KR100829836B1 - Molecular marker-assisted detection of rice weevil in stored rice - Google Patents

Abstract

The present invention relates to a method for the early diagnosis of rice weevil, Hwaranggok moth and barley moth in the storage rice using molecular markers, more specifically, a pair of primers for the sequence specific to each of the pests, and the primer By using a pair of DNA extracted from a small amount of rice using a pair amplification by PCR, and as a result of the present invention relates to a diagnostic method that can diagnose the pest early by electrophoresis to determine whether a specific single band appears. According to the present invention, even with a small amount of rice, it is possible to confirm the infection caused by the pest, which is not only useful for early diagnosis, but also spraying a small amount of pest control in a timely manner, thereby economically reducing costs. It can be effective.

Pests, Early Detection, PCR

Description

MOLECULAR MARKER-ASSISTED DETECTION OF RICE WEEVIL IN STORED RICE}

Figure 1 shows the DNA sequence of the internal transcribed spacer region of the rice weevil 5.8S ribosomal RNA (ribosomal RNA) gene.

Figure 2 shows a specific six primer pairs made from the DNA sequence of the internal transcribed spacer region of the rice weevil 5.8S ribosomal RNA gene.

Figure 3 (A) shows the DNA chain polymerization (PCR) results using primer pair 1 of the primer pairs made from rice weevil, Figure 3 (B) is a primer pair 2 ( DNA chain polymerization (PCR) results using SEQ ID NO: 4 and SEQ ID NO: 5) and primer pair 3 (SEQ ID NO: 6 and SEQ ID NO: 7) are shown.

4 (A) shows DNA chain polymerization (PCR) results using primer pair 4 (SEQ ID NO: 8 and SEQ ID NO: 9) and primer pair 5 (SEQ ID NO: 10 and SEQ ID NO: 11) among primer pairs prepared from rice weevil. 4 (B) shows a DNA chain polymerization (PCR) result using primer pair 6 (SEQ ID NO: 12 and SEQ ID NO: 13) among primer pairs prepared from rice weevil.

Figure 5 shows the results of sequencing the DNA fragments resulting from the PCR reaction of the primer pair 4 (SEQ ID NO: 8 and SEQ ID NO: 9) of the primer pairs prepared in rice weevil.

6 is a rice (Rice) without infection of rice weevil, rice about one month after being infected by rice weevil (W-Rice (N)), rice that has almost disappeared after more than six months of infection by rice weevil ( Genomic DNA was extracted from W-Rice (O)), followed by primer pair 1 (SEQ ID NO: 2 and SEQ ID NO: 3), primer pair 4 (SEQ ID NO: 8 and SEQ ID NO: 9), and primer pair 5 (SEQ ID NO: 10). And SEQ ID NO: 11) shows the result of DNA chain polymerization (PCR).

Figure 7 shows the DNA chain polymerization reaction (PCR) according to the amount of rice weevil, using a pair of rice weevil larvae primer pair 1 (SEQ ID NO: 2 and SEQ ID NO: 3), primer pair 4 (SEQ ID NO: 8 and SEQ ID NO: 9), DNA chain polymerization (PCR) was performed with primer pair 5 (SEQ ID NO: 10 and SEQ ID NO: 11).

FIG. 8 shows DNA sequence information of each microsatellite region of Hwaranggok moth and information on the preparation of each primer. A total of five primer pairs were prepared in each of five kinds of microsatellite regions. .

9 shows DNA chain polymerization (PCR) results using primer pairs 1 to 5 prepared from Hwaranggok moths.

Figure 10 shows the results of sequencing the DNA fragments as a result of the PCR reaction of the primer pair 4 (SEQ ID NO: 20 and SEQ ID NO: 21) of the primer pairs produced in Hwarangok moth.

Figure 11 shows the results of DNA chain polymerization reaction (PCR) using the primer pair 3 (SEQ ID NO: 18 and SEQ ID NO: 19) of the primer pair extracted DNA from Hwaranggok moth eggs.

FIG. 12 shows DNA sequences of barley moth out surface protein precursor (WSP) regions and primer pairs using the same.

Figure 13 shows the DNA chain polymerization (PCR) results using a primer pair prepared from barley moth.

Figure 14 shows the results of sequencing the DNA fragments resulting from the PCR reaction of the primer pair prepared from barley moth.

15 is DNA chain polymerization of rice weevil, Hwaranggok moth, barley moth and rice extract DNA from representative primer pairs (primer pair 1: rice weevil, primer pair 2: Hwagok moth, primer pair: barley moth) (PCR) shows the result.

The present invention relates to a method for early discrimination of pests in storage rice using DNA chain polymerization (PCR), and more specifically, DNA markers specific to rice weevil, Hwaranggok moth and barley moth, and using the same. The present invention relates to a method for discriminating whether a pest is infected early.

Rice and barley are important grains for our diet. However, these storage grains can be used as a host of small insects such as rice weevil, gorge moth and barley moth in the storage process, and its destruction is very serious.

Females of rice weevil (Sitophilus oryzae) drill holes in the grain, lay one egg per hole, and secrete a sticky substance to block the hole, sometimes two to three. The number of eggs varies slightly depending on the time of laying eggs, but one female lays 300 to 500 eggs. The eggs hatch in the grain until they grow into adult worms. Eat it. Adults and larvae tend to enjoy hard food, causing damage to stored grains such as rice, barley, wheat, corn, and corn. Damaged grains are not only quantitatively lost, but also due to the breathing of the larvae growing in the grains, resulting in high water content, heat generation, deterioration and deterioration, and so on.

Adults of Plodia interpunctella occur 3 to 4 times a year and spend the winter as larvae. The larvae are irregular and can see larvae, pupa and adult worms at various stages of growth. Adult worms usually lay eggs on straw bales or around rice barrels, with an average of 200 eggs. The caterpillar vomits thread in the mouth to entangle rice or grains, eats the rice eye first, and then eats the outer part. After growth, the caterpillar crawls out of the bale and becomes a pupa. It can also be found in more dry grains and foods than rice weavers living in similar places. If they live in beans or peppers, the larvae eat the inside of the fruit and then discharge the poop out through the holes, and are agricultural pests that reduce the value of commodities such as rice, beans and peppers.

The body of barley moth (Sitotroga cerealella) is greyish brown, the front wing is grayish yellow, the rear wing is gray or silver white. Some black spots are scattered on the rear edge of the fore wing. The eggs are flat oval, and the larva has a yellowish brown head and a pair of black purple spots on the upper part of the 8th segment of the trunk. Adult worms occur three times a year and spend the winter as larvae in cereals. The larvae add to the stored grains such as wheat, barley, millet, corn, buckwheat, and brown rice. The larvae eat mainly the eyes of barley grains stored in the stomach. The pupa comes from April to May, and the larvae that lived in the stored brown rice gather a few grains of brown rice into the threads of their mouths, and then make light yellow cocoons. After becoming an adult beetle, a hole is drilled out, leaving barley with a completely empty shell. In the wild, moths fly to barley and wheat after they leave, laying eggs on Isaac. Hatched larvae feed on and grow inside grain kernels, making them a major agricultural pest that reduces the commodity value of grains such as barley, wheat, and brown rice.

Therefore, early storage of pests is very important in order to reduce the damage caused by these insects when storing stored cereals. Therefore, there is a lot of research on how to control pests such as rice weevil, Hwaranggok moth, barley moth, which inhabit in storage rice and reduce the quality of storage rice. However, since pest control agents have been used only when the pest community has been found to some extent in storage rice, the remedy carried out after the presence of pests with the naked eye has been significantly reduced. Therefore, if the existence of the pest can be diagnosed at the early stage of infestation, the pest can be eradicated by using a much smaller amount of the drug, which is a more economical and environmentally friendly method. However, the early differentiation of the pests has not been developed yet.

Therefore, the present inventors have studied for several years to develop a DNA marker for the pest in a way that can be more easily find a rice weevil, Hwaranggok moth, and barley moth, the insects that are not a specific primer sequence of the crop itself The present invention was completed by identifying primers for the nucleotide sequences specifically found in each genome, and confirming that the presence of the insects can be discriminated early by molecular markers.

It is an object of the present invention to provide a method for diagnosing rice weevil infection using primer pairs for specific sequences of rice weevil (Sitophilus oryzae).

Another object of the present invention is to provide a method for diagnosing Hwarangok Moth infection using primer pairs for specific sequences of Plodia interpunctella.

Still another object of the present invention is to provide a method for diagnosing barley moth infection using primer pairs for specific sequences of barley moth (Sitotroga cerealella).

It is another object of the present invention to provide specific pairs of primers that express specific nucleotide bands of rice weevil, granola moth and barley moth.

In one embodiment, the present invention provides a rice weevil specific nucleotide by amplifying by a pair of primers selected from the group consisting of (SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 8 and SEQ ID NO: 9, and SEQ ID NO: 10 and SEQ ID NO: 11). Expressing the band; or

(Ii) amplified by primer pairs selected from the group consisting of SEQ ID NO: 14 and SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 22 and SEQ ID NO: 23 Expressing the band; or

(Iii) a method of diagnosing a pest infection using a primer pair specific to a nucleotide sequence specific to each pest, including amplifying by primer pairs of SEQ ID NO: 24 and SEQ ID NO: 25 to express a barley moth specific nucleotide band. will be.

The present invention provides a method for diagnosing pest infection of a crop, characterized in that the pest is rice weevil.

The internal transcribed spacer region of rice weevil 5.8S ribosomal RNA gene is known to be specific to each species. The inventors have focused on the use of this region to design primers that can specifically detect DNA sequences specific to rice weevil, and from the base sequence of rice weevil disclosed in the NCBI gene bank of the US biological information site. Six primer pairs were prepared to PCR amplify specific nucleotide bands only in rice weevil. In addition, experiments are performed for each primer pair by PCR to determine whether these molecular markers can discriminate rice weevil specifically, so that three pairs of primers amplify nucleotide bands accurately and quickly even at least 1 g of rice by PCR reaction. It was confirmed that rice weevil could be detected. Therefore, this primer pair can be used as a diagnostic marker for early detection of rice weevil infection in the present invention.

The present invention provides a method for diagnosing a pest infection, characterized in that the pest is a granola moth.

In the present invention, in order to develop molecular markers specific to Hwaranggok moths, when using a microsatellite sequence region that each species has a specific DNA sequence, a DNA sequence that is specifically present only in Hwaranggok moths In view of the possibility of designing a primer capable of specifically detecting the nucleotide sequence, five types of primer pairs capable of PCR amplifying nucleotide bands specific to Hwarangok moths from the nucleotide sequences of Hwarangok moths disclosed in the US biological information site NCBI Gene Bank Was produced. In addition, experiments were carried out on each of the primer pairs by PCR to determine whether these molecular markers could specifically discriminate Hwaranggok moths, and the three pairs of primers amplified the nucleotide bands through PCR reactions. It was confirmed that the form can also be detected. Therefore, these primer pairs can be used as a diagnostic marker that can confirm early infection of Hwakkok moth in the present invention. Hwaranggok moth stays in rice in the form of eggs for a long time, so it is very useful to develop a molecular marker that can detect eggs, the molecular marker of the present invention can also meet this demand (Fig. 11).

The present invention provides a method for diagnosing a pest infection, wherein the pest is barley moth.

To develop molecular markers specific for barley moth in the present invention, it is specific to barley moth from the sequence of the out surface protein precursor (WSP) region of barley moths disclosed in the gene bank of the US biological information site NCBI. Primer pairs were prepared to PCR amplify a specific nucleotide band. In addition, PCR experiments showed that the molecular markers could distinguish barley moths specifically. As a result, clear PCR products were produced in barley moths. However, it could be seen that the nucleotide bands are formed in the rice weevil during the PCR, but in the case of barley moth, a clearer PCR product is detected, thereby confirming that it can be used as a marker for detecting the presence of barley moth.

As described above, when each PCR reaction is performed on a rice sample using specific primer pairs of the present invention for rice weevil, Hwaranggok moth, and barley moth, the PCR product is generated when infected by the pest. do. Accordingly, the use of the primer pair provided by the present invention makes it easy to know whether an insect is infected even if the pest is invisible, so that its presence can be diagnosed before the pest inhabits. Damage can be minimized. This method of the present invention can be applied to all grains in which the pests can inhabit other than rice. Such grains include, but are not limited to, rice, barley, wheat, sorghum, corn, peppers, brown rice, and soybeans.

In another aspect, the present invention provides a primer pair for use in the pest infection diagnosis method.

Hereinafter, the content of the present invention will be described in more detail with reference to Examples. These examples are for illustrative purposes only for understanding the contents of the present invention, but the scope of the present invention is not limited thereto.

Example 1 Development of DNA Marker of Rice Weevil (Sitophilus oryzae)

1. Investigation of DNA sequence region and primer pairs specific to rice weevil

The DNA sequence of the internal transcribed spacer region known to be specific for each species of 5.8S ribosomal RNA gene was used. This was retrieved through the US biological information site NCBI Genebank. In this region, six types of primer pairs (SEQ ID NO: 2 to SEQ ID NO: 13), which are assumed to be specific to rice weevil, were prepared (Fig. 1).

Primer pair 1: 5'-CTTGACGTTTATTTTCGATGC-3 '(SEQ ID NO: 2) and 5'- TGGTTAATTTTGGCGTCCC-3' (SEQ ID NO: 3)

Primer pair 2: 5'-GCATCGATGAAGAACGCAGC-3 '(SEQ ID NO: 4) and 5'- TCAGACGTCGATTTCCGT-3' (SEQ ID NO: 5)

Primer pair 3: 5'-TCGGAGCGTGTTGGGTGTTT-3'- (SEQ ID NO: 6) and 5'-TCCTCCGCTTATTGATATGC-3 '(SEQ ID NO: 7)

Primer pair 4: 5'-CTTGACGTTTATTTTCGATGC-3 '(SEQ ID NO: 8) and 5'-TCCTCCGCTTATTGATATGC-3'- (SEQ ID NO: 9)

Primer Pair 5: 5'-GCATCGATGAAGAACGCAGC-3'- (SEQ ID NO: 10) and 5'-TGGTTAATTTTGGCGTCCC-3 '(SEQ ID NO: 11)

Primer pair 6: 5'-TCGGAGCGTGTTGGGTGTTT-3 '(SEQ ID NO: 12) and 5'-TCAGACGTCGATTTCCGT-3' (SEQ ID NO: 13)

2. Searching for the Most Specific and Clear DNA Marker in the Extracted Rice Weevil DNA Using Chain Polymerization (PCR)

Experiments were carried out for each of the primer pairs by PCR to determine whether these molecular markers could specifically discriminate rice weevil (Fig. 3, Fig. 4). Experimental results In the case of primer pair 2 (SEQ ID NO: 4 and SEQ ID NO: 5), primer pair 3 (SEQ ID NO: 6 and SEQ ID NO: 7), and primer pair 6 (SEQ ID NO: 12 and SEQ ID NO: 13), not only rice weevil but also Hwaranggok moth The same DNA fragment was amplified in either Plodia or rice. However, for primer pair 1 (SEQ ID NO: 2 and SEQ ID NO: 3), primer pair 4 (SEQ ID NO: 8 and SEQ ID NO: 9), and primer pair 5 (SEQ ID NO: 10 and SEQ ID NO: 11), DNA fragments specific only in rice weevil This was amplified. And we found that the size of the fragments is the same as we expected and appears to be clear.

As a result of confirming that the amplified DNA fragments were identical in the sequence of the internal transcribed spacer region, we produced the same region (FIG. 5). This was confirmed through primer pair 4 (SEQ ID NO: 8 and SEQ ID NO: 9).

3. Detection of rice weevil using specific primer pairs 1, 4 and 5 DNA markers found in rice weevil.

Using various rice samples, it was examined whether rice weevil can be detected using the DNA marker of the present invention (FIG. 6). W-Rice (O) severely infected with rice weevil (6 months after weevil infection), W-Rice (N) (one month after weevil infection) and infection that rice weevil has just begun Experiments were performed using a normal rice sample (Rice) without any at all.

6, it can be found that W-Rice (N) has a PCR product generated from primer pair 1 (SEQ ID NO: 2 and SEQ ID NO: 3). However, no PCR product was produced in W-Rice (O) or normal rice. Adults of rice weevil lay eggs in rice, and larvae grow in rice. Therefore, we could predict that PCR products could be amplified because rice weevil larvae were contained in randomly extracted W-Rice (N).

However, since W-Rice (O) was too long after infection, it was predicted that rice weevil larvae could not live because the rice tissue had already been destroyed. As can be seen from this experiment, by using rice weevil and randomly extracting rice about 1 month after infection by using the primer pair produced in the present invention, even a small amount of rice (1 g of rice) can effectively detect the infection. I could see that.

4. Differential sensitivity of rice weevil

In order to investigate the differentiation sensitivity of rice weevil, the following experiment was performed. Genomic DNA was extracted by mixing rice (rice 1g) with a single weevil larvae, followed by primer pair 1 (SEQ ID NO: 2 and SEQ ID NO: 3), primer pair 4 (SEQ ID NO: 8 and SEQ ID NO: 9), and primer pair 5 (SEQ ID NO: 10 and SEQ ID NO: 11) it was tested whether the search (Fig. 7). It was observed that PCR products were produced from three primer pairs. In particular, primer pair 5 was found to produce a very large amount of PCR products. Through this experiment, the amount of rice weevil per one gram of rice, even if the rice weevil is present inside the rice, even if it is invisible it can be seen that using the primer pair of the present invention can be sufficiently detected.

Example 2 Development of DNA Marker Specific to Plodia Interpunctella

1. Investigation of DNA sequence region specific to Hwaranggok Moth and its primer pair preparation

Five types of primer pairs were prepared as follows using a microsatellite sequence region that each species had a specific DNA sequence (FIG. 8). This was retrieved through the US biological information site NCBI Genebank.

Primer pair 1: 5'-CAGATGAGACAATAACGAAAC-3 '(SEQ ID NO: 14) and 5'-GAACACCGCTCAAATTAC-3' (SEQ ID NO: 15)

Primer pair 2: 5'-CGAGTCGCATTCACGTATGT-3 '(SEQ ID NO: 16) and 5'-GTCACTAACTTCAACGGTGT-3' (SEQ ID NO: 17)

Primer pair 3: 5'-GCACGCACAACGCTATGTA-3 '(SEQ ID NO: 18) and 5'-TGGTCTTTTCCATCCGTT-3' (SEQ ID NO: 19)

Primer Pair 4: 5'-GCTCTTATTACCGCTGCGT-3 '(SEQ ID NO: 20) and 5'-GAGGACAAACTTACTTTGGC-3' (SEQ ID NO: 21)

Primer pair 5: 5'-CCGGTCTCAATTTTCGTT-3 '(SEQ ID NO: 22) and 5'-CCAACATCGTGCTGATCA-3' (SEQ ID NO: 23)

2. Development of Hwaranggok Moth Specific DNA Marker Using PCR

PCR was performed to determine whether Hwaranggok moths could be specifically identified by each primer pair. As a result of the experiment, clear and clear PCR products can be seen in the reaction using the Hwarangok Moth DNA sample (Fig. 9). However, in the case of primer pair 4 (SEQ ID NO: 20 and SEQ ID NO: 21), a PCR product was also produced in rice weevil, which was found to be unsuitable for specifically detecting Hwarangok moths. However, primer pair 1 (SEQ ID NO: 14 and SEQ ID NO: 15) to primer pair 3 (SEQ ID NO: 18 and SEQ ID NO: 19) and primer pair 5 (SEQ ID NO: 22 and SEQ ID NO: 23) were specifically detected only in Hwarangok moths. Sequencing analysis of the PCR product detected by primer pair 2 (SEQ ID NO: 16 and SEQ ID NO: 17) was performed to confirm that the detected product was the microsatellite sequence prepared in Example 2.1 (FIG. 10). . As a result, it was confirmed that the detected product and the prepared subunit sequence were identical.

3. Gallery Moth detection through Gallery Moth DNA marker.

It was tested whether the primers for the microsatellite of Hwaranggok moth prepared in the present invention were also detected in genomic DNA of Hwaranggok moth larvae (FIG. 11). Adults of Hwaranggok moths lay eggs on rice, which have been in the form of eggs for a long time. Therefore, if the eggs of the Hwaranggok moth can be detected, it was considered to be very useful in diagnosing the early infection of Hwaranggok Moth. PCR was performed by extracting genomic DNA from about 20 eggs. As a result of PCR, it was confirmed that a very light band was detected. The results of FIG. 11 show that the PCR cycle was set at 35 to search for a clearer and more accurate band.

Example 3 Development of DNA Marker Specific to Barley Moth (Sitotroga cerealella)

1. Investigation of DNA sequence region specific to barley moth and preparation of primer pair

Among the DNA sequences of barley moth, DNA markers were prepared using the sequence of the out surface protein precursor (WSP) region found through the NCBI gene bank (FIG. 12).

TAGCTGGTGGTGGTGCGTTT (SEQ ID NO: 24)

TCTCACCACCGCTTTTATCG (SEQ ID NO: 25)

2. Development of Barley Moth Specific DNA Marker Using PCR

As a result of performing PCR with the primer prepared in Example 3.1, it was found that a clear PCR product was produced from barley moth (FIG. 13). But even rice weevil has a very light band. However, in the case of barley moth, the generated PCR product has a clearer band than in the case of barley moth, and it can be confirmed that there is a difference in the size. In addition, when electrophoresis was further performed for about 30 minutes, clear PCR products distinguished from the PCR products of rice weevil could be detected (FIG. 13). The PCR product thus detected was confirmed by sequencing analysis to match the sequence of the outer surface protein precursor (WSP) region prepared above (FIG. 14).

As described above, in the case of using the primer pair produced in the present invention, it is possible to specifically detect untreated pests through PCR, and to detect an infection from a very small amount of rice. As such, these properties are very useful for the early identification of stored rice pests.

Attach sequence list electronic file  

Claims (5)

A method for diagnosing barley moth pest infection of a crop using a primer pair specific for a nucleotide sequence specific to barley moth, comprising amplifying by a pair of primers of SEQ ID NO: 24 and SEQ ID NO: 25 to express a barley moth specific nucleotide band. The method of claim 1, wherein the crop is a crop selected from the group consisting of rice, barley, wheat, brown rice, sorghum, corn, red pepper, and soybeans. A primer pair consisting of SEQ ID NO: 24 and SEQ ID NO: 25 expressing a barley moth specific nucleotide band. Composition for diagnosing barley moth pest infection of a crop comprising a primer pair of claim 3. The diagnostic composition according to claim 4, wherein the crop is a crop selected from the group consisting of rice, barley, wheat, brown rice, sorghum, corn, red pepper and soybean.

Images