacag gcaaaaatct atcattgtca agaacgttat 2820

ggtctggttt gggtttgtct gggtgatccg gttaatgata ttccgagtct gccggaatgg 2880

gatgatccga attatcataa tacctgcacc aagagctact ttatccaggc aagcgcattt 2940

cgtgtgatgg ataactttat tgatgtgagc cattttccgt ttgtgcatga tggtggtctg 3000

ggcgatcgta atcatgcaca gattgaagaa tttgaggtga aagtggataa agacggtatt 3060

agcattggca atctgaaact gcagatgcct cgttttaata gcagcaatga agatgatagc 3120

tggaccctgt atcagcgtat tagccatccg ctgtgtcagt attatatcac cgaaagcagc 3180

gaaattcgta cagcagatct gatgctggtt accccgattg atgaagataa ttcactggtt 3240

cgtatgctgg tgacctggaa tcgtagcgaa attctggaaa gcaccgttct ggaagaattt 3300

gatgaaacca ttgaacagga tatcccgatt attcatagcc agcagcctgc acgtctgccg 3360

ctgctgccga gcaagcagat taatatgcag tggctgagcc aagaaattca tgttccgagc 3420

gatcgttgta ccgttgcata tcgtcgttgg ctgaaagaac tgggcgttac ctatggtgtt 3480

tgttgagaag gagatataca tatgcagatt ctgggtatca gcgcctatta tcatgatagc 3540

gcagcagcaa tggttattga tggtgaaatt gttgcagcag cacaagaaga acgttttagc 3600

cgtcgtaaac atgatgcagg ttttccgacc ggtgcaatta cctattgtct gaaacaggtt 3660

ggcaccaaac tgcagtatat tgatcagatc gtgttctatg ataaaccgct ggtgaaattt 3720

gaacgtctgc tggaaaccta tctggcctat gcaccgaaag gttttggtag ttttattacc 3780

gcaatgccgg tgtggctgaa agagaaactg tatctgaaaa ccctgctgaa aaaagaactg 3840

gcactgctgg gtgaatgtaa agcaagccag ctgcctccgc tgctgtttac cagccatcat 3900

caggcacatg cagcagcagc attttttccg agcccgtttc agcgtgcagc agttctgtgt 3960

ctggatggtg ttggtgaatg ggcaaccacc agtgtttggc tgggtgaagg taataaactg 4020

acaccgcagt gggaaattga ttttccgcat agcctgggcc tgctgtatag cgcatttacc 4080

tattataccg gctttaaagt gaacagcggt gagtataaac tgatgggtct ggcaccgtat 4140

ggtgaaccga aatatgttga tcagattctg aaacatctgc tggatctgaa agaagatggc 4200

acctttcgtc tgaacatgga ttatttcaat tataccgttg gtctgaccat gaccaaccat 4260

aaatttcata gcatgtttgg tggtccgcct cgtcaggcag aaggtaaaat tagccagcgt 4320

gatatggatc tggcaagcag cattcagaaa gttaccgaag aagtgattct gcgtctggca 4380

cgtaccatta agaaagaatt aggtgttgaa tacctgtgtc tggcaggcgg tgttggtctg 4440

aattgtgttg caaatggtcg tattctgcgt gagagcgatt ttaaagatat ttggattcag 4500

cctgcagccg gtgatgcagg tagcgcagtt ggtgcagcac tggcaatttg gcatgaatat 4560

cataaaaaac cgcgtaccag caccgcaggc gatcgtatga aaggtagcta tctgggtccg 4620

agctttagcg aagcagaaat tctgcagttt ctgaacagcg tgaatattcc gtatcatcgt 4680

tgtgtggata atgaactgat ggcacgtctg gcggaaattc tggatcaggg taatgttgtt 4740

ggttggttta gcggtcgtat ggaatttggt ccgcgtgcac tgggtggtcg tagcattatt 4800

ggtgatagcc gtagcccgaa aatgcagagc gttatgaatc tgaaaatcaa atatcgcgaa 4860

agcttccgtc cgtttgcacc gagcgttctg gcagaacgtg ttagcgatta ttttgatctg 4920

gatcgtccga gcccgtatat gctgctggtt gcacaggtta aagaaaatct gcatattccg 4980

atgacccaag aacagcatga actgtttggt atcgaaaaac tgaatgttcc gcgtagccag 5040

attccggcag ttacccatgt tgattatagc gcacgtattc agaccgttca taaagaaacc 5100

aatccgcgtt attatgaact gatccgtcat tttgaagcac gtaccggttg tgcagttctg 5160

gttaatacca gctttaatgt tcgtggtgaa ccgattgtgt gtacaccgga agatgcatat 5220

cgttgtttta tgcgtaccga gatggattac ctggtgatgg aaaattttct gctggtgaaa 5280

agcgaacagc ctcgtggtaa tagtgatgaa agctggcaga aagaatttga gctggattga 5340

tactctaacc ccatcggccg tcttaggggt tttttgtcga agttcctatt ctctagaaag 5400

tataggaact tcacctgtgg ggtgactttg ccgccgctgc cgtgatgtct gcattaccga 5460

tc 5462

<210> 100

<211> 112

<212> DNA

<400> 100

agtccagcct tgcaagaagc ggatacagga gtgcaaaaaa tggctatctc tagaaaggcc 60

taccccttag gctttatgca acagaaacaa taataatgga gtcatgaaca tg 112

<210> 101

<211> 114

<212> DNA

<400> 101

agtccagcct tgcaagaagc ggatacagga gtgcaaaaaa tggctatctc tagaaaggcc 60

taccccttag gctttatgca acagaaacaa taataatgga gtcatgaaca tatg 114

88

Claims

1. a kind of method that N-STX is produced in host cell, method includes the following steps:

(A) under conditions of being suitble to production N-STX, host cell is cultivated in the medium in the presence of following substrate, The host cell includes coding PPT enzyme and the nucleic acid molecules for encoding Sxt polypeptide A, B, D, G, H, I, S, T, U, V, W and X:

(i) S-adenosylmethionine,

(ii) arginine

(iii) acetyl coenzyme A, malonyl coenzyme A or propionyl coenzyme A, and

(iv) carbamyl phosphate ester,

And wherein, the host cell does not include the nucleic acid molecules of coding Sxt peptide C, F, J, K, L, M, P, Q, R and ORF24； And optionally

(B) N-STX is separated and/or purified from the host cell or the culture medium.

2. a kind of method for producing N-STX or its analog or variant, method includes the following steps:

(i) S-adenosylmethionine,

(ii) arginine

(iii) acetyl coenzyme A, malonyl coenzyme A or propionyl coenzyme A, and

(iv) carbamyl phosphate ester,

And optionally

(B) N-STX or its analog or variant are separated and/or purified from the reaction medium.

3. according to the method described in claim 2, wherein, the reaction medium additionally comprises PPT enzyme.

4. a kind of method for producing N-STX or its analog or variant in host cell, this method includes following step It is rapid:

(A) it under conditions of being suitble to production N-STX or its analog or variant, is being cultivated in the presence of following substrate Host cell is cultivated in base, the host cell includes the nucleic acid point of coding Sxt polypeptide A, B, D, G, H, I, S, T, U, V, W and X Son:

(i) S-adenosylmethionine,

(ii) arginine

(iii) acetyl coenzyme A, malonyl coenzyme A or propionyl coenzyme A, and

(iv) carbamyl phosphate ester；And optionally

(B) N-STX or its analog or variant are separated and/or purified from the host cell or the culture medium.

5. according to the method described in claim 4, wherein, the host cell additionally comprises the nucleic acid molecules of coding PPT enzyme.

6. the method according to any one of claim 2-5, wherein the substrate not with one in Sxt peptide C, J and K The a variety of or all contacts of kind and/or the host cell do not include one of coding Sxt peptide C, J and K or a variety of or institute Some nucleic acid molecules.

7. the method according to any one of claim 2-6, wherein the substrate is not and in Sxt polypeptide Q, R and ORF24 One or more or all contacts and/or the host cell do not include coding one of Sxt polypeptide Q, R and ORF24 or A variety of or all nucleic acid molecules.

8. the method according to any one of claim 2-7, wherein the substrate not with one or more in (a)-(c) Any Sxt polypeptide contact in a:

(a) C, Q, R and ORF24；

(b) L, Q, R and ORF24；Or

(c) J, K, L, Q, R and ORF24；

And/or the host cell does not include the nucleic acid of any Sxt polypeptide in one or more of coding (a)-(c) Molecule.

9. the method according to any one of claim 2-8, wherein the substrate not with one in Sxt polypeptide F, M and P The a variety of or all contacts of kind and/or the host cell do not include one of coding Sxt polypeptide F, M and P or a variety of or institute Some nucleic acid molecules.

10. method according to any of the preceding claims, wherein the substrate in addition with selected from by SxtC, E, J, K, in addition one of group of L and R (preferably C and/or E) composition or the contact of a variety of Sxt polypeptides and/or the host cell wrap One of the Sxt peptide C containing coding, E, J, K, L and R (preferably C and/or E) or a variety of nucleic acid molecules.

11. method according to any of the preceding claims, wherein the substrate not with selected from by SxtF, M, N, O, P, a variety of or all Sxt polypeptides of one of group of Y, Z, ORF3, ORF4, ORF29, ORF34, OMPR or HISA composition connect Touching and/or the host cell do not include coding Sxt polypeptide F, M, N, O, P, Y, Z, ORF3, ORF4, ORF29, ORF34, OMPR Or the nucleic acid molecules that one of HISA is a variety of or all.

12. method according to any of the preceding claims, wherein the substrate in addition with SxtN and/or SxtDIOX Contact and/or the host cell additionally comprise the nucleic acid molecules of coding SxtN and/or SxtDIOX.

13. according to claim 1 or method described in any one of 4-12, wherein the host cell is prokaryotic host cell, Preferred bacterium cell, most preferably Bacillus coli cells.

14. according to claim 1 or method described in any one of 4-13, wherein the host cell is heterotrophic organism.

15. according to claim 1 or method described in any one of 4-14, wherein the host cell is recombinant host cell.

16. method according to any of the preceding claims, wherein by the N-STX or its analog or Variant or its pharmaceutically acceptable salt are configured to pharmaceutical composition.

17. according to the method for claim 16, wherein the preparation steps include new Saxidomus will separate or purifying Toxin or its analog or variant are mixed with one or more pharmaceutically acceptable carriers, adjuvant and/or excipient.

18. the N-STX or its analog or variant that pass through method production described in any one of preceding claims.

19. a kind of host cell comprising coding Sxt polypeptide A, the nucleic acid molecules of B, D, G, H, I, S, T, U, V, W and X, wherein The host cell, which does not include, encodes nucleic acid molecules below:

(i) one of Sxt peptide C, J or K are a variety of or all；

(ii) one of Sxt polypeptide Q, R and ORF24 are a variety of or all；

(iii) one of Sxt peptide C, Q, R and ORF24 are a variety of or all；

(iv) one of Sxt polypeptide L, Q, R and ORF24 are a variety of or all；

(v) one of Sxt polypeptide J, K, L, Q, R and ORF24 are a variety of or all；Or

(vi) one of Sxt polypeptide F, M and P are a variety of or all.

20. host cell according to claim 19, wherein the host cell additionally comprise coding selected from by SxtC, E, the nucleic acid molecules of one of group of J, K, L and/or R (preferably C and/or E) composition or a variety of Sxt polypeptides.

21. host cell described in 9 or 20 according to claim 1, wherein the host cell additionally comprise coding SxtN and/ Or the nucleic acid molecules of SxtDIOX.

22. host cell described in any one of 9-20 according to claim 1, wherein the host cell does not include coding choosing One of group of free F, M, N, O, P, Y, Z, ORF3, ORF4, ORF29, ORF34, OMPR or HISA composition or a variety of or institute There are the nucleic acid molecules of Sxt polypeptide.

23. host cell described in any one of 9-22 according to claim 1, wherein the host cell is that prokaryotic hosts are thin Born of the same parents, preferred bacterium cell, most preferably Bacillus coli cells.