KR100781386B1 - Recombinant Saccharomyces cerevisiae containing protein disulfideisomerase1 coding gene and Ero1 coding gene with a capacity of hirudin production, and Method for production of hirudin from it - Google Patents

Abstract

In the present invention, a gene encoding protein isulase 1 and a gene encoding IALO1 are simultaneously introduced into a recombinant Saccharomyces cerevisiae into which a gene encoding a hirudin protein is introduced. The present invention relates to a method for producing rudin protein, wherein final concentration of 1.1 g / L can be obtained by fed-batch hirudin protein.

Hirudin, yeast, protein disulfide isomerase 1, IAO 1

Description

Recombinant Saccharomyces cerevisiae containing protein and a method for producing a hirudin-producing recombinant Saccharomyces cerevisiae which simultaneously introduces a gene encoding a protein disulfide isomerase 1 and a gene encoding ialio1 disulfideisomerase1 coding gene and Ero1 coding gene with a capacity of hirudin production, and Method for production of hirudin from it}

1 is a schematic diagram of a pMPDI1 vector in which a gene encoding Pdi1 protein is inserted, a pMERO1 vector in which Ero1 protein is inserted and a pMPDERO1 vector map in which a gene encoding Ero1 protein and a gene encoding Pdi1 protein are simultaneously inserted. .

Figure 2 is a graph showing the hirudin production ratio, and the total change in Hi Ruthin production ERO1, PDI1 gene into strains respectively or at the same time according to the change of time.

3 is ERO1, PDI1 is a Western Blossom putting pictures gene that shows the amount in the accumulated hirudin in the cell strains into each, or at the same time.

4 is a graph showing the results of fed-batch culture ERO1, it isolates the PDI1 gene into the same time.

The present invention relates to a method for producing hirudin protein using Saccharomyces cerevisiae , and more particularly, to a recombinant Saccharomyces cerevisiae in which a gene encoding a hirudin protein is introduced. And a gene encoding protein disulfide isomerase 1 and a gene encoding IALO1 are simultaneously produced.

Hirudine is a small protein with a molecular weight of 7,000 Da consisting of 65 to 66 amino acids secreted from the blood-sucking leech, Hirudo medicinalis , which specifically inhibits thrombin activity. Fibrinogen, the last step in the mechanism, prevents blood from clotting by activating fibrin. It is reported that hirudin has the strongest and specific activity of thrombin activity inhibitors known to date, and has less localized bleeding side effects and selective thrombin only compared to blood coagulation inhibitors such as heparin currently used clinically. It has many advantages, such as not requiring cofactors such as antithrombin factor III and many studies have been conducted to develop antithrombotic agents.

Saccharomyces cerevisiae , on the other hand, was first used for the production of interferon in 1981 (Hitzeman et al. Nature, 1981, vol.293, p.717), and is useful for producing useful foreign proteins. It has been widely used.

Yeasts can use their intracellular expression and secretion systems to secrete proteins of interest in their active form, and the N-terminal methionine removal, glycosylation, and disulfide bonds can be achieved. It has a system of posttranslationmodification, such as bonds.

As such, when foreign protein is produced using yeast, it is safe for human body and can be obtained in a form similar to protein expressed in animal or human cells, and refining process is simpler and refolded after fermentation compared to E. coli expression system. There is an advantage in that you can obtain an active foreign protein immediately without such a process.

However, in the case of producing recombinant proteins in yeast, the productivity is significantly different according to the protein, and most of them have a relatively small amount of production.

In the case of hirudin protein, also produced using Saccharomyces cerevisiae , the specific yield of hirudin is maximum when 10 copies of the gene encoding hirudin is contained, but the growth of yeast There is a problem that the total yield is not significantly increased, and the growth of cells is increased when the gene encoding the hirudin is kept below 4 copies in order to increase the growth of the yeast, but the specific yield of hirudin is lowered, After all, there is a problem that the total output does not increase.

Accordingly, the present invention provides a method for producing hirudin protein using Saccharomyces cerevisiae , and provides a recombinant strain for increasing the total production of hirudin protein and a method for producing hirudin using the same. have.

In order to achieve the above object, the present invention encodes a gene encoding protein isulfide isomerase 1 and IAO 1 in Saccharomyces cerevisiae transformed with a gene encoding a hirudin protein. It provides a recombinant Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) characterized in that the gene is introduced at the same time and a method of producing hirudin using the same.

Hereinafter, the present invention will be described in more detail.

The present invention is a problem that occurs in Saccharomyces cerevisiae recombined with a gene expressing hirudin, to overcome the small amount of protein production, disulfide bond in the protein molecule (disulfide bond) Endoplasmic reticulum oxydori known as a factor that regulates oxidation and reduction in endoplasmic reticulum (ER) and genes encoding Protein Disulfide Isomerase 1 (PDI1) proteins known to induce A gene encoding Endoplasmic Reticulum Oxidoreductase 1: ERO1 protein was introduced into Saccharomyces cerevisiae , which was recombined with a gene expressing hirudin.

The strain used in the present invention may be any of Saccharomyces cerevisiae recombined to produce hirudin, but preferably stains a hirudin expression cassette induced by galactose expression. Saccharomyces cerevisiae (Recombination Saccharomyces cerevisiae ) containing 10 copies of the sieve is preferred.

Ero1 and Pdi1 protein coding genes to be inserted in the present invention are introduced by a method of transformation into a recombinant Saccharomyces cerevisiae so that the vector containing these genes can produce hirudin.

On the other hand, preferably the Ero1 and Pdi1 gene is cloned from Saccharomyces cerevisiae ( Saccharomyces cerevisiae ).

In addition, the vector is preferably inserted into a specific position in the genome of Saccharomyces cerevisiae , which is cleaved by restriction enzymes to produce hirudin in a linear form, more preferably. Is preferably introduced by homologous recombination into the URA3 gene.

Gene introduction by an integration method can prevent the phenomenon that the vector containing a specific gene is lost during the culture. In addition, when the host is transformed into a cyclic form, the burden of the cells due to the presence of an excessive copy can be prevented from reducing the growth rate of the cells.

As a result of measuring the amount of hirudin secreted outside the transformants into which the Ero1 and Pdi1 genes were introduced alone or simultaneously, the yield of hirudin was significantly increased in the transformants overexpressing either Ero1 or Pdi1. In addition, transformants overexpressing Ero1 and Pdi1 simultaneously exerted mutual synergistic effects on hirudin production at a statistically significant level, significantly increasing their yield.

In addition, in the present invention, the amount of hirudin present inside the transformant was measured by Western blotting using a hirudin-specific binding antibody. As a result, the expression of Ero1 and Pdi1 proteins prevented the secretion of extracellular and accumulated in cells. It can be seen that the amount of rudin decreases, the largest decrease when the Ero1 and Pdi1 protein is co-expressed.

In addition, a fed-batch culture supplying galactose used as the carbon source of the strain was performed, and as a result of comparing the growth of the cells and the production of hirudin, the control strain was unable to grow properly due to the expression of hirudin, so the galactose Although the fed-batch cultivation step of injecting the scavenger is almost impossible (not shown), the strains in which the Ero1 and Pdi1 proteins of the present invention are simultaneously expressed show smooth growth of cells and hirudin production (maximum concentration of hirudin-1.1 g / L). ). This was obtained from a continuous cell recycling process reported by Chi-Min Choi et al., Effects of medium composition on hirudin production in recombinant Saccharomyces cerevisiae, Biotechnology letters Volume 18 No. 10 (October 1996) pp. 1129-1132. It is about 2.4 times higher than the maximum hirudin concentration, 460 mg / l.

Example 1 : Protein Disulfide isomerase 1  The gene that encodes I know  Recombination with the gene encoding Saccharomyces  Serenity ( Saccharomyces  cerevisiae Production of Hirudine Protein Using 2805

In this Example, the recombinant saccharo cerevisiae 2805 [ Matα ; pep4 :: HIS3 prb1 can1 his3 ura3 -52 ] (Kim et al. (2004) Appl. Micobiol. Biotechnol. 65: 259-262) (Myoung-Dong Kim et al., Enhanced production of anticoagulant hirudin in recombinant Saccharomyces cerevisiae by chromosomal δ-integration, Journal of Biotechnology 85 (2001) 41-48; Myoung-Dong Kim et al., Coexpression of BiP increased antithrombotic hirudin production in recombinant Saccharomyces cerevisiae , Journal of Biotechnology 101 (2003) 81-87).

The vector for expressing the Ero1 and Pdi1 proteins was a pMURA (5.9 kb) in which a linear fragment obtained by cleaving pESC-URA (Stratagene, La Jolla, USA) with MunI and SnaBI was conjugated with T4 DNA ligase. Was used. Genes encoding Ero1 and Pdi1 proteins were subjected to polymerase chain reaction using a primer consisting of the base sequences specified below from the 2805 chromosome to Saccharomyces cerevisiae, based on the nucleotide sequences reported to the gene bank. Obtained using.

Two primers for the amplification of the gene encoding protein Ero1 i.e., ERO1F (5'-CGC GGATCC CAGTAACGTGCAGGTAAAACATGA -3 ') and ERO1R (5'-CC GCTCGAG TTATTGTATATCTAGCTTATAGGAAATA- 3' was used), Pdi1 to amplify the protein coding gene PDI1F (5'-ATAAGAAT GCGGCCGC CATACATCTATCCCGTTATGAAG-3 ') and PDI1R (5'-GG ACTAGT TTACAATTCATCGTGAATGGCATC-3') were used.

Ero1 and Pdi1 protein coding genes obtained through polymerase chain reaction were digested with Bam HI / Xho I and Not I / Spe I, respectively, and then inserted into pMURA vector digested with the same restriction enzymes, pMPDI1 (7.6 kb) and pMERO1. (7.6 kb) vector was completed (see FIG. 1). In addition, Ero1 protein gene digested with Bam HI / Xho I restriction enzyme was inserted into pMPDI1 vector to construct pMPDERO1 (9.2 kb) vector, and Ero1 and Pdi1 proteins were designed to be induced simultaneously by galactose (see FIG. 1). .

Four vectors prepared in this example, that is, the control pMURA, and the pMPDI1, pMERO1, and pMPDERO1 vectors were cut and linearized by Xcm I restriction enzymes, respectively, and transformed by lithium acetate method to induce expression by galactose. Ero1 and Pdi1 protein expression cassettes were allowed to be introduced at the URA3 site of the yeast chromosome. Transformants were selected in restriction media lacking uracil.

Meanwhile, as a result of measuring the amount of hirudin secreted to the outside of the transformant, as shown in FIG. 2, in the case of the transformant overexpressing only one of Ero1 or Pdi1 (in FIG. 2, Ero1 is an equilateral triangle, Pdi1 The addition of is shown in the inverted triangle) significantly increased the production of hirudin compared to the control (circled in Figure 2), but in the case of transformants overexpressing Ero1 and Pdi1 at the same time (shown in square in Figure 2) Was found to have a synergistic effect on cell growth and hirudin production.

In addition, as a result of measuring the amount of hirudin present in the transformant produced in the present invention using a Western blot using an antibody, Figure 3 ("-in Figure 3 is not inserted into the gene," + "Indicates that the gene is inserted), the co-expressing transformants of the Ero1 and Pdi1 proteins were confirmed to decrease the amount of hirudin accumulated in the cells without being secreted into the cells.

Induces hirudin expression from a strain transformed with a pMURA vector, which is a control vector, to a recombinant yeast containing a Hirudine expression cassette on the chromosome, the expression of which is induced by galactose, and a strain containing the pMPDERO1 vector produced in the present invention. Fed-batch culture was performed to supply galactose used as the carbon source. As a result, the control strain was unable to grow properly due to the expression of hirudin, and the fed-batch culture process of injecting galactose was almost impossible (not shown), and co-expressing strains of the Ero1 and Pdi1 proteins of the present invention were smooth. It was confirmed that the growth of cells and the hirudin production pattern (maximum concentration of hirudin 1.1 g / L, see Figure 4).

As described above, Saccharomyces cerevisiae co-expression of Ero1 and Pdi1 of the present invention is very useful in the biological industry because it significantly increases the production of hirudin.

Claims (6)

Saccharomyces cerevisiae transformed with a gene encoding a hirudin protein is characterized by the simultaneous introduction of a gene encoding protein disulfide isomerase 1 and a gene encoding Ialo1 Recombinant Saccharomyces cerevisiae ). The method of claim 1, The protein disulfide iso-epimerase first and yial O 1 is saccharide as MY process three Levy jiae (Saccharomyces cerevisiae) a recombinant Saccharomyces My process three Levy jiae (Saccharomyces cerevisiae) in which characterized in that in the cloning. The method of claim 1, The recombinant Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) is a recombinant Saccharomyces cerevisiae ( Saccharomyces cerevisiae ), characterized in that it contains 10 copies of the Hirudine expression cassette induced expression by galactose on the chromosome. The method of claim 1, Recombinant Saccharomyces, characterized in that the gene encoding the proteinase sulfide isomerase 1 and the gene encoding Ialoh1 is inserted at a specific gene position in the genome of Saccharomyces cerevisiae ( Saccharomyces cerevisiae ). Saccharomyces cerevisiae . The method of claim 4, wherein A specific gene in the genome of Saccharomyces cerevisiae into which the gene encoding the protein disulfide isomerase 1 and the gene encoding IALO 1 is inserted is a URA3 gene. Saccharomyces cerevisiae . Method for producing a hirudin protein, characterized in that using the recombinant Saccharomyces cerevisiae of claim 1.

Images