KR100803330B1 - Method for modifying the morphology of plants by controlling the level of LNG2 in cell - Google Patents

Abstract

A method for modifying the morphology of a plant is provided to obtain a hetero-plant with the modified morphology such as leaves, flowers, hypocotyls, silique, and seed tissue. A method for modifying the morphology of a plant or controlling the growth of a plant cell comprises a step of controlling the level of a polypeptide in a cell having an amino acid sequence described as SEQ ID : NO. 1 by increasing or decreasing the expression of a polynucleotide encoding the polypeptide and having a sequence described as SEQ ID : NO. 2 where the plant is selected from the group consisting of Arabidopsis thaliana, Brassica campestris subsp. napus var. pekinensis, Brassica oleracea var. capitata, Brassica juncea, Brassica campestris subsp. napus var. nippo-oleifera, Raphanus sativus, Brassica napobrassica, Brassica rapa/Brassica campestris, tricale, Brassica oleracea var. botrytis, Brassica oleracea var. italica, Capsella bursa-pastoris, Cardamine flexuosa, Arabis glabra, Draba nemorosa var. hebecarpa, Brassica juncea, Brassica napus, Brassica oleracea, Brassica caulorapa, Brassica fimbriata, Brassica ruvo, Brassica septi-ceps, Brassica nigra, Cochlearia officinalis, Armoracia lapathifolia, Descurainia pinnata, and Aubrieta deltoidea and the plant cell is a cell of a plant tissue selected from the group consisting of leaves, flowers and seeds. A method for preparing a morphology modified plant cell comprises a step of introducing the polynucleotide encoding the polypeptide having the amino acid sequence described as SEQ ID : NO. 1 into the plant cell.

Description

Method for modifying the morphology of plants by controlling the level of LNG2 in cell}

The present invention relates to a method for changing a plant's morphology by adjusting the intracellular level of LNG2, and more particularly, to adjust the intracellular level of a polypeptide having an amino acid sequence represented by SEQ. It is about how to change.

Plants are largely composed of roots, stems, leaves of nutritional organs and flowers, seeds (seeds), fruit reproductive organs, they form a certain external structure (external structure) or shape to form the plant.

The most important factor in determining the shape of the plant is the leaf part of the plant. The leaves of the plant are repeatedly produced at the periphery of the shoot apical meristem, and they have various shapes such as round shape, pointed shape, spiral shape or heart shape or sawtooth shape. It is an institution with various appearances. The shape of these leaves is closely related to the environmental and ecological status at which the plant can grow, how various leaf forms exist within the same species or similar species, and how they are determined by the interaction of different genes, and This is a good place to study how interactions have changed during evolution.

Furthermore, because flower organs such as petals and calyxes also exhibit various characteristics of leaf development, they are thought to undergo developmental processes similar to those of leaf development, so understanding the development of leaves can be used to understand the overall process of plant morphogenesis. Provide an important foundation.

However, due to the large number of factors that act when the leaves develop and the complex interactions between these factors, the development process of the leaves is not yet clearly understood.

To date, leaf primordia are formed in the periphery of the shoot apical meristem, and in the proximodistal axis (proximal-base) and equalization during the morphogenesis process. It has been found that three major axes, the dorsiventral axis (adaxial-abaxial) and the mediolateral axis, are established and eventually elongate to the final shape and size of the leaves (Sinha et al., 1999). Ann.Rev. Plant Physiol.Plant Mol.Biol., 50, 419-446; Bowman et al., 2002, Development, 126, 2387-2396; Kim and Cho, 2006, Physiologia Plantarum 126: 494-502).

Each of these processes is a complex process in which many genetic elements interact with each other, and to date, Group I Knotted-like homeobox ( KNOX ) such as KNAT1 , KNAT2 , KNAT6 and STM involved in foliar formation (Jackson et al. , 1994, Development, 120, 405-413 ), PHAN (PHANTASTICA), corn RS2 (ROUGH of snapdragon (antirrhinum) SHEATH 2 ), AS1 ( ASSYMETRIC) MYB genes such as LEAVES 1 ) (Waites and Hudson, 1995, Development, 121, 2143-2154; Waites et al., 1998, Cell, 93, 779-789; Schneeberger et al., 1998, Development, 125, 2857- 2865; Byrne et al., 2000, Nature, 408, 21-28; Byrne et al., 2002, Development, 129, 1957-1965; Ori et al., 2000, Development, 127, 5523-5532), such as class III Ho Meo domain, which is involved in the formation of the abaxial leaf - a leucine zipper gene PHB (PHABULOSA), PHV (PHAVOLUTA ), REV (rEVOLUTA), YABBY family member of the FIL (FILAMNTOUS FLOWER), YAB3 (YABBY3), CRC (CRABS CLAW) and KANADI family members of KANI -4 (Siegfried et al, 1999 , Development, 126, 4117-4128;.. MacConnell et al, 2001, Nature, 411, 709- 713;. Otsuga et al, 2001 , Plant J., 25, 223-236) and ICK1 (cyclin-dependent kinase to inhibit the growth of leaf cells inhibitor 1 ) or KRP2 ( Kip - related protein 2 ), ROT3 or ROT4, which is involved in the longitudinal extension of the leaves, and AN ( ANGUSTIFOLIA ), which is involved in the longitudinal extension of the leaves, are known to be involved in leaf morphology (Wang et al., 2000). , Plant J., 24, 613-623; Verkest et al., 2005, Plant Cell, 17, 1723-1736; Kim et al., 1998, Genes Dev., 12, 2381-2391; Narita et al., 2004 , The Plant J., 38, 699-713; Kim et al., 2002, The EMBO J., 21, 1267-1279). Despite these findings, many factors involved in leaf morphology remain unknown.

Therefore, the present inventors conducted a study on the leaves of plants in order to find new factors involved in the formation of plants. As a result, new inventors involved in regulating the shape of tissue cells such as leaves by controlling the elongation The present invention has been completed by developing a method of finding a gene and using the same to change the shape of a plant.

Accordingly, it is an object of the present invention to provide a method of changing the shape of a plant by adjusting the intracellular level of LNG2.

Still another object of the present invention is to provide a method of controlling the growth of plant cells by adjusting the intracellular level of LNG2.

Another object of the present invention is to provide a plant with a modified form that includes cells with altered intracellular levels of LNG2.

In order to achieve the above object, the present invention provides a method of changing the shape of the plant by adjusting the level of () cells of LNG2.

In order to achieve another object of the present invention, the present invention provides a method for controlling the growth of plant cells by adjusting the intracellular level of LNG2.

In order to achieve another object of the present invention, the present invention provides a method for producing a plant having a shape changed, comprising the step of transforming the plant with a polynucleotide encoding LNG2.

In order to achieve another object of the present invention, the present invention provides a method for producing a plant cell of a changed shape comprising the step of introducing a polynucleotide encoding LNG2 to the plant cell.

In order to achieve another object of the present invention, the present invention provides a method for producing a plant with a changed form, including plant cells with altered intracellular levels of LNG2.

Hereinafter, the content of the present invention will be described in more detail.

The present invention relates to a method of changing the shape of a plant by adjusting the intracellular level of LNG2.

LNG2 of the present invention is a polypeptide consisting of 905 amino acids and is involved in the elongation of tissues such as leaves, flowers, hypocotyls, siliques and seeds of plants. This function of LNG2 was first revealed by the present inventors. LNG2 is preferably a polypeptide having the amino acid sequence of SEQ ID NO: 1.

On the other hand, the polypeptide may be a functional equivalent to the polypeptide having an amino acid sequence represented by SEQ ID NO: 1. The term 'functional equivalent' refers to a sequence homology with at least 60%, preferably 70%, more preferably 80% or more of the amino acid sequence represented by SEQ ID NO. 1 as a result of the addition, substitution or deletion of amino acids. The polypeptide which exhibits substantially homogeneous activity with LNG1 of this invention. Here, "substantially homogeneous activity" means taking part in the determination of the shape of the plant, in particular in the longitudinal extension of the plant tissue. Such functional equivalents include amino acid sequence variants in which some of the amino acids of the amino acid sequence represented by SEQ ID NO: 1 have been substituted, deleted or added. Substitutions of amino acids are preferably conservative substitutions. Examples of conservative substitutions of amino acids present in nature are as follows; Aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of amino acids is preferably located in portions not directly involved in the activity of LNG1 of the present invention. The functional equivalents also include polypeptide derivatives in which some chemical structures of the polypeptide have been modified while maintaining the basic backbone of LNG1 and its physiological activity. For example, fusion proteins made by fusion with other proteins, such as GFP, while maintaining structural alterations and physiological activities to alter the stability, shelf life, volatility or solubility of the polypeptides of the present invention.

In the present invention, the form of the plant represents the external structure or shape of the plant, and represents the shape of each of the plant tissues or organs such as leaves, stems, roots, and flowers, and the overall shape of the plant. In the present invention, since the length and width of part or the entirety of the tissues and organs are mainly changed according to the intracellular level of the polypeptide of SEQ ID NO: 1, the change of the shape of the plant is mainly leaf, stem, root, It shows with the change of the length and width of each part or whole of the tissue of a plant, such as a flower.

The 'intracellular level' refers to the amount present in the cell, which can be adjusted by various methods known to those skilled in the art. For example, but not limited to, intracellular levels can be regulated through regulation at the transcriptional stage or regulation at the post-transcriptional stage. Modulation at the transcriptional stage is a method for enhancing the expression of a gene known to those skilled in the art, for example, by producing a recombinant expression vector linking a gene encoding SEQ ID NO: 1 to a promoter to enhance the expression of the gene or Inserting an expression control sequence to enhance the expression of the gene in the vicinity of the gene encoding SEQ ID NO: 1, or a method for inhibiting the expression of the gene, for example, promoter activity by inducing mutation of a promoter or gene region Or a method of inhibiting the function of a protein, a method of expressing an antisense gene, a RNAi or a microRNA method.

The term 'promoter' refers to a DNA sequence that regulates the expression of a nucleic acid sequence operably linked in a particular host cell. 'Operably linked' means that one nucleic acid fragment is combined with another nucleic acid fragment. Its function or expression is affected by other nucleic acid fragments. In addition, it may further comprise any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. The promoter may be a promoter (constitutive promoter) to induce the expression of the target gene at all times at all times or a promoter (inducible promoter) to induce the expression of the target gene at a specific position, time, for example SV40 Promoter, CMV promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108: 193-199, 1991; Monahan et al., Gene Therapy , 7: 24-30, 2000 ) , CaMV 35S promoter (Odell et al ., Nature 313: 810-812, 1985), Rsyn7 promoter (US Patent Application Serial No. 08 / 991,601), rice actin promoter (McElroy et. al ., Plant Cell , 2: 163-171, 1990), ubiquitin promoter (Christensen et al ., Plant Mol . Biol . 12: 619-632, 1989) and ALS promoters (US Patent Application No. 08 / 409,297). In addition, U.S. Patents 5,608,149; The promoters disclosed in 5,608,144 5,604,121 5,569,597 5,466,785, 5,399,680 5,268,463, 5,608,142, and the like can all be used.

Modulation at the post-transcriptional stage is a method for enhancing or inhibiting protein expression known to those skilled in the art, for example, a method for enhancing or inhibiting the stability of mRNA transcribed into a template encoding a gene encoding SEQ ID NO: 1, a protein or polypeptide. It can be carried out by a method of enhancing or inhibiting the stability of or a method of enhancing or inhibiting the activity of a protein or polypeptide.

More specific examples of the method may be transformed into DNA sequences encoding RNAs that act on transcribed mRNA such as group 1 intron type, M1 RNA type, hammerhead type, hairpin type or microRNA type. In addition, couppression may be induced through transformation of DNA having a sequence identical or similar to a target gene sequence.

Preferably in the present invention, adjusting the intracellular level of the polypeptide of SEQ ID NO: 1 may be carried out by a method of increasing or decreasing the expression of the polynucleotide encoding the polypeptide. The method of increasing or decreasing each may use methods known to those skilled in the art, for example, by preparing a recombinant expression vector connecting a polynucleotide encoding the polypeptide of SEQ ID NO: 1 to a promoter to enhance its expression, It is possible to prepare a recombinant expression vector linking an antisense polynucleotide for the polynucleotide to a promoter to reduce its expression. At this time, the polynucleotide may preferably have a nucleotide sequence represented by SEQ ID NO: 2.

LNG2 of the present invention is to be extended in the longitudinal direction (root axis) of the plant cell when overexpression, and the length of the width direction (left and right axis) of the plant cell is relatively reduced. In addition, when the expression of the LNG2 protein of the present invention is reduced or inhibited, the elongation in the longitudinal direction of the plant cells is reduced, so that the length in the width direction is relatively increased. Due to the change in the length of the plant cell in the longitudinal direction or the width direction of the plant tissue consisting of the changed plant cells and further the length of the plant is changed to change the shape of the plant.

The plants are Arabidopsis, cabbage, cabbage, mustard, rape (rapeseed), radish, Homu ( Brassica napobrassica), turnip (Brassica rapa / Brassica campestris), tree, kale, cauliflower, broccoli, horseradish, wasabi Stork pole herbs, kkotdaji, sanggat (Brassica juncea ), brassica napus ), Brassica oleracea ( Brassica oleracea), kohlrabi (Brassica caulorapa), Brassica Pim other Calabria (Brassica fimbriata), Brassica rubo (Brassica ruvo), Brassica septi kepseu (Brassica septi - ceps ), black mustard ( Brassica nigra ), Cochlearia Officinalis officinalis ), Mustard Radish ( Armoracia lapathifolia ), Descurainia pinnata ), Aubrieta deltoidea ), and the tissues affected by altered expression of LNG1 or LNG2 protein in the plant may be leaves, flowers, hypocotyls, siliques, seeds.

As described above, since the LNG2 of the present invention allows the plant cells to elongate or contract in the longitudinal direction (root axis) or the width direction (left and right axis), the present invention controls the growth of plant cells by controlling the intracellular level of LNG2. Provide a way to. The regulation of LNG2 and intracellular levels is as described above.

In addition, the present invention provides a method for producing a plant having a changed shape, comprising the step of transforming the plant with a polynucleotide encoding LNG2.

Preparation of polynucleotides for transformation can be carried out by methods known to those skilled in the art, as described above.

In the present invention, transforming a plant with a gene encoding LNG2 may be performed by transformation techniques known to those skilled in the art. Preferably, transformation method using Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, liposome mediation (liposome) mediated method, In planta transformation, Vacuum infiltration method, floral meristem dipping method, Agrobacteria spraying method. More preferably, a transformation method using Agrobacterium can be used. At this time, the polynucleotide may be in the form of a recombinant expression vector operably linked to a promoter, for example, operably linked to a promoter to be expressed in the transformed plant.

In addition, the present invention provides a method for producing a plant cell having a changed shape, including the step of introducing into a plant cell as a polynucleotide encoding LNG2.

The introduction of the polynucleotide into the plant cell may be performed by the above-described transformation technique, wherein the polynucleotide is operably linked to a promoter such as a promoter to be expressed in the introduced plant cell. It may be in the form of a recombinant expression vector operably linked with.

Plant cells into which the polynucleotide is introduced have a form in which the length in the longitudinal direction (root axis) and the width direction (left and right axis) is increased or decreased. Additionally, the plant cells may be cultured as described above to be liquid cultures, callus, plasma cultures, and differentiated to be plant tissues or plants.

Cultivation of plant cells may be carried out by any method known to those skilled in the art, such as separating a part of a plant from a mother and cultivating it aseptically under suitable conditions, such as liquid culture of tissue sections, callus culture of tissue sections, and protoplast culture. The culture conditions and methods may be carried out by conditions and methods known to those skilled in the art.

Differentiating the cultured plant cells into plants is to induce differentiation of cultured plant cells of callus, protoplast form under appropriate conditions to differentiate into plant tissues or plants. It may be carried out by the method.

In one embodiment of the present invention, a mutant Arabidopsis pellucida in which T-DNA is inserted was prepared. It was confirmed that confirm the genes involved in the length of the leaf from the produced mutant Arabidopsis and screening an elongated mutants with the naked eye, this variant phenotype results LNG1, LNG1 and showed a high homology, LNG2 to substantially the same function Could find.

Meanwhile, in another embodiment of the present invention, the characteristics of overexpression or deletion mutants of LNG1 and LNG2 were investigated. As a result, when LNG1 and LNG2 are overexpressed, the leaves, flowers, hypocotyls, siliques, and seed tissues of plants are longer in length, shorter in width in the left and right axes, and in the case of LNG1 and LNG2 deletions. The length was shortened to the axis, and the width was widened to the left and right axes, and this was confirmed to be due to the change in the length and width of the cell itself, not the change in the proliferation of the cell.

Accordingly, the present invention provides a method of changing the shape of a plant by controlling the expression of genes encoding LNG1 or LNG2 proteins.

Below. The present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the present invention, the contents of the present invention is not limited to the following examples.

< Example  1> T- DNA Of Mutant Arabidopsis Bacillus Inserted

<1-1> T- DNA  Tagging Baby Pole Line (T- DNA tagging Arabidopsis line Manufacturing

Arabidopsis thaliana (Col-0 ecotype) to insert T-DNA was grown in a greenhouse controlled at 22-24 ° C. and 16-hour light cycle, 8-hour dark cycle.

The Arabidopsis with T-DNA was inserted into pSKI1015, an activation tagging vector (Weigel et al, 2000, Plant). Physiol . , 122, 1003-1013) using Agrobacterium infected by the dipping procedure (Clough et al, 1998, Plant J. , 16, 735-743) by the following method.

That is, in the LB liquid medium containing kanamycin (100 mg / ml) (Bacto-tryptone (10 g), Bacto-Yeast extract (5 g), NaCl (10 g) in 1 L pH 7.0) (Weigel et al, 2000, Plant Physiol . , 122, 1003-1013), were incubated overnight with Agrobacterium infected with pSKI1015. The Agrobacterium culture was centrifuged to obtain only Agrobacterium, which was then suspended in dipping solution (10 mM MgCl ₂ , 0.01% Silwet L- 77 and 5% Sucrose). The immersion solution was soaked for 30-40 seconds above the Arabidopsis (Col-0 ecotype, Arabidopsis 4 weeks after seeding). It was incubated for 1 day with no vinyl in the absence of light. Thereafter, after removing the vinyl, 16 hours of dark cycle and 8 hours of dark cycle were grown again for 2-3 weeks.

Lines showing resistance to the herbicide ammonium glufosinate (Basta) were selected from the activation-tagged T-DNA insertion line.

<1-2> the length of the leaf Elongated  Isolation of Mutants

Visually separate the mutants having the length of the leaf phenotype at the height line was named this longifolia1 -1D (lng1 -1D). The lng1 -1D has had all the leaves have the form of long and narrow rather than wide in comparison to the wild-type, which was due to the long jyeotgi mainly leaves the body (leaf blade) and leaves the bag (leaf petiole). In addition, the leaves of lng1-1D were not smooth and serrate, and this phenotype was due to protruding drainage tissues rather than an increase in the number of hydathodes. In addition, as well as the leaves of lng1 -1D, was janggakgwa flowers, (silique), seeds (seed) and cotyledons (cotyledon) increase in length. In addition, the hypocotyl (hypocotyl) length of lng1 -1D jyeoteuna is slightly longer than the wild type, stem, and primary roots was not changed (see Figs. 1A to 1E and Table 1)

<1-3> lng1 -1D  Measurement of leaf elongation rate of mutant

In order to examine the dynamic variation (kinetics) of the height of the blade in lng1 -1D mutant, Example <1-1> The lng1 -1D mutants and fifth rosette of wild-type Arabidopsis thaliana (rosette) grown in the same environment as in The length and width of the leaves over time were measured. The fifth rosette leaf in Arabidopsis is used as a typical specimen of rosette leaves (Tsuge et al., 1996, Development , 122, 1589-1600).

Measurement, as shown in Figure 2 leaves the body (leaf blade), but the width of the stretching rate is initially lng1-1D mutant and wild-type are almost equal, to decrease at a faster rate than lng1 -1D mutant wild-type body, the more the width Narrow leaves were formed. Elongation rate of the length of the blade body by early increase at a faster rate than wild-type body lng1 -1D mutation to form a longer length leaf. lng1 -1D was mutants and growth is stopped on day 39 after seeded both wild-type, indicating that sikindaneun not having the mutation in lng1 -1D mutants change the height of the time development of leaf change the stretching rate.

< Example  2> Isolation of genes involved in the modified phenotype

<2-1> lng1 T- in -1D mutant DNA Of tagged gene regions

The lng1 the genomic DNA partial T-DNA is inserted in order to confirm the gene to indicate the phenotype of -1D variants were recovered from the recovered plasmid (plasmid rescue) experiment. In detail, genomic DNA was extracted from 1 g of plant samples by phenol-chloroform and dissolved in 300 μl of secondary distilled water (DDW). BamHI (BMS, USA; buffer composition: 33 mM Tris-acetate, 10 mM Magnesium-acetate, 66 mM Potassium-acetate, 0.5 mM Dithiothreitol (DTT)) and HindIII (BMS, United States; buffer composition: 10 mM) Tris-HCl, 5 mM MgCl ₂ , 100 mM NaCl, 1 mM 2-mercaptoethanol). This was treated with phenol-chloroform (1: 1) and allowed to self-ligation overnight at 14 ° C. The ligated DNA was again ethanol precipitated and then dissolved again in 50 μl of distilled water. It was transformed into recombinant-deficient E. coli SURE cells (Stratagene, USA). T-DNA insertion site was confirmed by analyzing the base sequence using the T7 promoter primer (5'-TAATACGACTCACTATAGGG-3 '; SEQ ID NO: 3) and BARSEQ primer (5'-GGGCGAATTTTGCGACAACA-3'; SEQ ID NO: 4).

As a result, the T-DNA insertion site was shown in GenBank Accession No. At5g15880 was identified as the top of 5477bp.

<2-2> lng1 -1D In LNG1  Increased expression

Northern blot analysis was performed to confirm that T-DNA was inserted to promote expression of surrounding genes.

RNA was extracted from three-week-old seedlings (seedling) using the RNeasy plant mini kit (Qiagen) according to the manufacturer's instructions. 20 μg of RNA was electrophoresed on 1.2% agarose gel and separated by size, and then transferred to a nylon membrane (Hybond-N; Amersham, USA). Pre-hybridization was performed in pre-hybrid buffer (50% formamide, 5x SSPE, 5x Denhardt's solution, 0.1% SDS and 100 μg / ml denatured salmon sperm DNA) at 42 ° C. for 1-2 h. Additional probes (25-100ng) for At5g15580, At5g15600, At5g15610 labeled with 32P-dCTP were added and hybridized overnight at 42 ° C. The hybridized membrane was subjected to twice with 2x SSC and 0.1% SDS solution for 10 minutes at room temperature, 1x with 1x SSC and 0.1% SDS solution for 15 minutes at 65 ° C and 2x with 0.1x SSC and 0.1% SDS solution for 15 minutes at 65 ° C. It was washed once. This was confirmed by a scanning densitometer (scanning densitometer, Pharmacia, USA).

At this time, each probe was isolated from the 23-day-old Arabidopsis pole using a total RNA isolation system (Qiagen, USA) according to the manufacturer's instructions, and then the isolated RNA was used as a template for At5g15580. For primers, primers of SEQ ID NO: 5 and SEQ ID NO: 6, primers of SEQ ID NO: 7 and SEQ ID NO: 8 for probes for At5g15600, primers of SEQ ID NO: 9 and SEQ ID NO: 10 for probes for At5g15610, respectively. Prepared by performing PCR. RT-PCR conditions were as follows: 94 ° C. 5 minutes; 35 repetitions of 94 ° C 30 seconds, 57 ° C 30 seconds, 72 ° C 30 seconds; 72 ° C. 10 minutes.

As a result, as can be seen in Figure 3B Jin Bank Accession No. The expression of At5g15880 was promoted, and the expression of At5g15600 and At5g15610 was not promoted.

< Example  3> LNG1  And LNG2  Genetic Characterization

<3-1> Homology  Search for proteins

Genebank Accession No. The gene of At5g15880 encodes 927 amino acids and has a sequence that is supposed to be a target signal to the nucleus. Homologous protein with no known homology with BLAST using homologous search results. GenBank Accession No. It was confirmed that the gene of At3g02170 had about 63% homology. Jin Bank Accession No. The gene At5g15880 into LONGIFOLIA1 (LNG1), and named the gene At3g02170 into LONGIFOLIA2 (LNG2).

<3-2> LNG1  And LNG2 The effect of expression on the phenotype

In order to examine whether appeared since the phenotype of the mutant was lng1 -1D expression of LNG1 increased, so that the LNG1 or LNG2 expressed by the CaMV 35S promoter and was prepared in an Arabidopsis transformant.

The LNG1 gene was cloned using the primers of SEQ ID NO: 11 and SEQ ID NO: 12, and the LNG2 gene was subjected to PCR under the following conditions using the primers of SEQ ID NO: 13 and SEQ ID NO: 14: 94 ° C. 5 minutes; 94 degreeC 30 second, 55 degreeC 30 second, 72 degreeC 2 minutes 35 repetitions, 72 degreeC 7 minutes. DNA amplified by PCR was subcloned into a pBAR vector (Xiang et al., 1999, Plant Mol. Biol. 40, 711-717) and introduced into Agrobacterium to transform Agro into which LNG1 or LNG2 can be overexpressed. Got the bacterium.

Agrobacterium infected with pBAR was incubated overnight in medium LB broth containing kanamycin (100 mg / ml) (Bacto-tryptone (10 g), Bacto-Yeast extract (5 g), NaCl (10 g) in 1 L pH 7.0). . Agrobacterium culture was centrifuged to obtain only Agrobacterium, which was then suspended in a dipping solution (10 mM MgCl ₂ , 0.01% Silwet L-77 and 5% Sucrose). The soaking solution was immersed in the ground portion of the Arabidopsis (Col-0 ecotype, Arabidopsis 4 weeks after seeding) for 30-40 seconds. It was incubated for 1 day with no vinyl in the absence of light. Thereafter, after removing the vinyl, 16 hours of dark cycle and 8 hours of dark cycle were grown again for 2-3 weeks.

As a result, similarly to the lng1 -1D mutants in seven out of a total of 15 transformants, elongated body leaves (leaf blade), longer petioles (petiole) and representation of the serrated (serrated) leaf edge (leaf margins) appears (FIG. 4A), it was found that the overexpression of LNG1 involved in the phenotype of the mutant Lng1 -1D.

Experiments with LNG2 also showed elongated leaf blades and elongated petioles in five out of a total of 18 transformants (FIG. 4B). On the other hand, the overexpression of LNG2 showed no phenotype of serrated leaf margins, indicating that LNG1 and LNG2 had different but overlapping functions.

As a result, it can be seen that LNG1 and LNG2 are involved in regulating leaf morphology by promoting cell elongation in the longitudinal direction. On the other hand, plants with no change in phenotype among the transformants inserted with T-DNA are thought to be because the inserted T-DNA enters different positions in the chromosome and thus overexpression is not effectively induced.

<3-3> LNG1  And LNG2 Expression patterns

In order to examine the physiological functions of LNG1 and LNG2, the expression patterns of the respective promoters of LNG1 and LNG2 were examined. For this purpose, a transformant plant is prepared by attaching the GUS gene to the bottom of each promoter of LNG1 and LNG2, and then the expression level of GUS is expressed in each tissue such as leaf bag, leaf body and root of floral organ of the transformant. Investigate.

PCR was performed using primers of SEQ ID NO: 15 and SEQ ID NO: 16 for the LNG1 promoter and primers of SEQ ID NO: 17 and SEQ ID NO: 18 for the LNG2 promoter: 94 ° C. 5 min; 94 degreeC 30 second, 55 degreeC 30 second, 72 degreeC 2 minutes 35 repetitions, 72 degreeC 7 minutes. In order to replace the 35S promoter region of pBAR-GUS, the primers each have a Pst I forward primer and a Bam HI restriction site. PCR amplified DNA was digested with Ps tI and Bam HI restriction enzymes to connect the pBAR-GUS from which the 35S promoter was removed to prepare a recombinant vector, which was then introduced into Agrobacterium to obtain a transformed Agrobacterium. .

That is, pBAR-infected Agrobacterium overnight in medium LB liquid medium (Bacto-tryptone (10g), Bacto-Yeast extract (5g), NaCl (10g) in 1L pH 7.0) containing kanamycin (100mg / ml) Incubated. Agrobacterium culture was centrifuged to obtain only Agrobacterium, which was then suspended in a dipping solution (10 mM MgCl ₂ , 0.01% Silwet L-77 and 5% Sucrose). The soaking solution was immersed in the ground portion of the Arabidopsis (Col-0 ecotype, Arabidopsis 4 weeks after seeding) for 30-40 seconds. It was incubated for 1 day with no vinyl in the absence of light. Thereafter, after removing the vinyl, it was grown again for 2-3 weeks at 16 hours of dark cycle and 8 hours of dark cycle.

GUS staining was performed by Jefferson et al. (Jefferson et al., 1987, EMBO J , 6, 3901-3907). Briefly described as follows. Plant tissues were treated with substrate solution (100 mM sodium phosphate, pH 7), 10 mM EDTA, 0.1% Triton X-100, 0.5 mg / ml 5-bromo-4-chloro-3-indolyl β-D gluronic acid (X- Gluc), 100 μg / ml chloramphenicol, 2 mM potassium ferricyanide and 2 mM potassium ferrocyanide). It was incubated overnight at 37 ° C. and then washed with 80% ethanol for several days. Stained plant tissue was observed under a microscope.

As a result, GUS was strongly expressed in the petiole, especially at the base of the petiole (Fig. 5B, F), and GUS was expressed in all parts in the leaf, especially in the vein part (Fig. 5C, G). These results suggest that LNG1 and LNG2 are expressed in various tissues of the Arabidopsis, where they regulate cell elongation.

< Example  4> LNG1  And LNG2 Overexpression or deletion of Variant  Characteristic investigation

<4-1> LNG1  And LNG2 Of fruit ( loss - of - function ) Mutants

Loss-of-function mutants of LNG1 and LNG2 were obtained from the SALK Institute Genomic Analysis Laboratory. The LNG1 deletion mutants were called lng1-2 (salk_107002) and lng1-3 (salk_135585), and the LNG2 deletion mutants were called lng2-1 (salk_067658) and lng2-2 (salk_034645).

In order to confirm whether the mutant is actually a loss-of-function mutant of LNG1 and LNG2, the expression level of LNG1 and LNG2 was investigated using RT-PCR.

RNA was isolated from the plant tissues of lng1-2, lng1-3, lng2-1, lng2-2 using a total RNA isolation system (Qiagen, USA) according to the manufacturer's instructions. PCR was performed using the primers of SEQ ID NO: 11 and SEQ ID NO: 12 to confirm the expression of LNG1 using the isolated RNA as a template, and the primers of SEQ ID NO: 13 and SEQ ID NO: 14 to confirm the expression of LNG2. Performed: 94 ° C. 5 minutes, 94 ° C. 30 seconds 55 ° C. 30 seconds 72 ° C. 30 seconds 35 repetitions, 72 ° C. 7 minutes.

As a result, it was found that LNG1 is weakly expressed in lng1-2 and not in lng1-3. For LNG2 both lng2-1 and lng2-2 were not expressed at all (see Figure 6B).

On the other hand, double mutants (lng1-3 lng2-1) in which both lng1 and lng2 are deleted were produced by the following procedure. In other words, The homozygous mutants of lng1 and lng2 obtain heterozygous plants by contacting the lng1 pistil with pollen of lng2 on the head of lng1 pistil (cross pollination method). In later generations, there are several plant populations that go through the process of segregation. Double loss of function mutants of the homozygous lng1 lng2 were obtained by PCR under the following conditions using primers of SEQ ID NO: 19 (TGGTTCACGTAGTGGGCCATCG) and SEQ ID NO: 20 (GCGTGGACCGCTTGCTGCAACT) in the plant group: 94 5 min, 94 ° C., 30 seconds, 55 ° C., 30 seconds, 72 ° C., 30 seconds, 35 repetitions, 72 ° C., 7 minutes).

As a result of confirming whether the double mutant expresses lng1 and lng2 by the RT-PCR method, it was found that the double mutant did not express both the lng1 and lng2 genes (see FIG. 6B).

<4-2> LNG1  And LNG2 Variant  Tissue length measurement

In order to examine the function of LNG1 and LNG2, the length of each tissue of a variant in which LNG1 and LNG2 were overexpressed or deleted was measured.

Primary root, hypocotyl, leaf stem (petiole), leaf blade (leaf blade), leaf node (internode), silique and seed (seed) and the results of measuring the length of each tissue, Table 1 (unit mm) It was like

Agency Wild type lng1-1D lng1-3 lng2-1 lng1-3 / lng2-1 Leaf body (width direction) 11.2 ± 1.5 8.0 ± 1.3 11.0 ± 2.2 11.9 ± 1.5 11.4 ± 1.3 Leaf body (length direction) 21.5 ± 3.4 30.7 ± 3.8 18.3 ± 4.9 17.9 ± 3.1 15.0 ± 2.0 Leaf sack 12.6 ± 1.5 15.0 ± 1.9 12.2 ± 1.3 12.6 ± 1.4 8.0 ± 1.7 stem 20.8 ± 2.2 21.1 ± 2.4 24.4 ± 3.4 21.5 ± 5.2 17.8 ± 3.5 Internode 746.3 ± 98.0 557.7 ± 48.9 747.4 ± 95.3 788.4 ± 109.4 1201.0 ± 77.5 Axle 3.1 ± 0.4 3.5 ± 0.6 3.1 ± 0.7 2.9 ± 0.4 2.7 ± 0.4 Silique 9.5 ± 0.7 14.4 ± 1.3 9.0 ± 0.5 7.9 ± 0.8 5.7 ± 0.4 Seed (Width) 258.0 ± 24.5 242.7 ± 27.7 261.7 ± 17.6 270.3 ± 18.1 244.4 ± 22.3 Seed (length) 421.8 ± 29.1 501.0 ± 23.0 429.5 ± 24.7 437.3 ± 34.1 365.1 ± 31.1 Root 25.0 ± 6.8 23.0 ± 9.5 24.7 ± 6.2 22.2 ± 2.5 19.6 ± 7.7

lng1 -1D were the road leaves the body length is about 43% of the wild-type, leaves the body width is 29% shorter. As the length of the leaves increased, the length of the leaf bag also increased by 19% compared to the wild type, and the width narrowed slightly (6%). The length of the stem, there was no much difference between the wild type and lng1 -1D, the stem diameter is about 25% smaller than wild-type lng1 -1D. Taken together, these results lng1 -1D the mutant was found in the body leaves, leaf bags, flowers, cotyledons (cotyledon), Mr taken place, such as a longitudinal extension of the place in a variety of tissues.

For deletion mutants, the leaf body width was little different in wild type, lng1-3, lng2-1 and lng1-3 lng2-1 plants, but the leaf body length was a single gene of lng1-3, lng2-1. The mutants were 15% shorter than the wild type and the lng1-3 lng2-1 double mutants were nearly 30% short, indicating that LNG1 and LNG2 additionally (totally) regulate leaf longitudinal expansion. The petiole length of lng1-3 and lng2-1 was not substantially different from wild type, whereas lng1-3 lng2-1 double mutant was 37% shorter. Similarly, the length of the long family was about 40% short of the double mutant (Table 1 and Figure 6C). Stem diameter increased about 60% in double mutants compared to wild type.

Taken together, these results indicate that LNG1 and LNG2 promote longitudinal longitudinal expansion in several engines and inhibit stem thickness expansion.

<4-2> Lng1 -1D  Observing the Morphology of Cells of Mutants

This result is to ensure that the result of cell elongation lng1 -1D the mutant and the fifth rosette leaf of a wild-type Arabidopsis thaliana (rosette leaf) was observed by a scanning electron microscope (scanning electron microscopy) in order.

As a result, as shown in Fig. 7, it was found that the epidermal cells of the midvein and the epidermal cells near the mesenchymal veins were elongated in the longitudinal direction than those of the wild type. 7 A, B, D and E). Adaxial leaf surface of the body (adaxial side) of epidermal cells in lng1 -1D mutants were extended in the longitudinal direction as compared to the wild type (see FIG. 7C and 7F). Adaxial epidermal cells in the proximal and distal petals of the mutants also had longer and narrower forms than the wild type (Figs. 7G, H, K). , L) and silique cells were the same (FIG. 7I, J, M, N).

In order to quantitatively compare the cell sizes, the lengths and widths of 150 axial epidermal cells in mutants and wild-types were measured. , Mutants had a length of 132.6 ± 19.1 μm and a width of 59.8 ± 9.4 μm. Thus, the axial epidermal cells of the mutants were 51% longer and 28% narrower than the wild type.

In order to reconfirm the role of LNG1 and LNG2, the size of the cells was measured in the transverse and the longitudinal direction (see Table 2; unit μm). In the longitudinal direction, palisade cells were 46% longer in the lng1-1D mutant than the wild type and 24% shorter in the lng1-3 lng2-1 double mutant (see Table 2 and FIG. 8). There was no significant difference in wild type and variants in the width direction (see Table 2).

Wild type lng1-1D lng1-3 lng2-1 lng1-3 / lng2-1 Desk Cell Size (Length) 47.9 ± 5.2 69.8 ± 4.6 47.4 ± 7.9 40.8 ± 5.4 36.5 ± 3.7 Cell size (width direction) 41.5 ± 6.1 36.4 ± 2.3 41.1 ± 4.6 45.2 ± 5.2 45.7 ± 3.2 Leaf thickness (lengthwise) 45.6 ± 7.9 39.6 ± 1.8 47.6 ± 6.7 47.7 ± 5.6 51.7 ± 2.0

To determine the effect of the expression of LNG1 and LNG2 on the proliferation of the cells, the number of desk cells and mesophyll cells in the width direction or the length direction was measured. The measurement results are shown in Table 3 (unit: dog), and the measurement results showed that the degree of proliferation of the cells was not significantly changed even in the variants. It was.

Wild type lng1-1D lng1-3 lng2-1 lng1-3 / lng2-1 Longitudinal direction palisade cells 384.2 ± 35.9 395.9 ± 60.0 348.4 ± 40.7 388.3 ± 16.2 383.6 ± 69.0 mesophyll cells 976.4 ± 108.9 1033.2 ± 170.0 890.2 ± 112.6 998.3 ± 112.9 1017.8 ± 98.6 Width direction palisade cells 113.0 ± 12.5 116.4 ± 17.3 108.2 ± 7.7 116.2 ± 9.2 116.7 ± 14.3 mesophyll cells 307.2 ± 26.9 347.0 ± 45.0 281.4 ± 33.4 341.0 ± 14.2 302.5 ± 21.4

These results indicate that the change in the size of the leaf body in the mutant is not due to the change in cell proliferation, but rather that LNG1 and LNG2 regulate the leaf elongation by regulating the degree of proliferation of the cells to promote the elongation of the cells. .

As described above, the method of the present invention has the effect of changing the shape of the plant, in particular, the shape of the leaves, flowers, hypocotyls, long shells, and seed tissue. Therefore, the method of the present invention can be used for the production of heterologous plants in which the shape of the plant is changed.

Figure 1 is a picture comparing the wild type (Col-0) and representation of lng1 -1D mutants of the present invention.

A: 27 days old wild-type and mutant Arabidopsis lng1 -1D

B: 39 day-old wild-type and lng1 -1D rosette (rosette) leaves of the mutant Arabidopsis thaliana

C: lng1 -1D of wild-type and mutant Arabidopsis flowers

D: the wild-type and mutant Arabidopsis lng1 -1D janggakgwa (silique)

E: lng1 -1D of wild-type and mutant Arabidopsis seeds

F: wild type and mutant of Arabidopsis cotyledons lng1 -1D

Figure 2 is a comparison of the height of the wild-type and mutated Arabidopsis lng1 -1D fifth rosette leaf of the rod in cross section (A) and longitudinal sectional view (B) directed graph.

Figure 3 is a results of testing the expression of the inserted T-DNA region near the gene in the schematic view (A) and wild-type and mutant lng1 -1D of T-DNA insertion site of lng1 -1D.

Figure 4 is a photograph showing the phenotype of Arabidopsis transformed to overexpress LNG1 and LNG2 by the CaMV 35S promoter.

Figure 5 is a photograph showing the expression sites of the promoter of the LNG1 and LNG2 by X-Gluc staining.

A to C: LNG1 promoter (transformer)

D: LNG1 promoter (flower)

E to G: LNG2 promoter (transformer)

H: LNG2 promoter (flower)

Figure 6 is a photograph showing a change in the phenotype of the mutation according to the expression level of LNG1 and LNG2.

A: T-DNA insertion site of lng1 -2 , lng1 -3 , lng2 -1 , lng2 -2 mutants

B: wild-type, lng1 -3, lng2 -1, lng1 -3 lng2 -1, lng1 -1D LNG1 LNG2 and expression analysis of the mutant

C: wild-type, lng1 -3, lng2 -1, lng1 -3 lng2 -1, lng1 -1D phenotypic comparison of the mutant

Figure 7 is a photograph observing the epidermal cells of the wild-type and mutated Arabidopsis thaliana lng1 -1D a scanning electron microscope (SEM).

A to C: Leaves of Wild-type Arabidopsis

D to F: lng1 -1D of mutant Arabidopsis thaliana leaf

G: Circular adaxial petal epidermis of wild type Arabidopsis

H: proximal adaxial petal epidermis

I to J: silique of wild-type baboons

K: lng1 -1D mutant of Arabidopsis thaliana one-adaxial epidermal petal cells

L: lng1 -1D roots of Arabidopsis thaliana mutant-petal adaxial epidermal cells

M to N: lng1 -1D janggakgwa of mutant Arabidopsis thaliana

FIG. 8 is a photograph showing the results of observing the longitudinal (root axis axis; A to E) cutting plane and the transverse (left and right axis; F to G) cutting plane of the fifth leaf fully grown under a microscope and a paramalmal image; FIG. to be.

A, F, K: Col-0

B, G, L: lng1 -3

C, H, M: lng2 -1

D, I, N: lng1 -3 lng2 -1

E, J, O: lng1 -1D

Attach sequence list electronic file  

Claims (18)

A method of changing the morphology of a plant by adjusting the intracellular level of a polypeptide having an amino acid sequence represented by SEQ ID NO: 1. The method of claim 1, wherein said regulating said intracellular level is to increase or decrease expression of a polynucleotide encoding said polypeptide. The method of claim 2, wherein the polynucleotide has a nucleotide sequence represented by SEQ ID NO: 2. The method of claim 1, wherein the plant is Arabidopsis, Chinese cabbage, cabbage, mustard, rape (rapeseed), radish, Homu ( Brassica) napobrassica ), turnip ( Brassica rapa / Brassica campestris), tree, kale, cauliflower, broccoli, horseradish, wasabi Stork pole herbs, kkotdaji, sanggat (Brassica juncea), freshly pressed (Brassica napus ), Brassica oleracea ( Brassica oleracea , Kohlrabi caulorapa), Brassica Pim other Calabria (Brassica fimbriata ), Brassica lubo ruvo), Brassica septi kepseu (Brassica septi - ceps ), black mustard ( Brassica nigra ), Cochlearia officinalis ), Mustard Radish ( Armoracia lapathifolia ), Descurainia pinnata ), Aubrieta deltoidea ) A method of changing the shape of a plant, characterized in that it is selected from a pizza plant. A method of controlling the growth of plant cells by controlling the intracellular level of the polypeptide having the amino acid sequence represented by SEQ ID NO: 1. 6. The method of claim 5, wherein said regulating said intracellular levels increases or decreases the expression of a polynucleotide encoding said polypeptide. The method according to claim 6, wherein the polynucleotide has a nucleotide sequence represented by SEQ ID NO: 2. The method of claim 5, wherein the plant cells are cells of plant tissue selected from the group consisting of leaves, flowers, and seeds. The method of claim 5, wherein the plant cells are Arabidopsis, cabbage, cabbage, mustard, rape (rapeseed), radish, Homu ( Brassica) napobrassica ), turnip ( Brassica rapa / Brassica campestris), tree, kale, cauliflower, broccoli, horseradish, wasabi Stork pole herbs, kkotdaji, sanggat (Brassica juncea ), brassica napus ), Brassica oleracea ( Brassica oleracea , Kohlrabi caulorapa), Brassica Pim other Calabria (Brassica fimbriata), Brassica rubo (Brassica ruvo), Brassica septi kepseu (Brassica septi - ceps ), black mustard ( Brassica nigra ), Cochlearia Officinalis officinalis ), Mustard ( Armoracia lapathifolia ), Descurainia pinnata ), a method of controlling the growth of plant cells, characterized in that the cells of the plant selected from the pizza plant consisting of Aubrieta deltoidea ( Aubrieta deltoidea ). A method for producing a plant with a changed form, comprising the step of transforming a plant with a polynucleotide encoding a polypeptide having an amino acid sequence represented by SEQ ID NO: 1. The method of claim 10, wherein the polynucleotide has a nucleotide sequence represented by SEQ ID NO: 2. A method for producing a plant cell having a changed form, comprising introducing a polynucleotide encoding a polypeptide having an amino acid sequence represented by SEQ ID NO: 1 into a plant cell. The method of claim 12, wherein the polynucleotide has a nucleotide sequence represented by SEQ ID NO: 2. A plant cell produced by the method of claim 12 or 13. Plant tissue comprising the plant cell of claim 14. The plant tissue of claim 15, wherein the plant tissue is selected from the group consisting of leaves, flowers, and seeds. A plant comprising the plant cell of claim 14. The method of claim 17, wherein the plant is Arabidopsis, Chinese cabbage, cabbage, mustard, rape (rapeseed), radish, Homu ( Brassica) napobrassica ), turnip ( Brassica rapa / Brassica campestris), tree, kale, cauliflower, broccoli, horseradish, wasabi Stork pole herbs, kkotdaji, sanggat (Brassica juncea), freshly pressed (Brassica napus ), Brassica oleracea ( Brassica oleracea , Kohlrabi caulorapa), Brassica Pim other Calabria (Brassica fimbriata), Brassica rubo (Brassica ruvo), Brassica septi kepseu (Brassica septi - ceps ), black mustard ( Brassica nigra ), Cochlearia officinalis ), Mustard Radish ( Armoracia lapathifolia ), Descurainia pinnata ), Aubrieta deltoidea ) A plant characterized by being selected from a pizza plant.

Images