KR100824413B1 - Multiplex pcr method for rapid classification of esbl and pcr primer therefor - Google Patents

Multiplex pcr method for rapid classification of esbl and pcr primer therefor Download PDF

Info

Publication number
KR100824413B1
KR100824413B1 KR1020060117766A KR20060117766A KR100824413B1 KR 100824413 B1 KR100824413 B1 KR 100824413B1 KR 1020060117766 A KR1020060117766 A KR 1020060117766A KR 20060117766 A KR20060117766 A KR 20060117766A KR 100824413 B1 KR100824413 B1 KR 100824413B1
Authority
KR
South Korea
Prior art keywords
seq
pcr
ctx
tem
esbl
Prior art date
Application number
KR1020060117766A
Other languages
Korean (ko)
Inventor
김성한
김준영
전세미
박미선
이복권
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020060117766A priority Critical patent/KR100824413B1/en
Application granted granted Critical
Publication of KR100824413B1 publication Critical patent/KR100824413B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Four kinds of PCR primer sets are provided to be applicable to one PCR reaction at the same time. A multiplex PCR method for detecting and classifying extended spectrum beta lactamase(ESBL) is provided to detect and classify 4 kinds of the ESBLs, which are CMYII, CTX-MI, CTX-MII, and DHA, with accuracy and rapidity by applying the same primers. A multiplex PCR method for detecting and classifying ESBL is characterized in that it detects and classifies at least two target sequences of CMY II(cephamycin resistant type II), CTX-MI(cefotaxime resistant type-MI), CTXMII(cefotaxime resistant type-MII), DHA(daharan) gene in the ESBL using at least two PCR primer sets selected from the group consisting of a PCR primer set for detecting the CMY II having sequences of SEQ ID : NOs. 1 and 2, a PCR primer set for detecting the CTX-MI having sequences of SEQ ID : NOs. 3 and 4, a PCR primer set for detecting the CTX-MII having sequences of SEQ ID : NOs. 5 and 6, and a PCR primer set for detecting the DHA having sequences of SEQ ID : NOs. 7 and 8. A kit for diagnosing and classifying the ESBL comprises at least two PCR primer sets selected from the group consisting of the PCR primer set for detecting the CMY II having sequences of SEQ ID : NOs. 1 and 2, the PCR primer set for detecting the CTX-MI having sequences of SEQ ID : NOs. 3 and 4, the PCR primer set for detecting the CTX-MII having sequences of SEQ ID : NOs. 5 and 6, and the PCR primer set for detecting the DHA having sequences of SEQ ID : NOs. 7 and 8.

Description

기질확장형 β―락타마제의 신속분류를 위한 멀티플렉스 ＰＣＲ 기법 및 이를 위한 ＰＣＲ 프라이머{Multiplex PCR method for rapid classification of ESBL and PCR primer therefor}Multiplex PCR Method for Rapid Classification of Substrate-Expandable β-lactamase and PCR Primer Thereof {Multiplex PCR method for rapid classification of ESBL and PCR primer therefor}

도 1 ~ 도 6은 본 발명에 의한 멀티플렉스 PCR 기법을 5개 균종 총82주에 적용한 결과를 보인 전기영동사진.1 to 6 are electrophoresis images showing the results of applying the multiplex PCR method according to the present invention in a total of 82 strains of five species.

도 7은 종래의 ESBL 유형 분류법과 본 발명에 의한 멀티플렉스 PCR 기법을 이용한 ESBL 유형 분류법을 비교한 도표.Figure 7 is a table comparing the ESBL type classification method using the conventional ESBL type classification method and the multiplex PCR method according to the present invention.

본 발명은 기질확장형 β-락타마제(Extended Spectrum Beta Lactamase; ESBL)의 신속분류를 위한 멀티플렉스 PCR 기법 및 이를 위한 PCR 프라이머에 관한 것이다. 더욱 상세하게는 한번의 PCR 반응에 동시에 적용할 수 있는 4종의 PCR 프라이머세트의 개발 및 이들 프라이머들을 동시에 적용하여 정확하고 신속하게 다수의 기질확장형 β-락타마제(ESBL)를 검출 및 분류할 수 있는 멀티플렉스 PCR 기법에 관한 것이다.The present invention relates to a multiplex PCR technique for rapid classification of substrate extended type β-lactamase (ESBL) and PCR primers therefor. More specifically, the development of four sets of PCR primers that can be applied simultaneously to one PCR reaction and the application of these primers simultaneously can detect and classify multiple substrate-extension β-lactamase (ESBL) accurately and quickly. The present invention relates to a multiplex PCR technique.

β-락탐(β-lactam)계 항균제는 세균의 세포벽 합성을 방해하여 항균력을 나타내게 되는데, β-락타마제(β-lactamase)는 β-락탐계 항균제의 β-락탐환을 가 수 분해하여 항균력을 제거하는 효소로 세균이 이 효소를 생산하는 능력을 갖게 되면 β-락탐계 항균제에 대한 내성을 갖게 된다. β-lactam-based antimicrobial agents exhibit antimicrobial activity by interfering with bacterial cell wall synthesis. β-lactamase (beta-lactamase) hydrolyzes β-lactam ring of β-lactam-based antimicrobial agents to reduce its antimicrobial activity. The enzyme that removes the bacteria has the ability to produce this enzyme, making it resistant to β-lactam antibiotics.

β-락타마제는 앰블러(Ambler)식 분류법(Livermore, 1995)에 따라 크게 Class A, B, C 및 D로 나눌 수 있으며 Class A는 페니실린(penicillin) 계열의 항균제에 활성이 높은 것으로 기질확장형 β-락타마제 (ESBL)가 속해 있는 분류군으로 이 효소를 암호화하는 내성 유전자가 주로 플라스미드(plasmid)에 위치하고 있기 때문에 균 사이의 서로 전이가 가능하며 ESBL은 3세대 세팔로스포린(cephalosporin)을 분해하는 β-락타마제를 의미한다. β-lactamase can be classified into Class A, B, C and D according to Ambler's classification (Livermore, 1995), and Class A has high activity against penicillin-based antimicrobial agents. -Lactamase (ESBL) is a taxon that belongs to the resistance gene encoding this enzyme is mainly located in the plasmid (plasmid) can be transferred to each other between bacteria and ESBL is a β that breaks down 3rd generation cephalosporin (β) -Means lactase.

Class B　β-락타마제는 효소의 활성에 아연을 필요로 하는 금속함유효소(metaloenzyme) 이고, Class C 효소는 세팔로스포린(cephalosporin)을 분해하는 Amp C라 불리는 효소군으로 이것에 유래되는 것으로 추정되는 플라스미드(plasmid) 매개 β-락타마제 CMY-1, MOX-1 및 FOX-1 생산 균주는 2세대 세팔로스포린(cephalosporin)에 내성을 보이고 3세대 세팔로스포린(cephalosporin)에 낮은 정도의 중등도 내성을 보이므로 광범위한 의미의 ESBL로 볼 수 있다. Class D는 옥살실린(oxalcillin) 분해능이 뛰어나다.Class B β-lactamase is a metaloenzyme that requires zinc for its activity, and class C enzymes are presumed to be derived from a group of enzymes called Amp C that degrade cephalosporin. The resulting plasmid-mediated β-lactamase CMY-1, MOX-1 and FOX-1 producing strains are resistant to second-generation cephalosporins and have a low degree of moderate resistance to third-generation cephalosporins. It can be seen as ESBL in a broad sense. Class D has excellent oxalcillin resolution.

1980년대 초부터 사용한 3세대 세팔로스포린계 항균제를 이용한 감염병 치료는 다량의 Class A, D ESBL, Class C 효소 생성 균주를 출현시켰다. ESBL은 TEM을 비롯해 SHV, OXA, CTX 등 다양한 유형이 보고되고 있고 이것은 세계 전역에 퍼져있으며 국내외에서 현재 주요 병원체 별로 ESBL 보유현황에 대한 조사(survey)는 거의 완료되었다.Infectious disease treatment using the third-generation cephalosporin-based antimicrobial agents used since the early 1980s has produced a large amount of Class A, D ESBL, and Class C enzyme producing strains. ESBL is reported in various types such as TEM, SHV, OXA, CTX, etc., and it is spread all over the world, and the survey of ESBL holding status by major pathogens at home and abroad is almost completed.

ESBL은 그 유형에 따라 항균제 내성 경향에서 차이를 보이고 있고, 이들을 암호화하는 유전자들은 대부분 접합을 이용한 전달 능력이 있어 항균제 내성이 없는 다른 균주로 쉽게 항균제 내성의 원인이 되는 ESBL 생산능력을 전달할 수 있기 때문에 ESBL을 생산하는 균주 감염질환에 대한 효과적인 치료를 위해서는 신속한 ESBL 유형의 분류가 필요하다.ESBL shows a difference in antimicrobial resistance tendency according to its type, and most of the genes encoding them have the ability to transfer by using conjugation, which can easily transfer ESBL production capacity that causes antimicrobial resistance to other strains without antimicrobial resistance. Rapid treatment of ESBL-type strains is necessary for effective treatment of ESBL-producing strains.

일반적으로 ESBL 진단 및 유형 분류 방법은 예를 들어 1) 클라불란산(clavulanic acid: CVA)의 존재 및 부재하에서 CTX, CAZ, AZT에 대한 MIC(최소 억제 농도)를 측정하는 방법, 2) 두 종류의 디스크를 사용하는 이중-디스크 시너지 방법, 3) 생산이 의심되는 병원체의 등전점을 측정한 후 추정되는 유형을 대상으로 개개의 중합효소연쇄반응(PCR)을 통해 유형을 확인하는 등전점 측정 및 중합효소연쇄반응(PCR)을 이용하여 유형을 확인하는 방법 등이 행해지고 있다.In general, ESBL diagnostic and type classification methods are, for example, 1) measuring the minimum inhibitory concentration (MIC) for CTX, CAZ, AZT in the presence and absence of clavulanic acid (CVA), and 2) two types. Dual-disk synergy using discs, 3) measuring isoelectric points of suspected pathogens, and isoelectric point measurements and polymerases to identify types through individual polymerase chain reactions (PCRs) of suspected types. The method of confirming a type using a chain reaction (PCR), etc. are performed.

그러나 이들 방법은 박테리아 분리 및 배양을 위해 장시간이 소요되어 신속한 검출에 어려움이 있고, 다수의 병원체의 동시 진단에도 어려움이 있다. 특히, 등전점 측정 및 중합효소연쇄반응을 이용하는 방법은 약 3일 정도의 시간이 소요되며 등전점으로 미루어 추측되는 유형만을 확인하므로 실제 보유 유전자 중에 일부만이 확인될 가능성이 있는 문제점이 있다(도 7 참조).However, these methods require a long time for bacterial isolation and cultivation, and thus have difficulty in rapid detection, and also have difficulty in simultaneous diagnosis of many pathogens. In particular, the method using the isoelectric point measurement and the polymerase chain reaction takes about three days, and thus confirms only the type that is estimated by the isoelectric point, so that only a part of the actual genes may be identified (see FIG. 7). .

따라서 ESBL 생산여부 확인 및 유형분류 시간을 단축시킴으로써 항균제 내성 보유 병원체의 전파를 조기에 차단할 수 있는 정확하고 신속한 ESBL 진단 및 유형 분류 방법에 대한 요구가 계속적으로 있어 왔다.Therefore, there is a continuous need for accurate and rapid ESBL diagnosis and classification methods that can prevent the transmission of antimicrobial resistant pathogens early by shortening the ESBL production confirmation and classification time.

본 발명은 상기 종래 기술의 문제점 및 요구를 해결하기 위해 안출된 것으로, 본 발명의 목적은 다중 중합효소 연쇄반응을 이용하여 신속하게 진단과 동시에 그 유형을 분류할 수 있어 정확하고 신속하게 기질확장형 β-락타마제(ESBL)를 검출, 분류할 수 있는 멀티플렉스 PCR 기법을 제공하는 것이다.The present invention has been made to solve the problems and demands of the prior art, the object of the present invention can be quickly and quickly classify the type using the multiple polymerase chain reaction can be accurately and quickly substrate expansion type β It is to provide a multiplex PCR technique that can detect and classify lactamase (ESBL).

본 발명의 다른 목적은 상기 기질확장형 β-락타마제의 신속분류를 위한 멀티플렉스 PCR 기법에 사용되는 PCR 프라이머들을 제공하는 것이다.Another object of the present invention is to provide PCR primers used in the multiplex PCR technique for rapid classification of the substrate-extension β-lactamase.

본 발명의 또 다른 목적은 상기 PCR 프라이머들을 포함하는 ESBL 검출 및 분류 키트를 제공하는 것이다.Another object of the present invention is to provide an ESBL detection and classification kit comprising the PCR primers.

상기 목적을 달성하기 위해, 본 발명자들은 ESBL 중 광범위하게 전파되는 병원체에서 최근 유행하고 있는 주 유형들인 TEM, CMY, CTX-M, OXA, SHV형들 각각에 대한 PCR용 프라이머를 개발하고자 예의 연구하여 왔으며, 나아가 한번의 PCR 반응을 동시에 적용할 수 있도록 공통의 반응조건을 갖는 프라이머의 개발에 주력하여 왔다. 그 결과 5종의 ESBL 각각의 PCR용 프라이머를 합성하였으며, 개발된 5세트의 프라이머 모두(이하, “ESBL 세트 1”이라고 함)를 PCR 반응에 동시에 적용하여 1회의 PCR 수행으로 5종의 ESBL을 동시에 검출 및 분류할 수 있음을 확인하고 이를 선특허출원 제10-2006-0069129호로 출원한 바 있다. In order to achieve the above object, the present inventors have intensively studied to develop primers for PCR for each of the main types of TEM, CMY, CTX-M, OXA, and SHV types, which are recently prevalent in the widely spread pathogens of ESBL. Furthermore, we have focused on the development of primers with common reaction conditions so that one PCR reaction can be applied simultaneously. As a result, PCR primers for each of five ESBLs were synthesized, and all five sets of primers (hereinafter, referred to as “ESBL set 1”) were simultaneously applied to a PCR reaction, and five ESBLs were applied in one PCR. At the same time, it was confirmed that it can be detected and classified, and has filed it as prior patent application No. 10-2006-0069129.

본 발명자들은 관련연구를 계속하여 상기 선출원의 프라이머세트로 검출이 불가능했던 유형들인 CMY II (세파마이신(Cephamycin) 내성 유형 II), CTX-MI(세포탁심(Cefotaxime) 내성 유형-MI), CTX-MII(세포탁심(Cefotaxime) 내성 유형-MII), DHA(다하란(Daharan))형 4종의 ESBL 각각의 PCR용 프라이머를 합성하였으며, 개발된 4세트의 프라이머 모두(이하, “ESBL 세트 2”라고 함)를 PCR 반응에 동시에 적용하여 1회의 PCR 수행으로 4종의 ESBL을 동시에 검출 및 분류할 수 있음을 확인하고 본 발명을 완성하게 되었다.The inventors continued their studies to study CMY II (Cephamycin Resistance Type II), CTX-MI (Cefotaxime Resistance Type-MI), CTX- Primers for PCR of four ESBLs of MII (Cefotaxime resistance type-MII) and DHA (Daharan) type were synthesized, and all four sets of primers developed (hereinafter, “ESBL set 2”) were synthesized. The present invention was completed by confirming that four kinds of ESBLs can be detected and classified simultaneously by applying one PCR to a PCR reaction at the same time.

따라서 본 발명은 ESBL 검출 및 분류를 위한 멀티플렉스 PCR 기법에 있어서, ESBL 중 CMYII, CTX-MI, CTX-MII, DHA 유전자의 2 이상의 표적서열을 다음 프라이머세트로 이루어진 그룹으로부터 선택되는 2이상의 PCR 프라이머세트를 사용하여 검출 및 분류함을 특징으로 하는 ESBL 검출 및 분류를 위한 멀티플렉스 PCR 기법을 제공한다.Therefore, in the multiplex PCR technique for ESBL detection and classification, two or more PCR primers selected from the group consisting of two or more target sequences of CMYII, CTX-MI, CTX-MII, and DHA genes in ESBL from the following primer sets Provided is a multiplex PCR technique for ESBL detection and classification characterized by detection and classification using sets.

본 발명에 의한 PCR용 프라이머세트 그룹은 서열번호 1 및 서열번호 2의 염기서열을 갖는 CMYII 검출을 위한 PCR용 프라이머세트, 서열번호 3 및 서열번호 4의 염기서열을 갖는 CTX-MI 검출을 위한 PCR용 프라이머세트, 서열번호 5 및 서열번호 6의 염기서열을 갖는 CTX-MII 검출을 위한 PCR용 프라이머세트, 그리고 서열번호 7 및 서열번호 8의 염기서열을 갖는 DHA 검출을 위한 PCR용 프라이머세트인 것을 특징으로 한다.The primer set group for PCR according to the present invention is a primer set for PCR for detecting CMYII having nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, PCR for detecting CTX-MI having a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 Primer set for PCR, primer set for PCR for detecting CTX-MII having nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, and primer set for PCR for detecting DHA having nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8 It features.

나아가 본 발명은 상기 프라이머세트로 이루어진 그룹으로부터 선택되는 2이상의 PCR 프라이머세트를 포함하는 ESBL 진단 및 분류 키트를 제공한다.The present invention further provides an ESBL diagnostic and classification kit comprising two or more PCR primer sets selected from the group consisting of the above primer sets.

본 발명에 따른 ESBL 중 CMYII, CTX-MI, CTX-MII, DHA형 각각에 대해 특이적인 프라이머세트는 각 이 유형을 생산하는 blaCMYII, blaCTX - MI, blaCTX - MII 및 blaDHA 유전자들의 염기서열을 기초하여 합성된 것이다. The primer sets specific for each of CMYII, CTX-MI, CTX-MII, DHA types in ESBL according to the present invention are the bases of the bla CMYII , bla CTX - MI , bla CTX - MII and bla DHA genes that produce these types, respectively. Synthesized based on sequence.

ESBL 중 CMYII, CTX-MI, CTX-MII, DHA형을 생산하는 유전자 검출을 위한 PCR 기법은 한 세트의 프라이머 -Forward 프라이머와 Revere 프라이머-를 이용하게 되는데, 이들 프리이머 설계시, 프라이머의 A, G, C, T 함량비, 프라이머 복합체(dimer) 형성 방지, 같은 염기서열의 3회 이상 반복금지 등 여러 가지 제약이 따르며, 그 외에 단독 PCR 반응조건에 있어서 주형(template) DNA의 양, 프라이머의 농도, dNTP의 농도, Mg2 +의 농도, 반응온도, 반응시간 등의 조건이 적정해야 한다.The PCR technique for detecting genes producing CMYII, CTX-MI, CTX-MII, and DHA in ESBL uses a set of primers-Forward and Revere primers. G, C, T content ratio, preventing the formation of primer complex (dimer), prohibition of repeating three or more times of the same base sequence, and other restrictions, in addition to the amount of template DNA, primer primer concentration, and the conditions such as the concentration of dNTP, Mg concentration of 2 +, and the reaction temperature, and the reaction time should be adequate.

또한 본 발명에서와 같이 4종의 ESBL에 대한 PCR 프라이머를 혼합하여 동시에 한번에 PCR을 수행함으로써 분리한 각 병원체의 유전자를 1회에 확인하는 멀티플렉스 PCR 반응에서는, 프라이머 설계시 단독 PCR의 경우와 같은 조건이 더욱 엄격하게 요구되며, 또한 반응완료 후 겔상에서 증폭되는 유전자 산물의 구별을 위해서는 유전자 산물의 크기가 각각 구별이 되어야 하는 크기의 제약까지 따른다. 반응조건의 설정에 있어서도 4세트의 프라이머 모두에 대한 공통의 반응조건이 설정되어야 하므로, 단독 PCR에 비해서 매우 어려운 조건 설정 과정이 요구된다.In addition, as in the present invention, in multiplex PCR reactions in which the PCR primers for four ESBLs are mixed and PCR is performed at the same time, and the genes of each pathogen isolated are identified at once. More stringent conditions are required, and in order to distinguish gene products that are amplified on the gel after completion of the reaction, the size of the gene products must be distinguished. In setting the reaction conditions, since common reaction conditions for all four sets of primers must be set, a very difficult condition setting process is required compared to a single PCR.

본 발명에 의해 제공되는 ESBL 검출 및 분류를 위한 4종의 프라이머세트는 이러한 멀티플렉스 PCR 기법에 적합하도록 개발된 것으로서, 1회의 PCR 반응에 동시에 적용할 수 있어 1회의 PCR 수행으로 4종의 ESBL을 동시에 고감도로 검출할 수 있다. 본 발명에서 개발된 4종의 ESBL에 대한 PCR용 프라이머세트 및 이들에 의한 PCR 증폭산물의 크기는 다음과 같다.The four primer sets for ESBL detection and classification provided by the present invention were developed to be suitable for such a multiplex PCR technique, and can be applied simultaneously to one PCR reaction. At the same time, it can be detected with high sensitivity. The primer sets for PCR and four PCR amplification products of the four ESBLs developed in the present invention are as follows.

NameName SequenceSequence 표적유전자Target gene sizesize CMY II 361F CMY II 361F AGCGATCCGGTCACGAAATA (서열번호 1) AGCGATCCGGTCACGAAATA (SEQ ID NO: 1) blaCMYII bla CMYII 695 bp 695 bp CMY II 1010R CMY II 1010 R CCCGTTTTATG CACCCATGA (서열번호 2) CCCGTTTTATG CACCCATGA (SEQ ID NO: 2) CTX M I 45F CTX M I 45F TCCAGAATAAGGAATCCCATGG (서열번호 3)  TCCAGAATAAGGAATCCCATGG (SEQ ID NO: 3) blactx -M I bla ctx -MI 621 bp 621 bp CTX M I 665R CTX M I 665 R TGCTTTACCCAGCGTCAGAT (서열번호 4) TGCTTTACCCAGCGTCAGAT (SEQ ID NO: 4) CTX M II 168F CTX M II 168F ACCGCCGATAATTCGCAGAT (서열번호 5) ACCGCCGATAATTCGCAGAT (SEQ ID NO: 5) blactx -M iI bla ctx -M iI 588 bp 588 bp CTX M II 752R CTX M II 752R GATATCGTTGGTGGTGCCATAA (서열번호 6) GATATCGTTGGTGGTGCCATAA (SEQ ID NO: 6) DHA 88F DHA 88F GTGGTGGACAGCACCATTAAA (서열번호 7) GTGGTGGACAGCACCATTAAA (SEQ ID NO: 7) blaDHA bla DHA 314 bp 314 bp DHA 401R DHA 401R CCTGCGGTATAGGTAGCCAGAT (서열번호 8) CCTGCGGTATAGGTAGCCAGAT (SEQ ID NO: 8)

본 발명에 따른 멀티플렉스 PCR 기법은 1회의 PCR을 수행함으로써 ESBL 중 광범위하게 전파되는 병원체에서 최근 유행하고 있는 유형들인 CMYII, CTX-MI, CTX-MII, DHA형들을 신속 정확하게 진단과 동시에 그 유형을 분류할 수 있고 비용면에서 매우 경제적이다. 특히 본 발명에 따른 멀티플렉스 PCR 기법은 약 4시간 만에 진단과 분류가 가능하여, 기존 실험법으로 3일 이상 소요되던 ESBL 생산여부 확인 및 유형분류 시간을 단축시킴으로써 항균제 내성 보유 병원체의 전파를 조기에 차단할 수 있는 기반 형성에 기여할 것으로 기대된다(도 7 참조).The multiplex PCR technique according to the present invention is capable of quickly and accurately diagnosing CMYII, CTX-MI, CTX-MII, and DHA types, which are the most prevalent types of pathogens spread widely in ESBL by performing a single PCR. It can be classified and very economical in terms of cost. In particular, the multiplex PCR method according to the present invention can be diagnosed and classified in about 4 hours, thereby reducing the propagation of the antimicrobial agent-resistant pathogens by reducing the ESBL production status and type classification time, which took 3 days or more by the existing test method. It is expected to contribute to the formation of a barrier that can be blocked (see FIG. 7).

이하, 실시예를 통해 본 발명을 상세히 설명한다. 그러나 하기 실시예들은 본 발명을 설명하기 위한 것으로, 본 발명의 권리범위가 하기 실시예들에 의하여 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail through examples. However, the following examples are provided to illustrate the present invention, and the scope of the present invention is not limited to the following examples.

실시예Example 1:  One: ESBLESBL 표준균주의Standard strain 준비 Ready

1993년부터 2005년까지 임상에서 분리된 균주 가운데 ESBL 생산과 유형이 확인된 Enterobacer cloacea 3주, Escherichia coli 12주, Salmonella spp. 9주, Shigella spp. 21주 및 Klepsiella pneumoniae 37주를 대상으로 본 발명에 의한 멀티플렉스 PCR 기법을 수행하였다. Enterobacer identified ESBL production and type among clinically isolated strains from 1993 to 2005 cloacea 3 weeks, Escherichia coli 12 weeks, Salmonella spp. 9 weeks, Shigella spp. 21 weeks and Klepsiella 37 pneumoniae strains were subjected to multiplex PCR according to the present invention.

실시예Example 2:  2: ESBLESBL 유형 확인을 위한 본 발명에 의한 멀티플렉스  Multiplex according to the present invention for type identification PCRPCR 기법의 확립 Establishment of the technique

진단 대상이 되는 유전자는 현재 ESBL로 문제시되는 CMYII, CTX-MI, CTX-MII, DHA 유형을 생산하는 blaCMYII, blaCTX - MI, blaCTX - MII,및 blaDHA 유전자들을 대상으로 하였고, 이 유형을 표적으로 한 특이적인 프라이머(primer)를 제작(표 1 참조)하여 본 발명에 의한 멀티플렉스 PCR(multiplex PCR)법으로 유형을 확인하였다. The genes to be diagnosed were the bla CMYII , bla CTX - MI , bla CTX - MII , and bla DHA genes, which produce CMYII, CTX-MI, CTX-MII, and DHA types that are currently problematic with ESBL. Specific primers were prepared (see Table 1) and the types were identified by the multiplex PCR method according to the present invention.

반응 혼합액은 10X PCR 완충용액 2.5㎕, dNTP 4㎕, 19pM/㎕의 각 유형의 표적용 프라이머 4세트를 0.5㎕씩, Ex Taq 중합효소 0.5㎕ 넣은 후 최종 반응액 25㎕을 구성하였다. 반응과정은 94℃에서 5분간 변성시킨 후 반응은 94℃ 1분, 61℃ 1분, 72℃ 1분을 한 주기로 30 사이클(cycle) 조건으로 증폭시켰다. For the reaction mixture, 2.5 μl of 10X PCR buffer solution, 4 μl of dNTP, and 19 pM / μl of 4 sets of target primers of each type were added to 0.5 μl of Ex Taq polymerase, and 25 μl of the final reaction solution was formed. After the reaction was denatured at 94 ° C. for 5 minutes, the reaction was amplified in 30 cycles at 94 ° C. for 1 minute, 61 ° C. for 1 minute, and 72 ° C. for 1 minute.

실시예Example 3: 본 발명에 의한 멀티플렉스  3: multiplex according to the present invention PCRPCR 기법의 적용시험 Application test of technique

본 발명에 의한 멀티플렉스 PCR 기법을 5개 균종 총82주에 적용해 보았다. 이때 PCR 반응 조건은 실시예 2와 동일하였다. 반응 종료 후 PCR 증폭산물을 2 % 아가로스 겔을 이용하여 전기영동을 실시하였으며, 그 결과는 도 1 ~ 도 6에 나타내었다.The multiplex PCR technique according to the present invention was applied to a total of 82 strains of five species. At this time, PCR reaction conditions were the same as in Example 2. 2% PCR amplification product after reaction Electrophoresis was performed using an agarose gel, and the results are shown in FIGS. 1 to 6.

도 1에서 M 레인은 100bp 표준 마커(marker), 1 레인은 E. coli 01-003, 2 레인은 E. coli 01-004, 3 레인은 K. pneumoniae 01-013, 4 레인은 E. coli 01-018, 5 레인은 E. coli 01-035, 6 레인은 K. pneumoniae 01-038, 7 레인은 K. pneumoniae 01-120, 8 레인은 K. pneumoniae 01-122, 9 레인은 K. pneumoniae 01-123, 10 레인은 E. coli 01-132, 11 레인은 K. pneumoniae 01-162, 12 레인은 K. pneumoniae 01-1171, 13 레인은 K. pneumoniae 01-197, 14 레인은 K. pneumoniae 01-221, 15 레인은 K. pneumoniae 01-250을 나타낸다. In Figure 1 lane M is 100bp standard marker, lane 1 is E. coli 01-003, lane 2 is E. coli 01-004, lane 3 is K. pneumoniae 01-013, lane 4 is E. coli 01 -018, lane 5 E. coli 01-035, lane 6 K. pneumoniae 01-038, lane 7 K. pneumoniae 01-120, lane 8 K. pneumoniae 01-122, lane 9 K. pneumoniae 01 -123, 10 for E. coli 01-132, 11 for K. pneumoniae 01-162, 12 for K. pneumoniae 01-1171, 13 for K. pneumoniae 01-197, 14 for K. pneumoniae 01 Lanes -221, 15 represent K. pneumoniae 01-250.

도 2에서 M 레인은 100bp 표준 마커(marker), 16 레인은 E. coli 01-245, 17 레인은 K. pneumoniae 02-065, 18 레인은 K. pneumoniae 02-199, 19 레인은 E. coli 02-211, 20 레인은 K. pneumoniae 02-219, 21 레인은 K. pneumoniae 02-475, 22 레인은 K. pneumoniae 02-514, 23 레인은 E. coli 02-542, 24 레인은 K. pneumoniae 02-581, 25 레인은 K. pneumoniae 02-696, 26 레인은 K. pneumoniae 03-028, 27 레인은 E. coli 03-034 , 28 레인은 E. coli 03-038, 29 레인은 K. pneumoniae 03-063, 30 레인은 K. pneumoniae 03-094을 나타낸다. In FIG. 2, M lane is 100 bp standard marker, 16 lanes are E. coli 01-245, 17 lanes are K. pneumoniae 02-065, 18 lanes are K. pneumoniae 02-199, and 19 lanes are E. coli 02. -211, 20 lanes K. pneumoniae 02-219, 21 lanes K. pneumoniae 02-475, 22 lanes K. pneumoniae 02-514, 23 lanes E. coli 02-542, 24 lanes K. pneumoniae 02 -581, 25 lanes K. pneumoniae 02-696, 26 lanes K. pneumoniae 03-028, 27 lanes E. coli 03-034, 28 lanes E. coli 03-038, 29 lanes K. pneumoniae 03 Lanes -063 and 30 represent K. pneumoniae 03-094.

도 3에서 M 레인은 100bp 표준 마커(marker), 31 레인은 K. pneumoniae 03-127, 32 레인은 K. pneumoniae 03-137, 33 레인은 K. pneumoniae 03-147, 34 레인은 K. pneumoniae 03-167, 35 레인은 K. pneumoniae 03-186, 36 레인은 K. pneumoniae 03-189, 37 레인은 K. pneumoniae 03-222, 38 레인은 K. pneumoniae 03-241, 39 레인은 E. coli 03-252, 40 레인은 K. pneumoniae 04-030, 41 레인은 K. pneumoniae 04-074, 42 레인은 K. pneumoniae 04-083, 43 레인은 K. pneumoniae 04-105, 44 레인은 E. coli 04-128, 45 레인은 E. cloacea 04-163 을 나타낸다. In FIG. 3, M lane is 100 bp standard marker, 31 lanes are K. pneumoniae 03-127, 32 lanes are K. pneumoniae 03-137, 33 lanes are K. pneumoniae 03-147, and 34 lanes are K. pneumoniae 03. -167, 35 lanes K. pneumoniae 03-186, 36 lanes K. pneumoniae 03-189, 37 lanes K. pneumoniae 03-222, 38 lanes K. pneumoniae 03-241, 39 lanes E. coli 03 -252, 40 lanes K. pneumoniae 04-030, 41 lanes K. pneumoniae 04-074, 42 lanes K. pneumoniae 04-083, 43 lanes K. pneumoniae 04-105, 44 lanes E. coli 04 Lanes -128, 45 represent E. cloacea 04-163.

도 4에서 M 레인은 100bp 표준 마커(marker), 46 레인은 K. pneumoniae 05-048, 47 레인은 K. pneumoniae 05-075, 48 레인은 K. pneumoniae 05-089, 49 레인은 K. pneumoniae 05-093, 50 레인은 E. cloacea 04-172, 51 레인은 E. cloacea 04-199, 52 레인은 K. pneumoniae 05-224, 53 레인은 S. sonnei 99-292, 54 레인은 S. sonnei 99-511, 55 레인은 S. sonnei 99-845, 56 레인은 S. sonnei 99-1497, 57 레인은 S. sonnei 99-1503, 58 레인은 S. sonnei 99-1505, 59 레인은 S. sonnei 99-2495, 60 레인은 S. sonnei 99-2496을 나타낸다. In Figure 4 lane M is 100bp standard marker, 46 lanes K. pneumoniae 05-048, 47 lanes K. pneumoniae 05-075, 48 lanes K. pneumoniae 05-089, 49 lanes K. pneumoniae 05 -093, 50 lanes E. cloacea 04-172, 51 lanes E. cloacea 04-199, 52 lanes K. pneumoniae 05-224, 53 lanes S. sonnei 99-292, 54 lanes S. sonnei 99 -511, 55 lanes S. sonnei 99-845, 56 lanes S. sonnei 99-1497, 57 lanes S. sonnei 99-1503, 58 lanes S. sonnei 99-1505, 59 lanes S. sonnei 99 Lanes -2495, 60 represent S. sonnei 99-2496.

도 5에서 M 레인은 100bp 표준 마커(marker), 61 레인은 S. sonnei 99-2497, 62 레인은 S. sonnei 99-2969, 63 레인은 S. sonnei 99-2733, 64 레인은 S. sonnei 99-3087, 65 레인은 S. sonnei 99-3093, 66 레인은 S. sonnei 99-3095, 67 레인은 S. sonnei 99-4263, 68 레인은 S. sonnei 99-6087, 69 레인은 S. sonnei 00-207, 70 레인은 S. sonnei 00-1989, 71레인은 S. sonnei 00-2028, 72레인은 S. sonnei 00-2852, 73레인은 S. sonnei 01-2833, 74 레인은 S. Senftenberg 93-337, 75 레인은 S. Senftenberg 93-338을 나타낸다. In FIG. 5, lane M is 100bp standard marker, lane 61 is S. sonnei 99-2497, lane 62 is S. sonnei 99-2969, lane 63 is S. sonnei 99-2733, lane 64 is S. sonnei 99 -3087, 65 lane S. sonnei 99-3093, 99-3095 66 lane S. sonnei, S. sonnei 99-4263 67 lanes, lane 68 S. sonnei 99-6087, 69 lane S. sonnei 00 -207, 70 lanes S. sonnei 00-1989, 71 lanes S. sonnei 00-2028, 72 lanes S. sonnei 00-2852, 73 lanes S. sonnei 01-2833, 74 lanes S. sonfti 93 Lanes -337, 75 represent S. Senftenberg 93-338.

도 6에서 M 레인은 100bp 표준 마커(marker), 76 레인은 S. Enteritidis 97-299, 77 레인은 S. Enteritidis 97-333 , 79 레인은 S. Montevideo 01-1792, 80 레인은 S. Montevideo 01-2182, 81 레인은 S. Enteritidis 02-2072, 83 레인은 S. Suberu 04-14304, 85 레인은 S. Enteritidis 04-17563을 나타낸다.In Figure 6, M lane is 100bp standard marker, 76 lanes are S. Enteritidis 97-299, 77 lanes are S. Enteritidis 97-333, 79 lanes are S. Montevideo 01-1792, and 80 lanes are S. Montevideo 01 Lanes 2182, 81 represent S. Enteritidis 02-2072, lane 83 represent S. Suberu 04-14304, and lane 85 represent S. Enteritidis 04-17563.

ESBL 세트 1 및 ESBL 세트 2를 이용한 PCR 증폭 산물 확인 결과 모두 기존 유형과 같은 결과를 보였고 이 가운데 21주에서는 본 발명에 의한 세트 2에 의해 기존의 실험을 통해 밝혀진 유형 외에 ESBL 암호화 유전자를 추가로 탐색 분류할 수 있었다 (표 2, 3, 4, 5, 6 참조). 표 2는 Enetrobacter cloacea 균주의 ESBL　유형 확인 결과를 나타내고, 표 3은 Escherichia coli 균주의 ESBL　유형 확인 결과를 나타내고, 표 4는 Shigella spp. 균주의 ESBL　유형 확인 결과를 나타내고, 표 5는 Salmonella spp. 균주의 ESBL　유형 확인 결과이며, 표 6은 Klepsiella pneumoniae 균주의 ESBL　유형 확인 결과를 나타낸다. 본 발명에 의한 멀티플렉스 PCR 기법은 실험 시간도 약 4시간만이 소요되어, 기존의 진단 및 분류 방법보다 시간적, 경제적으로 훨씬 우수한 방법으로 확인되었다. 참고로 표 2 - 표 6에서 ESBL set 1은 본 발명자들의 선발명에 의한 TEM, CMY, CTX-M, OXA, SHV형을 검출용 프라이머세트를 나타내고, ESBL set 2는 본원발명에 의한 CMYII, CTX-MI, CTX-MII, DHA형 검출용 프라이머세트를 나타낸다.The results of PCR amplification products using ESBL set 1 and ESBL set 2 showed the same results as the existing types, and among these, 21 weeks, the ESBL encoding gene was additionally searched in addition to the type identified by the existing experiment by set 2 according to the present invention. Could be classified (see Tables 2, 3, 4, 5, 6). Table 2 shows Enetrobacter The ESBL type confirmation result of cloacea strain is shown, Table 3 shows Escherichia coli strain ESBL type confirmation results are shown, Table 4 shows Shigella spp. It shows the ESBL type confirmation result of the strain, Table 5 shows Salmonella spp. ESBL type confirmation result of the strain, Table 6 shows the ESBL type confirmation result of the Klepsiella pneumoniae strain. The multiplex PCR technique according to the present invention requires only about 4 hours of experiment time, and has been confirmed to be much better in terms of time and economy than conventional diagnostic and classification methods. For reference, in Tables 2 to 6, ESBL set 1 indicates primer sets for detecting TEM, CMY, CTX-M, OXA, and SHV types according to the inventors' selection, and ESBL set 2 indicates CMYII and CTX according to the present invention. A primer set for detecting -MI, CTX-MII, and DHA types is shown.

Year  Year No.  No. Strain  Strain 기존 확인 유형  Legacy verification type Multiplex PCR을 이용한 유형 확인Type Identification Using Multiplex PCR ESBL set 1 ESBL set 1 ESBL set 2ESBL set 2 20042004 04-16304-163 E. E. cloaceacloacea SHVSHV 20052005 05-17205-172 E. E. cloaceacloacea SHVSHV SHV SHV CMYCMY IIII 20052005 05-19905-199 E. E. cloaceacloacea SHVSHV

Year  Year No.  No. Strain  Strain 기존 확인 유형  Legacy verification type Multiplex PCR을 이용한 유형 확인Type Identification Using Multiplex PCR ESBL set 1ESBL set 1 ESBL set 2 ESBL set 2 20012001 01-00301-003 E. E. colicoli TEMTEM TEM TEM 20012001 01-00401-004 E. E. colicoli TEMTEM TEM TEM 2001 2001 01-018 01-018 E. E. colicoli TEM TEM TEM, OXA TEM, OXA 2001 2001 01-035 01-035 E. E. colicoli TEM, DHA TEM, DHA TEM TEM DHADHA 2001 2001 01-132 01-132 E. E. colicoli CTX, TEM CTX, TEM CTX, TEM CTX, TEM 2001 2001 01-245 01-245 E. E. colicoli CTX, TEM CTX, TEM CTX, TEM CTX, TEM 2002 2002 02-211 02-211 E. E. colicoli CTX, SHV, TEM CTX, SHV, TEM CTX, SHV, TEM CTX, SHV, TEM 2002 2002 02-542 02-542 E. E. colicoli CMY CMY CMY, CTX , OXA, TEM CMY, CTX , OXA, TEM 2003 2003 03-034 03-034 E. E. colicoli SHV SHV SHV SHV 2003 2003 03-038 03-038 E. E. colicoli SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2003 2003 03-252 03-252 E. E. colicoli SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2004 2004 04-128 04-128 E. E. colicoli CTX CTX CTX, OXA , CMY CTX, OXA , CMY CMYCMY IIII

Year   Year No.   No. Strain   Strain 기존 확인 유형   Legacy verification type Multiplex PCR을 이용한 유형 확인 Type Identification Using Multiplex PCR ESBL set 1 ESBL set 1 ESBL set 2ESBL set 2 19991999 99-29299-292 S. S. sonneisonnei CTX, TEMCTX, TEM CTX, TEM CTX, TEM 1999 1999 99-511 99-511 S. S. sonneisonnei TEM TEM TEM TEM 1999 1999 99-845 99-845 S. S. sonneisonnei TEM TEM TEM TEM 1999 1999 99-1497 99-1497 S. S. sonneisonnei TEM TEM TEM TEM 1999 1999 99-1503 99-1503 S. S. sonneisonnei TEM TEM TEM TEM 1999 1999 99-1505 99-1505 S. S. sonneisonnei TEM TEM TEM, OXA , CMY TEM, OXA , CMY CTXCTX I  I 1999 1999 99-2495 99-2495 S. S. sonneisonnei TEM TEM TEM TEM 1999 1999 99-2496 99-2496 S. S. sonneisonnei TEM TEM TEM TEM 1999 1999 99-2497 99-2497 S. S. sonneisonnei TEM TEM TEM TEM CMYCMY IIII 1999 1999 99-2696 99-2696 S. S. sonneisonnei TEM TEM TEM TEM 1999 1999 99-2733 99-2733 S. S. sonneisonnei TEM TEM TEM TEM CMYCMY IIII 1999 1999 99-3087 99-3087 S. S. sonneisonnei TEM TEM TEM TEM 1999 1999 99-3093 99-3093 S. S. sonneisonnei TEM TEM TEM TEM CMYCMY IIII 1999 1999 99-3095 99-3095 S. S. sonneisonnei TEM TEM TEM TEM CMYCMY IIII 1999 1999 99-4263 99-4263 S. S. sonneisonnei TEM TEM TEM TEM 1999 1999 99-6087 99-6087 S. S. sonneisonnei CMY CMY CMY CMY 2000 2000 00-207 00-207 S. S. sonneisonnei TEM TEM TEM TEM CMYCMY IIII 2000 2000 00-1989 00-1989 S. S. sonneisonnei CTX, TEM CTX, TEM CTX, TEM CTX, TEM CMYCMY IIII 2000 2000 00-2028 00-2028 S. S. sonneisonnei CTX CTX CTX, TEM CTX, TEM CMYCMY IIII 2000 2000 00-2852 00-2852 S. S. sonneisonnei TEM TEM TEM, CTX TEM, CTX 2001 2001 01-2833 01-2833 S. S. sonneisonnei TEM TEM TEM TEM

Year Year No.  No. Strain  Strain 기존 확인 유형   Legacy verification type Multiplex PCR을 이용한 유형 확인   Type Identification Using Multiplex PCR ESBL set 1 ESBL set 1 ESBL set 2ESBL set 2 19931993 93-33793-337 S. Senftenberg S. Senftenberg OXA OXA OXA, CMY OXA, CMY 1993 1993 93-338 93-338 S. Senftenberg S. Senftenberg OXA OXA OXA, CMY OXA, CMY 1997 1997 97-299 97-299 S. Enteritidis S. Enteritidis TEM TEM TEM TEM 1997 1997 97-333 97-333 S. Enteritidis S. Enteritidis TEM TEM TEM TEM 2001 2001 01-1792 01-1792 S. Montevideo S. Montevideo TEM TEM TEM TEM DHADHA 2001 2001 01-2182 01-2182 S. Montevideo S. Montevideo TEM TEM TEM TEM DHADHA 2002 2002 02-2072 02-2072 S. Enteritidis S. Enteritidis TEM TEM TEM TEM DHADHA 2004 2004 04-14304 04-14304 S. Suberu S. Suberu TEM TEM TEM TEM DHADHA 2004 2004 04-17563 04-17563 S. Enteritidis S. Enteritidis TEM, OXA, SHV TEM, OXA, SHV TEM, OXA, SHV, CMY TEM, OXA, SHV, CMY

Year   Year No.   No. Strain   Strain ESBL Type   ESBL Type Multiplex PCR을 이용한 유형 확인 Type Identification Using Multiplex PCR ESBL set 1 ESBL set 1 ESBL set 2ESBL set 2 20012001 01-01301-013 K.K. pneumoniaepneumoniae TEMTEM 2001 2001 01-038 01-038 K.K. pneumoniaepneumoniae TEM TEM TEM, OXA , SHV , CMY TEM, OXA , SHV , CMY DHADHA 2001 2001 01-120 01-120 K.K. pneumoniaepneumoniae TEM TEM TEM, SHV TEM, SHV 2001 2001 01-122 01-122 K.K. pneumoniaepneumoniae TEM, DHA TEM, DHA TEM TEM DHADHA 2001 2001 01-123 01-123 K.K. pneumoniaepneumoniae CMY, TEM CMY, TEM CMY, TEM, SHV CMY, TEM, SHV 2001 2001 01-162 01-162 K.K. pneumoniaepneumoniae SHV, CMY SHV, CMY SHV, CMY, OXA SHV, CMY, OXA 2001 2001 01-171 01-171 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2001 2001 01-197 01-197 K.K. pneumoniaepneumoniae CTX, TEM CTX, TEM CTX, TEM, SHV CTX, TEM, SHV 2001 2001 01-221 01-221 K.K. pneumoniaepneumoniae SHV SHV SHV SHV 2001 2001 01-250 01-250 K.K. pneumoniaepneumoniae SHV SHV SHV SHV 2002 2002 02-065 02-065 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2002 2002 02-199 02-199 K.K. pneumoniaepneumoniae CTX, TEM CTX, TEM CTX, TEM, SHV CTX, TEM, SHV 2002 2002 02-219 02-219 K.K. pneumoniaepneumoniae CTX, TEM CTX, TEM CTX, TEM, SHV CTX, TEM, SHV 2002 2002 02-475 02-475 K.K. pneumoniaepneumoniae SHV, CMY SHV, CMY SHV, CMY, OXA SHV, CMY, OXA 2002 2002 02-514 02-514 K.K. pneumoniaepneumoniae CTX, TEM CTX, TEM CTX, TEM, SHV CTX, TEM, SHV 2002 2002 02-581 02-581 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM, CTX SHV, TEM, CTX 2002 2002 02-696 02-696 K.K. pneumoniaepneumoniae TEM, DHA TEM, DHA TEM、SHV , CTX TEM, SHV , CTX DHADHA 2003 2003 03-028 03-028 K.K. pneumoniaepneumoniae SHV SHV SHV SHV 2003 2003 03-063 03-063 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2003 2003 03-094 03-094 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2003 2003 03-127 03-127 K.K. pneumoniaepneumoniae TEM TEM TEM, SHV TEM, SHV 2003 2003 03-137 03-137 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2003 2003 03-147 03-147 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2003 2003 03-167 03-167 K.K. pneumoniaepneumoniae TEM TEM TEM, SHV TEM, SHV 2003 2003 03-186 03-186 K.K. pneumoniaepneumoniae SHV, CMY SHV, CMY SHV, CMY, OXA , TEM SHV, CMY, OXA , TEM 2003 2003 03-189 03-189 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2003 2003 03-222 03-222 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2003 2003 03-241 03-241 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2004 2004 04-030 04-030 K.K. pneumoniaepneumoniae SHV SHV SHV SHV 2004 2004 04-074 04-074 K.K. pneumoniaepneumoniae SHV, TEM SHV, TEM SHV, TEM SHV, TEM 2004 2004 04-083 04-083 K.K. pneumoniaepneumoniae TEM, DHA TEM, DHA TEM, SHV TEM, SHV DHADHA 2004 2004 04-105 04-105 K.K. pneumoniaepneumoniae SHV SHV SHV SHV 2005 2005 05-048 05-048 K.K. pneumoniaepneumoniae SHV, DHA SHV, DHA SHV SHV DHADHA 2005 2005 05-075 05-075 K.K. pneumoniaepneumoniae SHV SHV SHV SHV 2005 2005 05-089 05-089 K.K. pneumoniaepneumoniae SHV SHV SHV SHV 2005 2005 05-093 05-093 K.K. pneumoniaepneumoniae TEM TEM TEM TEM 2005 2005 05-224 05-224 K.K. pneumoniaepneumoniae TEMTEM , , SHVSHV DHADHA

상술한 바와 같이 본 발명에 따른 4종의 프라이머세트들은 공통의 PCR 조건을 가지고 있어 1회의 PCR 반응에 동시에 적용하는 것이 가능하여, 이들 4종의 프라이머세트들을 모두 동시에 이용하는 본 발명에 의한 멀티플렉스 PCR 기법은 1회의 PCR을 수행함으로써 분리된 CMYII, CTX-MI, CTX-MII, DHA형 4종의 ESBL를 정확하고 신속하게 진단하고 동시에 유형 분류할 수 있는 효과를 도모할 수 있다.As described above, the four primer sets according to the present invention have a common PCR condition, so that they can be simultaneously applied to one PCR reaction, and thus multiplex PCR according to the present invention using all four primer sets simultaneously. The technique can achieve the effect of accurately and quickly diagnosing and simultaneously classifying four types of ESBL separated CMYII, CTX-MI, CTX-MII and DHA by performing one PCR.

따라서 본 발명은 항균제 내성 보유 병원체의 전파를 조기에 차단할 수 있고 신속하고 정확한 감염증 치료제 처방에 매우 유용한 발명이라 할 수 있다. Therefore, the present invention can block the spread of antimicrobial agent-resistant pathogens early and can be said to be a very useful invention for the rapid and accurate treatment of infectious agents.

서열목록 전자파일 첨부 Attach sequence list electronic file  

Claims (8)

기질확장형 β-락타마제(Extended Spectrum Beta Lactamase; ESBL) 검출 및 분류를 위한 멀티플렉스 PCR 기법에 있어서,In the multiplex PCR technique for the detection and classification of Extended Spectrum Beta Lactamase (ESBL), ESBL 중 CMY II (세파마이신(Cephamycin) 내성 유형 II), CTX-MI(세포탁심(Cefotaxime) 내성 유형-MI), CTX-MII(세포탁심(Cefotaxime) 내성 유형-MII), DHA(다하란(Daharan)) 유전자의 2 이상의 표적서열을 다음 프라이머세트로 이루어진 그룹으로부터 선택되는 2 이상의 PCR 프라이머세트를 사용하여 검출 및 분류함을 특징으로 하는 ESBL 검출 및 분류를 위한 멀티플렉스 PCR 기법;CMY II (Cephamycin Resistance Type II), CTX-MI (Cefotaxime Resistance Type-MI), CTX-MII (Cefotaxime Resistance Type-MII), DHA (DHARAN) in ESBL Daharan)) multiplex PCR technique for ESBL detection and classification, characterized in that detecting and classifying two or more target sequences of genes using two or more PCR primer sets selected from the group consisting of: (a) 서열번호 1 및 서열번호 2의 염기서열을 갖는 CMY II 검출을 위한 PCR용 프라이머세트;(a) a primer set for PCR for detecting CMY II having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2; (b) 서열번호 3 및 서열번호 4의 염기서열을 갖는 CTX-MI 검출을 위한 PCR용 프라이머세트;(b) a primer set for PCR for detecting CTX-MI having a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4; (c) 서열번호 5 및 서열번호 6의 염기서열을 갖는 CTX-MII 검출을 위한 PCR용 프라이머세트; 및(c) a primer set for PCR for detecting CTX-MII having the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6; And (d) 서열번호 7 및 서열번호 8의 염기서열을 갖는 DHA 검출을 위한 PCR용 프라이머세트.(d) PCR primer set for detecting DHA having the nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8. 삭제delete 삭제delete 삭제delete 삭제delete 다음 프라이머세트로 이루어진 그룹으로부터 선택되는 2 이상의 PCR 프라이머세트를 포함하는 기질확장형 β-락타마제(Extended Spectrum Beta Lactamase; ESBL) 진단 및 분류 키트;Extended Spectrum Beta Lactamase (ESBL) diagnostic and classification kits comprising two or more PCR primer sets selected from the group consisting of the following primer sets; (a) 서열번호 1 및 서열번호 2의 염기서열을 갖는 CMY II (세파마이신(Cephamycin) 내성 유형 II) 검출을 위한 PCR용 프라이머세트;(a) a primer set for PCR for detecting CMY II (Cephamycin resistance type II) having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2; (b) 서열번호 3 및 서열번호 4의 염기서열을 갖는 CTX-MI(세포탁심(Cefotaxime) 내성 유형-MI) 검출을 위한 PCR용 프라이머세트;(b) a primer set for PCR for detecting CTX-MI (Cefotaxime resistance type-MI) having the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4; (c) 서열번호 5 및 서열번호 6의 염기서열을 갖는 CTX-MII(세포탁심(Cefotaxime) 내성 유형-MII) 검출을 위한 PCR용 프라이머세트; 및 (c) a primer set for PCR for detecting CTX-MII (Cefotaxime resistance type-MII) having the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6; And (d) 서열번호 7 및 서열번호 8의 염기서열을 갖는 DHA(다하란(Daharan)) 검출을 위한 PCR용 프라이머세트.(d) A primer set for PCR for detecting DHA (Daharan) having a nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8. 제1항에 있어서, 상기 멀티플렉스 PCR 기법은The method of claim 1, wherein the multiplex PCR technique is 10X PCR 완충용액 2.5㎕, dNTP 4㎕, (a) 내지 (d)에 기재된 각 유형의 19pM/㎕의 표적용 프라이머 4세트를 0.5㎕씩, Ex Taq 중합효소 0.5㎕ 넣은 후 최종 반응액 25㎕을 구성되는 것을 특징으로 하는 ESBL 검출 및 분류를 위한 멀티플렉스 PCR 기법.2.5 μl of 10 × PCR buffer, 4 μl of dNTP, and 4 sets of target primers of 19 pM / μl of each type described in (a) to (d), 0.5 μl of Ex Taq polymerase, and 25 μl of final reaction solution. Multiplex PCR technique for ESBL detection and classification, characterized in that the configuration. 제1항 또는 제7항에 있어서, 반응과정은 94℃에서 5분간 변성시킨 후 반응은 94℃ 1분, 61℃ 1분, 72℃ 1분을 한 주기로 30 사이클(cycle) 조건으로 증폭하는 것을 특징으로 하는 ESBL 검출 및 분류를 위한 멀티플렉스 PCR 기법.According to claim 1 or 7, wherein the reaction process is denatured at 94 ℃ 5 minutes, the reaction is 94 ℃ 1 minute, 61 ℃ 1 minute, 72 ℃ 1 minute to amplify 30 cycles (cycle) conditions in one cycle Characterized Multiplex PCR Technique for ESBL Detection and Classification.
KR1020060117766A 2006-11-27 2006-11-27 Multiplex pcr method for rapid classification of esbl and pcr primer therefor KR100824413B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020060117766A KR100824413B1 (en) 2006-11-27 2006-11-27 Multiplex pcr method for rapid classification of esbl and pcr primer therefor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020060117766A KR100824413B1 (en) 2006-11-27 2006-11-27 Multiplex pcr method for rapid classification of esbl and pcr primer therefor

Publications (1)

Publication Number Publication Date
KR100824413B1 true KR100824413B1 (en) 2008-04-23

Family

ID=39572303

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020060117766A KR100824413B1 (en) 2006-11-27 2006-11-27 Multiplex pcr method for rapid classification of esbl and pcr primer therefor

Country Status (1)

Country Link
KR (1) KR100824413B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100245951B1 (en) 1994-12-27 2000-04-01 Lg Chemical Ltd Process for the selection of tem-like beta-lactamase-producing strains by using of polymerase chain reaction
KR20020065807A (en) * 2001-02-07 2002-08-14 (주)디스진 Genotyping kit for selecting antibiotics resistant bacteria
US20030219749A1 (en) 2002-05-17 2003-11-27 Creighton University Multiplex PCR for the detection of ampC beta-lactamase genes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100245951B1 (en) 1994-12-27 2000-04-01 Lg Chemical Ltd Process for the selection of tem-like beta-lactamase-producing strains by using of polymerase chain reaction
KR20020065807A (en) * 2001-02-07 2002-08-14 (주)디스진 Genotyping kit for selecting antibiotics resistant bacteria
US20030219749A1 (en) 2002-05-17 2003-11-27 Creighton University Multiplex PCR for the detection of ampC beta-lactamase genes

Similar Documents

Publication Publication Date Title
AU2008242250B2 (en) Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
Stobberingh et al. Occurrence of extended-spectrum betalactamases (ESBL) in Dutch hospitals
Vo et al. Antibiotic resistance, integrons and Salmonella genomic island 1 among non-typhoidal Salmonella serovars in The Netherlands
US20090239758A1 (en) Methods, microarray, and kits for detection of drug resistance genes in gram-negative bacteria
WO2018074762A1 (en) Quantamatrix assay platform-based diagnostic method and kit capable of detecting and identifying gram-positive and gram-negative bacteria and candida species and determining resistance to antibiotics simultaneously
EP2714939B1 (en) Detection of methicillin-resistant staphylococcus aureus
CN105121656A (en) PCR reaction mixtures and methods of using same
KR100741375B1 (en) - Multiplex PCR method for rapid classification of ESBL and PCR primer for PCR method
JP2013255492A (en) Composition for clostridium difficile strain detection, and method for clostridium difficile strain detection using the same
KR101775406B1 (en) A method for detecting both Antibiotic resistance related genes and gram negative bacteria and A composition therefor
Hem et al. Genomic analysis of Elizabethkingia species from aquatic environments: Evidence for potential clinical transmission
US6355435B1 (en) Methods for detecting and enumerating Campylobacter jejuni in environmental samples and for identifying antibiotic-resistant strains
EP3449010A1 (en) Method for detecting carbapenemase-producing bacteria
EP2633082B1 (en) Rapid salmonella serotyping assay
KR100824413B1 (en) Multiplex pcr method for rapid classification of esbl and pcr primer therefor
KR102110408B1 (en) Primer Set for Loop mediated Isothermal Amplification Reaction for Detecting Carbapenemase Producing Enterobacteriaceae and Uses Thereof
US20170327872A1 (en) Detection method
Zhu et al. A locked nucleic acid (LNA)-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture
EP2231866B1 (en) Methods and oligonucleotides for detection of mastitis causing bacteria
KR102635143B1 (en) PCR primer set for detecting Salmonella serovars and uses thereof
KR101981494B1 (en) Method for Detecting and Discriminating Vibrio Bacteria Using Multiplex PCR
Turng et al. Detection of Extended Spectrum Beta-Lactamase Among Enterobacteriaceae Using Phoenix™ Automated Microbiology System with BDXpert™ System
KR102463622B1 (en) Composition for detecting antibiotic resistant pathogen of sepsis and uses thereof
Van Ginkel Molecular characterisation of the multi-antibiotic resistant bacteria, Klebsiella Pneumoniae isolated from nosocomial infections
Faghihi et al. Detection of plasmid-mediated AmpC β-lactamases in Klebsiella pneumoniae clinical isolates from Bushehr province, Iran

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant