KR100827362B1 - - A Novel Limonoid UDP-glucosyltransferase and Method for Preparing the Same - Google Patents

Abstract

A novel limonoid UDP(uracil diphosphate)-glucosyltransferase is provided to remove bitter taste of limonoid while maintaining its physiological activity by converting limonoid into limonin glucoside, so that the enzyme is useful for preparing processed tangerine products having no bitter taste. A novel limonoid UDP-glucosyltransferase has the amino acid sequence of SEQ ID NO:1. A gene encoding the limonoid UDP-glucosyltransferase has the nucleotide sequence of SEQ ID NO:2. A method for producing the limonoid UDP-glucosyltransferase comprises the steps of: preparing a recombinant vector containing the limonoid UDP-glucosyltransferase gene; transforming a host cell selected from insect cell, bacteria, yeast and fungi with the recombinant vector to obtain a transformed microorganism; and culturing the transformed microorganism. A method for highly expressing the limonoid UDP-glucosyltransferase gene comprises the steps of: (a) transducing Escherichia coli with the recombinant vector containing the limonoid UDP-glucosyltransferase gene to produce a recombinant vector containing the limonoid UDP-glucosyltransferase gene; (b) transfecting the cloning vector to an insect cell such as Spodoptera frugiperda(Sf9) by using lipofectamine; and (c) culturing the transfected insect cell, and isolating and purifying the limonoid UDP-glucosyltransferase.

Description

Novel Limonoid UDP-glucosyltransferase and Method for Preparing the Same

Figure 1 is an electrophoresis picture of each of the total RNA of the sugar-containing tissue obtained by time using the trizol method.

Figure 2 is an electrophoresis picture showing the results of electrophoresis of the glucose-derived LUGT putative gene amplified under various RT-PCR conditions, a is a flower, b is immature fruit and C is mature fruit.

Figure 3 shows the phylogenetic tree of sequencing LUGT putative gene with UDP-glucosyltransferase of another plant using NCBI's multiple alignments program (clustal W program).

4 is a comparison of sugar-derived amino acid sequence and amino acid sequence of other Citrus using multiple alignments program (clustal W program).

Figure 5 is an electrophoresis picture showing the results of the expression of sugar-derived LUGT in E. coli by changing the expression conditions.

6 is a diagram illustrating a method for constructing a baculovirus expression system using insect cells of the present invention.

Figure 7 In order to determine the optimal expression time of sugar-derived LUGT protein, after infecting bacmid DNA while maintaining a constant cell concentration, cells are obtained from day 2, and the expression amount of mRNA after RT-PCR This is a graph.

Figure 8 is an electrophoresis picture showing the LUGT protein obtained from E. coli and Sf9, (a) shows the LUGT protein obtained from E. coli , (b) shows the LUGT protein obtained from Sf9.

Figure 9 is a photograph showing the result of western blot using anti-LUGT polyclonal antibody in order to know whether the expression of sugar-derived LUGT, (a) is LUGT expressed in E. coli , (b) is expressed in Sf9 LUGT, where 1 is negative control E. coli and Sf9 cell disruption containing the LUGT gene, 2 is E. coli and Sf9 cell disruption containing the LUGT gene, 3 is the C-terminal LUGT with 6x His tail was expressed in E. coli and Sf9, and the LUGT isolated using Ni-NTA column is shown.

10 is a result of comparing the LUGT expression pattern by sugar-glucose region, the lower part of the figure is an electrophoretic picture of the extracted enzyme protein, the shaded part of the upper part is a western blot picture of the part estimated as LUGT, 1 is a flower 2 uses leaves and 3 uses immature sugar sample.

11 is a result of comparing the expression patterns of LUGT for each time period after extracting the sugar-dried fruit samples collected during one month interval from October to February, and refrigerated, electrophoresis of the extracted enzyme protein at the bottom of the figure The shaded part of the upper part is a western blot picture of the part which is assumed to be LUGT, 1 is October, 2 is November, 3 is December, and 4 is sugar sugar sample harvested in January.

Figure 12 is a DNA electrophoresis picture comparing the expression of LUGT gene expression by site of sugar-fruit fruit by RT-PCR. GAPDH indicates that RT-PCR was performed using the same amount of total RNA as an internal control.

Figure 13 is a DNA electrophoresis picture comparing the expression of LUGT gene expression according to maturity of fruit by performing RT-PCR. GAPDH indicates that RT-PCR was performed using the same amount of total RNA as an internal control.

Figure 14a to 14c is a graph comparing the enzyme activity of LUGT expressed in E. coli and Sf9 using HPLC, Figure 14a shows a limonin glucoside standard, Figure 14b is a recombinant purified from E. coli LUGT, FIG. 14C shows the result of analyzing the reaction product after enzymatic reaction using recombinant LUGT separated and purified from Sf9.

 15 is a graph showing the result of enzymatic reaction of recombinant LUGT isolated and purified at Sf9 with different UDP-glucose concentrations.

16 is a graph comparing the efficiency of recombinant LUGT isolated and purified from E. coli and Sf9.

The present invention relates to a method for producing LUGT using a novel limonoid UDP-glucosyltransferase (LUGT), a gene encoding the enzyme and insect cells transformed with the gene.

Citrus fruits have functional ingredients with anti-cancer, antioxidant and anti-hypertensive properties, which are highly likely to develop into high value-added industries. Especially, immature fruits and traditional citrus fruits have limonoids that have anti-cancer and cardiovascular disease prevention effects. It contains significant amounts of physiologically active ingredients such as narazine and is highly likely to be developed as a functional material.

The study of limonoids began a long time ago when researchers identified the factors that caused the bitter taste of tangerine, which had an adverse effect on the juice industry, and the term limonoid was the first tetranortriterpene originating from the main ingredient that makes tangerine bitter. It is derived from limonin, a nodoid (tetranortriterpenoid). Compounds belonging to this group have various biological activities such as insecticidal activity against insects, inhibition of feeding and growth regulation, as well as antibacterial, antifungal, antimalarial, anticancer, antiviral and numerous pharmacological activities against humans. Although hundreds of limonoids have been isolated from various plants, their presence in the plant family is limited to plants belonging to the cedar, and also more abundant in the mulberry family and the family of cedars. It is rarely found in Harrisonia sp.

Citrus fruits contain significant amounts of limonoid compounds, and their quantitative analysis has been studied by HPLC. The limonoid compound is a secondary metabolite and is a triterpene derivative, which is present mainly in mature fruit or seeds. 38 limonoid aglycones, 23 neutral limonoids and 15 acidic limonoids, have recently been identified as 36 aglycones and 20 glucoside forms. Limonoids were isolated. These limonoid compounds are actually present in aglycone or glucoside form in citrus fruits, the most common being known as limonin and nomilin, and especially citrus seeds are known to be very rich in these limonoid compounds. In addition, as the fruit matures, more glucoside forms are reported than aglycone forms (Ruberto, G. et al. , J. Agric. Food Chem ., 50: 6766, 2002).

Limonoids are strongly oxidized and modified terpenoids that contain precursors with or derived from a 4,4,8-trimethyl-17-furanylsteroid backbone. All of the citrus limonoids found in nature not only have a furan ring attached to the D-ring 17 carbon, but also oxygen containing functional groups on carbon 3, 4, 7, 16 and 17. It contains. The structural variation of limonoids found in the Rheumno family is less than that of the mulberry family and is genetically limited only to modifications of the A and B rings. Limonoids of the mulberry family have a more complex structure with significantly higher oxidation and structure found in the parental limonoid structure.

Many studies have also been conducted on the physiological activity of citrus limonoid compounds. Citrus limonoid compounds, especially limonin and nomilin, have been shown to inhibit gastric cancer, lung cancer and skin cancer (Miller, EG et al. , Carcinogenesis 10: 1535).

As described above, limonoid is a physiologically active ingredient contained in a large amount of the tangerine's surgical and internal skins, and is a cause substance that is incorporated in juice during the production of citrus juice by the in-line juice method and exhibits a strong bitter taste of the citrus processed product. (Hasegawa, S. et al. , Phytochemistry , 28: 1717).

In order to develop high quality and functional citrus processed products, the quality of citrus juice should be solved first.In order to improve the quality of citrus juice, it is possible to adjust the harvest time of citrus fruits or to remove the bitter components of the citrus fruit to suit the taste of consumers. Technology development is important.

Prior to the research and development of the high expression method of the limonoid UDP-glucosyltransferase (LUGT) gene of the present invention, the market need for sugar bitter juice bitter taste was previously investigated.

At 17 Samsung Homeplus stores nationwide (Jeju-do Specialty Products Exhibition), 300 people were tasted for their taste and preference. In other words, by utilizing the high-quality image of Jeju Dangyuja Tea, the shops that sell local traditional foods at discount stores and the stores that specialize in tea are improved the quality of Jeju and the quality of Jeju Dangyuja Tea. In addition, market tests and tasting sales were conducted to secure quality raw materials and to improve quality (Table 1).

As a result, as shown in Table 1, about 73% of consumers knew that sugar-free tea was effective for coughing and colding, but about 83% of consumers answered that bittersweet tea had a bitter taste, and about 91% of consumers Respondents did not prefer the bitter taste of sugar yuja tea. In other words, Jeju's Dangyuja tea had a strong taste and aroma, and it was excellent for health functional foods such as cough and cold, but it was said that consumers were burdened with purchasing because of the bitter taste peculiar to Dangyuja tea.

Survey target term Survey Content it really is In general A little bit Not like that 300 Samsung Homeplus customers 2005.04.20 ~ 2005.04.25 It has bitterness in sugar yucha tea 31% (93 people) 31.7% (95 people) 20.7% (62 people) 16.6% (50 people) Does not prefer the bitter taste of sugar yuja tea. 32.7% (98 people) 35% (105 people) 23.3% (70 people) 9% (27 people) I know that the bitterness of sugar yuja tea is good for coughing and colding. 12% (36 people) 28% (84 people) 32.7% (98 people) 27.3% (82 people)

As a result of prior market research on removing sugar bitter juice bitterness, it was found that removing bitter taste peculiar to sugar citron tea is preceded by manufacturing high quality functional sugar sugar processed products using conventional citrus fruits.

Therefore, there is an urgent need in the art for the isolation and development of LUGT in the manufacture of high-quality and functional sugar-containing processed products containing limonine having various physiological activities as described above.

Accordingly, the present inventors have made intensive efforts to develop a novel limonoid UDP-glycotransferase (LUGT) which converts the bitter taste-free limonin glycoside while maintaining the physiological activity of the limonoid as it is. A sugar transfer enzyme was discovered and the present invention was completed.

After all, the main object of the present invention is to provide a sugar-derived novel enzyme and its gene.

Another object of the present invention is to provide a recombinant vector containing the gene and a microorganism transformed with the recombinant vector.

Still another object of the present invention is to provide a method for preparing limonoid UDP-glucosyltransferase (LUGT), which comprises culturing the transformed microorganism.

The present invention, in one aspect, relates to a sugar-containing novel limonoid UDP-glucosyltransferase (LUGT) having a amino acid sequence of SEQ ID NO: 1 and a gene encoding the same. The gene may be characterized by having the nucleotide sequence of SEQ ID NO: 2.

In the present invention, the sugar lactose growing in Jeju specialty was collected at each time, total RNA was isolated from each of them, and then amplified by obtaining a sugar-derived LUGT putative gene, and the sequence thereof was identified. Comparing the sequence of the gene identified above with other Citrus genus, it was confirmed that it is a LUGT gene encoding a new limonoid UDP-glycotransferase.

The limonoid UDP-glycotransferase has an inhibitory effect on gastric cancer, lung cancer, and skin cancer, and is an enzyme that converts a limonoid compound, which has a bitter taste in sugar milk, to limonin-glucoside. It can be used to manufacture high quality functional sugar citrus processed products.

In another aspect, the present invention, a recombinant vector containing a gene encoding the limonoid UDP-glucosyltransferase (LUGT), the recombinant vector in the group consisting of insect cells, bacteria, yeast and fungi Provided is a method for producing a transformed microorganism obtained by introducing into a selected host cell and a limonoid UDP-glucosyltransferase (LUGT) characterized by culturing the transformed microorganism. In the present invention, the host cell is preferably an insect cell, the insect cell may be characterized in that the Sf9 cells.

In the present invention, "vector" refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. The vector may be a viral vector, plasmid, phage particle, or simply a potential genomic insert. Once transduced into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid" and "vector" are sometimes used interchangeably in the present specification. For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. It has a structure comprising an antibiotic resistance gene and (c) a restriction enzyme cleavage site into which foreign DNA fragments can be inserted. Although no appropriate restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods facilitates ligation of the vector and foreign DNA.

Particularly useful vectors for the transformation of insect cells in the present invention are viral vectors. The viral vector may be any one selected from the group consisting of baculovirus, adenovirus, retrovirus and adeno-associated virus, but the preferred vector in the present invention is a baculovirus vector.

After ligation, the vector should be transformed into the appropriate host cell. In the present invention, preferred host cells are insect cells, and suitable insect cells are Sf9. In addition, prokaryotic cells may be used as host cells, which include E. coli DH5α, E. col JM101, E. coli K12, E. coli W3110, E. coli X1776, and E. coli XL-1Blue (Stratagene). , E. coli B, E. coli B21 and the like. However, E. coli strains such as FMB101, NM522, NM538 and NM539 and other prokaryotic species and genera may also be used. In addition to the aforementioned E. coli , strains of the genus Agrobacterium, such as Agrobacterium A4, bacilli , such as Bacillus subtilis , Salmonella typhimurium or Serratia marghesen another variety of enteric bacteria and Pseudomonas (Pseudomonas) in strains such as marcescens) may be used as host cells.

On the other hand, when the LUGT according to the present invention is expressed in recombinant insect cells, the efficiency of the LUGT was about 10 times higher than when expressed in E. coli .

Therefore, in another aspect, the present invention is characterized by culturing insect cells transformed with recombinant vectors containing limonoid UDP-glucosyltransferase (LUGT), LUGT (limonoid UDP-glucosyltransferase) It relates to a method of manufacturing).

Method for producing LUGT according to the present invention comprises the steps of (a) transducing the recombinant vector to E. coli, producing a recombinant vector containing the LUGT gene; (b) transfecting the vector cloned with the LUGT gene into insect cells using lipofectamin; And (c) culturing the insect cells, and then separating and purifying the LUGT. In the present invention, the insect cells may be characterized as Spodoptera frugiperda (Sf9) cells.

Example

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1: Plant Material

All the samples used in this experiment are sugar-growers growing in Jeju, and they are flowers, leaves, June fruits, October fruits, November fruits, December fruits, January fruits, and 2 Monthly fruit was collected. The tissue needed to obtain cDNA was frozen in liquid nitrogen and then stored at -80 ° C. Tissues needed for enzyme extraction by tissue were used as samples before enzyme extraction after refrigeration.

In order to extract LUGT (limonoid UDP-glucosyltransferase) from the sample, 50 mM Tris-Hcl buffer (pH 8.0; containing 1 mM PMSF in DMSO, 5 mM DTT, 15 mM β-mercaptoethanol) was added to each sample at 8 times the sample weight. The tissue was pulverized using a blender. The pulverized sample was filtered using gauze, and then centrifuged at 12,000 rpm and 4 ° C. for 30 minutes using a centrifuge to obtain a supernatant for each tissue. (NH ₄ ) ₂ SO ₄ was added to 75% of the supernatant volume of the sugar citron sample obtained after the centrifugation, followed by saturation for 1 hour, and after centrifugation (12,000 rpm, 4 ° C., 30 minutes), -80 ° C. It was used as a whole sample of the enzyme extract of each tissue while keeping in. In the enzyme reaction, the sample was dialyzed using 50 mM Tris-Hcl buffer (pH 8.0; containing 1 mM PMSF in DMSO, 5 mM DTT, 15 mM β-mercaptoethanol) to remove (NH ₄ ) ₂ SO _4. , All the conditions were set to pH 8.0 and 4 degreeC at the time of enzyme extraction.

Example 2 RT-PCR and Expressed Sequence (EST) Analysis

Using the Trizol method, the total RNA of the glucose-containing tissue obtained at each time was isolated (FIG. 1). In order to isolate LUGT from sugar- sugars , limonoid UDP-glucosyltransferase of Citrus unshiu , complete CDS (Kita, M. et al. , FEBS Lett. 10; 469 (2-3): 173-8, registered with NCBI (AB033758) , 2000) was searched for nucleotide sequences, and primers for amplifying only the sugar-derived LUGT gene were selected and ordered to Bioneer.

By the trizol method, RT-PCR was performed with 1 µg of each isolated total RNA and primers of SEQ ID NO: 3 and SEQ ID NO: 4, which were custom-made by Bioneer, to amplify the sugar-derived LUGT putative gene.

SEQ ID NO: 3 (LUGT forward primer): AATTTTAGAACAAATCATTCGAGAATA

SEQ ID NO: 4 (LUGT reverse primer): AGTGCTTTGAGTCAGAACTTCCAA

RT-PCR was performed by dividing into three conditions, as shown in Table 2 below, electrophoresis of the glucose-derived LUGT estimation gene amplified by each RT-PCR condition, as shown in Figure 2, LUGT estimation gene The clearest amplification was found in condition C. Lane a in FIG. 2 represents a flower, lane b represents an immature fruit and lane C represents a mature fruit.

Condition A Condition B Condition C -95 ℃ ~ 94 ℃, 2min -50 ℃, 1min -72 ℃, 1min -72 ℃, 10min -4 ℃, 40cycle -95 ℃ ~ 94 ℃, 2min -55 ℃, 1min -72 ℃, 1min -72 ℃, 10min -4 ℃, 40cycle -95 ℃ ~ 94 ℃, 2min -60 ℃, 1min -72 ℃, 1min -72 ℃, 10min -4 ℃, 40cycle

The amplified LUGT putative gene was subcloned using pGEM-T Easy vector (Promega). Colonies obtained by subcloning were screened using colony PCR. As a result, a cloning product containing the LUGT putative gene was obtained. The sequence of the cloned gene was confirmed using the Terminator Big-Dye kit (ABI) 3100 sequencer system. As a result of sequencing of the LUGT putative gene, the LUGT putative gene sequence of SEQ ID NO: 2 (1.536kb) was obtained.

The sequencing of the glucose-derived LUGT presumed gene was used the primers of SEQ ID NOs: 5-7.

SEQ ID NO 5: ACAATGCATAGCCAATTTCT

SEQ ID NO: AAATTTGCCCTATTAAACCC

SEQ ID NO: GAAGCATGATGAAGTGCCTA

The sequencing LUGT putative gene (of NCBI) was compared with UDP-glucosyltransferase in other plants using multiple alignments program (2 sequencing program) (clustal W program) to draw a phylogenetic tree (FIG. 3). As a result, as shown in Figure 3, the sequencing LUGT estimation gene was found to have a gene sequence similar to the UDP glucosyltransferase of other plants, it can be seen that Citrus grandis Osbeck LUGT. F3GT of Figure 3 Getiana triflora flavonoid 3'-O-glucosyltransferase , UGT 1S5A is Nicotiana tabacum salicylate-induced glucosyltransferase, F5GT is Torenia hybrida, Verbana hybrida, Petunia hybrida of anthocyanin 5-glucosyltransferase, F7GT are Scutellaria baicalensis of flavonoid 7-O -Glucosyltransferase, CaUGT1 and CaUGT2 are catharanthus roseus , UDP-glucose glucosyltransferase, UGT1a, tobacco glucosyltransferase Nt1a, UGT1b, tobacco glucosyltransferase Nt1, F3GT are Gentiana triflora , Perilla frutescens, Petunia hybrid flavonoid 3-O-glucosyltransferase, SAGT is Nicotiana tabacum salicylic acid glucosyltransferase, HqGT is Rauvolfia serpentina hydroquinone O-glucosyltransferase, B5GT, is a derivative of Dorotheanthus bellidiformis betanidin 5-O-glucosyltransferase, F5GT is Torenia hybrida, Verbana hybrida, Petunia hybrida , flavonoid 5-O-glucosyltransferase, MJGT is Nicotiana tabacum jasmonate-induced glulucosyltransferase, UGT73C6, is a Arabidopsis glucosyl transferase, and StGT of thaliana represents the Avena sativa sterol O-glucosyltransferase.

In addition, based on the amino acid sequence of the sugar residue 511 aa of SEQ ID NO: 1 of the other SEQ ID NO: 8 and SEQ ID NO: 9 (SEQ ID NO: 1: C. grandis, SEQ ID NO: 8: CU Merk, SEQ ID NO: 9: C.Unshiu) As a result of comparing the amino acid sequence in Citrus using clustal W programe, it was found that more than 90% of LUGT amino acid in other Citrus was consistent with each other.In this example, the isolated gene was LUGT gene (Fig. 4).

Example 3: Preparation of Glucose-Derived LUGT Recombinant Protein

3-1: Cloning with E. coli

PCR using the plasmid identified as a sugar-derived LUGT gene in Example 2 as a template, and using primers of SEQ ID NO: 10 and SEQ ID NO: 11 (95 ° C. 2 minutes, 94 ° C. 1 minute, 55 ° C. 1 minute, and 72 2 minutes (39 ° C.) was performed to amplify the LUGT gene. The amplified LUGT gene was inserted into the Nde I and Bam HI sites of the pET-16b + vector (Novagen) to produce a recombinant vector.

SEQ ID NO: 10 (LUGT forward primer): CATATGAGAATAATGGGAACTGAA

SEQ ID NO: 11 (LUGT reverse primer): GGATCCTCAATACTGTACACGTGT

Since the sugar-derived LUGT of the present invention is a membrane bound enzyme, the amount of protein finally obtained is not high. Therefore, the present inventors experimented by varying the incubation temperature, microbial concentration, IPTG concentration, IPTG induction after incubation time and the like to find the optimal expression conditions of sugar-derived LUGT.

Expression condition of sugar-derived LUGT One Expression at 37 ° C., OD ₆₀₀ = 0.7, IPTG concentration = 1 mM, 4 hours at 37 ° C., 2 Expression at 37 ° C., OD ₆₀₀ = 1.0, IPTG concentration = 1 mM, 4 hours at 37 ° C. 3 Expression at 30 ° C for 16 hours after treatment at 37 ° C, OD ₆₀₀ = 1.0, IPTG concentration = 1 mM and 0.4 mM 4 Expression at 18 ° C. for 20 hours after treatment at 37 ° C., OD ₆₀₀ = 1.0, IPTG concentration = 0.1 mM

As shown in Table 3 above, by expressing the glucose-derived LUGT by varying the expression conditions, and using the 12% SDS-PAGE to examine the expression level, as shown in Figure 5, the sugar in the pET 16b + vector The optimal condition of the expression of citron-derived LUGT was found to be 20 hours at 18 ° C. after treatment at 37 ° C., cell concentration OD ₆₀₀ = 1.0, and IPTG concentration = 0.1 mM.

3-2: Cloning with Insect Cells

The glucose-derived LUGT gene identified in Example 2 was expressed using Sf9, which is a donor cell. 6 is a diagram illustrating a method for constructing a baculovirus expression system using insect cells according to the present invention.

(1) LUGT bacmid separation

Subcloning the LUGT gene amplified by PCR using pGEM-T Easy vector (promega), screening colony, extracting plasmid containing LUGT and using restriction enzymes Bam HI (Promega) and Pst I (Promega) Was cut. The fragment obtained after restriction enzyme treatment was cloned into pFastBac ^™ HTb vector (4856bp) (Invitrogen co.) Of Bac-to-Bac Baculovirus Expression System (Invitrogen co.) And screened to obtain a recombinant glucose-derived LUGT bacmid. The 6x His tag contained in the bacmid was also used for affinity chromatography.

20 ml of LB medium was added to the obtained DH10BAC cell (Invitrogen) containing the recombinant bacmid DNA and shaken at 37 ° C for 24 hours, and centrifuged (1,500 rpm, 10 minutes) to obtain cells.

The obtained cells were treated with buffer I (resuspension), buffer II (lysis), and buffer III (neutralization), and the same amount of isopropanol was treated to obtain a recombinant bacmid. The bacmid obtained was dissolved in 50 μl of nucleotide free water and used as a sample for transfection.

(2) Transfection and Infection

The isolated recombinant bacmid DNA is mixed with lipofectamin for 15 minutes and then mixed with 0.8 ml of SFM II (Invitrogen) medium. Carefully drop the recombinant bacmid and lipofectamin mixture dropwise onto a 6 well plate pre-attached so that the Sf9 cell concentration is 7x10 ⁵ / ml, shake-incubate for 5 hours, and add 2 ml of SFM II (Invitrogen) medium. Incubate for 4 days in an incubator at 27 ° C. The cultured cells were centrifuged and the supernatant was taken. In a 25 cm 2 tissue culture flask, Sf9 cells were infected at 1 × 10 ⁶ cells / flask and infected with MOI of 10, and then cultured at 27 ° C. for 6 days. The supernatant obtained after cell culture was used for shaking incubation while stored at -70 ° C.

In shaking culture, Sf9 cells were incubated in advance to 3㎖10 ⁶ cells / ml, then subcultured to 1 ㅧ 10 ⁶ cells / ml, and the cells infected with T75 flask for one day were incubated in a shaking culture bottle.

(3) cell culture

The infected insect cell Spodoptera frugperda (Sf9) was cultured using SF 900 II SFM (Gibco-BRL, USA) as a basal medium, and cultured while maintaining a temperature of 27 ° C. Bottle culture for mass culture of the insect cells were cultured at 27 ℃ and 120rpm conditions.

(4) Optimal Expression of Sugar-Derived LUGT Proteins

In order to determine the optimal expression time of the sugar-derived LUGT protein, bacmid DNA was infected while maintaining Sf9 cell concentration constant, and then cells were obtained from day 2, and the expression level of mRNA was confirmed by RT-PCR (FIG. 7). ). As a result, as shown in FIG. 7, 72 hours after infection of bacmid DNA, the mRNA expression rate was found to be the highest.

(5) Confirmation of Sugar-Derived LUGT Expression in Insect Cell Line

Sf9 cells were cultured to 2 × 10 ⁶ / ml in a T75 flask, and the bacmid obtained in Example 3 was infected. 72 hours after infection of bacmid DNA with the highest LUGT expression rate, virus stocks were obtained and used for mass culture. The mass culture was performed by infecting the virus in a 1L culture bottle and incubating for 3 days while maintaining the conditions of 27 ° C. and 125 rpm, followed by centrifugation at 5000 rpm for 10 minutes to obtain infected cells.

Example 4 Purification and Identification of Sugar-Derived LUGT

Purification of sugar-derived LUGT was isolated and purified using a Ni-NTA column using 6x His tail. First, the cells were cultured and centrifuged (1000 rpm, 20 ° C., 10 min), and the obtained cells were placed in a lysis buffer (50 mM NaH ₂ PO ₄ 300 mM NaCl, 10 mM imidazole, Adjust pH to 8.0) having a cell weight of 4 times and mixed well. It was left to stand for 30 minutes. The soaked sample was sonicated, centrifuged (13,000 rpm, 4 ° C., 20 min), the supernatant was taken, and used as a whole sample of the enzyme experiment and purification step. The supernatant was purified after mixing with Ni-NTA for 2 hours at 4 ℃. The purified recombinant glucose-derived LUGT was confirmed using 12% SDS-PAGE (FIG. 8). As a result, as shown in Figure 8 E. coli (a) And 52.0 kDa purified protein in Sf9 cell (b).

After the electrophoresis, the protein was transferred to an immobilon membrane at 100 V for 120 min. Next, Western blot using anti-LUGT polyclonal antibody to determine the expression of the sugar-derived LUGT, as shown in Figure 9, LUGT expression in E. coli (a) and Sf9 cells (b) It was found.

The anti-LUGT polyclonal antibody was prepared and used as follows:

Purified LUGT was confirmed using SDS-PAGE, and then used as an antigen for making an antibody. The LUGT was dialyzed with PBS and the dialyzed protein was injected into rabbits. The protein was injected once every 4 days over 6 weeks, and the amount of protein was injected at least 200 μg once. The final Ab was confirmed using a western blot.

The western blot was performed as follows:

To identify the recombinant LUGTs, 12% SDS-PAGE was performed first, followed by transfer using Immobilon-P membranes. Then, polyclonal anti-LUGT antibody was added, and then unbound Ab was washed with TTBS and treated with anti-rabbit IgG antibodies. After the reaction using an ECL reagent, it was confirmed using an X-ray film.

Example 5: Expression and Utilization of Bitter-Treatment Enzymes

5-1: Expression Analysis of LUGT Enzyme Protein by Glucose Site

In order to examine the expression patterns of sugar glucose during the period of time, sugar milk was collected from June and stored in refrigeration, and used as a sample during enzyme extraction. The sample extracted by the method of Example 1 was electrophoresed to confirm the expression of LUGT.

Electrophoresis was performed using 12% SDS-PAGE, the same amount of protein was used 50㎍. Lane 1 is a flower, lane 2 is a leaf and lane 3 is an immature sugar sample. As a result of performing the western blot, LUGT was expressed in the flower extract sample and the immature and extracted sample, but it was found that LUGT was not expressed in the leaf extract sample (FIG. 10).

12% SDS-PAGE was carried out and the samples were collected and stored refrigerated at 1 month intervals from October to February. After extracting enzymes, the expression patterns of LUGT were compared. Lane 1 is October, lane 2 is November, lane 3 is December and lane 4 is January.

As a result, the expression of LUGT was gradually increased in November, December, and January than in October, but the expression rate of LUGT was decreased in maturity of February (Fig. 11).

5-2: LUGT Expression Patterns by Fruit Maturation Stages

1 μg / μl of total RNA collected in Example 2 and SEQ ID NO: 1 and SEQ ID NO: 2 using LUGT primer, 95 ℃ 2 minutes, 94 ℃ 1 minutes, 55 ℃ 1 minutes and 72 ℃ 2 minutes, 39 LUGT genes were amplified and compared by tissue in the meeting conditions (FIG. 12). As a result, as shown in FIG. 12, LUGT activity was observed in immature fruit, but LUGT activity was not seen in leaves.

In addition, the expression pattern of LUGT according to the maturity of the fruit was compared (Fig. 13). As a result, as shown in Figure 13, the expression pattern of LUGT was found to be almost similar.

5-3: Comparison of efficiency of recombinant LUGT in E. coli and Sf9

We compared the enzyme activity of Sf9 with LUGT expressed in E. coli using HPLC (FIGS. 14A-14C). Figure 14b and 14c is a graph showing the results of the analysis of the enzyme reaction product using the recombinant LUGT using HPLC, Figure 14a shows the limonin glucoside standard, Figure 14b shows the purified recombinant LUGT in E. coli The following shows the results of the HPLC analysis using the enzyme reaction, Figure 14c shows the result of analyzing the reaction product after the enzyme analysis using recombinant LUGT purified from Sf9. (B) of FIG. 14b and FIG. 14c are the results of HPLC analysis of the product reacted by addition of the LUGT enzyme and the limonoid compound, followed by HPLC analysis. , (c) shows only the reaction buffer and then analyzed by HPLC.

The enzyme activity was added to the enzyme activity reaction solution (1mM limonin (with an open D-ring), 2mM UDPG-2Na), 10mM Mg ²⁺ , 20mM Tris-Hcl buffer, pH 7.8) 100 ㎕, 37 ℃ The reaction was completed for 1 hour, and the enzyme reaction was terminated by boiling at 100 ° C. for 5 minutes, and then centrifuged at 13000 rpm for 10 minutes. All reactions were enzymatically reacted using 50 ㎍ / mL separated sample after protein quantification, and the reaction product was passed through Sep-Pak-C18 cartridge (Waters), elution with methanol, and then analyzed by HPLC. Used for. HPLC was performed using Shimadze model SCL-10 AVP systems, and the column was analyzed using a Capcell C18 column (Shiseido, 4.6 mm 250 mm). The solvent composition was 210 nm with A: 3 mM phosphoric acid / (H ₂ O: acetonitrile = 90: 10), B: 3 mM phosphoric acid / (H ₂ O: acetonitrile = 74: 26), and the solvent flow rate was 1 ml / min. Analyze The standard product was dissolved in acetonitrile to make 100ppm, 50ppm and 10ppm, and the calibration curve was prepared.

As a result of HPLC analysis, as shown in FIGS. 14A to 14C, the enzyme reaction product limonin glucoside was formed at 31 minutes of the same time as the Rt value of the limonin glucoside standard sample (Retension time, the time when the peak indicating limonoid glucose appeared). It was found that more reaction products were produced in the enzymatic reaction expressed using sf9 than the enzymatic reaction by LUGT expressed and purified from E. coli .

In addition, the enzyme reaction was carried out using LUGT purified from Sf9 by varying the concentration of the enzyme substrate UDP-glucose (Fig. 15). As a result, as shown in Figure 15, the enzyme reaction product was found to increase depending on the concentration of the substrate.

In addition, we compared the efficiency of recombinant LUGT in E. coli and Sf9 (Fig. 16). Sf9 of FIG. 16 represents LUGT purified from Ni-NTA for recombinant LUGT expressed from Sf9, and E. coli represents LUGT purified from Ni-NTA from recombinant LUGT expressed from E. coli . Using the same concentration of enzyme, the amount of limonin glucoside produced after the reaction was compared by the area ratio of the peak by HPLC analysis.

As a result, as shown in Figure 16, the amount of limonin glucoside produced after the reaction using the enzyme of the same concentration was found to be about 10 times more than the enzyme expressed in Sf9 than the enzyme expressed in E. coli .

As described in detail above, according to the present invention, a novel limonoid UDP-glucosyltransferase (LUGT), which is an enzyme that converts a limonoid into a limonin glycoside and removes the bitter taste while maintaining the physiological activity of the limonoid intact ), And the effect of providing a method for high expression of the LUGT, the bitter taste is removed by using a variety of traditional tangerines that are not used as raw materials of citrus processing as well as raw food because the bitter taste is strong It is useful for producing high quality and functional citrus fruits.

Having described the specific part of the present invention in detail, it is obvious to those skilled in the art that such a specific description is only a preferred embodiment, thereby not limiting the scope of the present invention. something to do. Therefore, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Attach sequence list electronic file  

Claims (9)

Novel limonoid UDP-glucosyltransferase (LUGT) having the amino acid sequence of SEQ ID NO: 1. The gene encoding the limonoid UDP-glucosyltransferase (LUGT) of claim 1. The gene according to claim 2, wherein the gene has a nucleotide sequence of SEQ ID NO. Recombinant vector containing the gene of claim 2. A transformed microorganism obtained by introducing the recombinant vector of claim 4 into a host cell selected from the group consisting of insect cells, bacteria, yeasts and fungi. 6. The transformed microorganism according to claim 5, wherein the insect cell is an Sf9 cell. A method for producing limonoid UDP-glucosyltransferase (LUGT), comprising culturing the transformed microorganism of claim 5 or 6. High expression of LUGT (limonoid UDP-glucosyltransferase) gene using insect cells comprising the following steps: (a) transducing the recombinant vector of claim 4 to E. coli to produce a recombinant vector containing the LUGT gene; (b) transfecting the vector cloned with the LUGT gene into insect cells using lipofectamin; And (c) culturing the insect cells, and then separating and purifying LUGT. The method of claim 8, wherein the insect cell is Spodoptera frugiperda (Sf9) cells.

Images